ID: 1169230892

View in Genome Browser
Species Human (GRCh38)
Location 20:3888510-3888532
Sequence AAGGGTCAGGGTCTCAGTCC TGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 3 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1169230882_1169230892 14 Left 1169230882 20:3888473-3888495 CCGGGCTTGGGCAGCCTTTGGTA No data
Right 1169230892 20:3888510-3888532 AAGGGTCAGGGTCTCAGTCCTGG No data
1169230886_1169230892 0 Left 1169230886 20:3888487-3888509 CCTTTGGTAGTGGGGATGCTTGG No data
Right 1169230892 20:3888510-3888532 AAGGGTCAGGGTCTCAGTCCTGG No data
1169230880_1169230892 18 Left 1169230880 20:3888469-3888491 CCTTCCGGGCTTGGGCAGCCTTT No data
Right 1169230892 20:3888510-3888532 AAGGGTCAGGGTCTCAGTCCTGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1169230892 Original CRISPR AAGGGTCAGGGTCTCAGTCC TGG Intergenic
No off target data available for this crispr