ID: 1169232957

View in Genome Browser
Species Human (GRCh38)
Location 20:3905026-3905048
Sequence CTGGAGCCCCAGAATCAGGA TGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 324
Summary {0: 1, 1: 0, 2: 7, 3: 24, 4: 292}

Found 4 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1169232957_1169232963 18 Left 1169232957 20:3905026-3905048 CCATCCTGATTCTGGGGCTCCAG 0: 1
1: 0
2: 7
3: 24
4: 292
Right 1169232963 20:3905067-3905089 ACTTTGCTTCTGTCAGTGTTGGG 0: 1
1: 0
2: 0
3: 27
4: 277
1169232957_1169232962 17 Left 1169232957 20:3905026-3905048 CCATCCTGATTCTGGGGCTCCAG 0: 1
1: 0
2: 7
3: 24
4: 292
Right 1169232962 20:3905066-3905088 GACTTTGCTTCTGTCAGTGTTGG 0: 1
1: 0
2: 1
3: 20
4: 193
1169232957_1169232964 19 Left 1169232957 20:3905026-3905048 CCATCCTGATTCTGGGGCTCCAG 0: 1
1: 0
2: 7
3: 24
4: 292
Right 1169232964 20:3905068-3905090 CTTTGCTTCTGTCAGTGTTGGGG 0: 1
1: 0
2: 4
3: 42
4: 384
1169232957_1169232965 30 Left 1169232957 20:3905026-3905048 CCATCCTGATTCTGGGGCTCCAG 0: 1
1: 0
2: 7
3: 24
4: 292
Right 1169232965 20:3905079-3905101 TCAGTGTTGGGGATAGAACATGG 0: 1
1: 0
2: 1
3: 36
4: 262

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1169232957 Original CRISPR CTGGAGCCCCAGAATCAGGA TGG (reversed) Intronic
900567072 1:3338729-3338751 CTGGAGCCCCAGAGGCAGCCAGG + Intronic
900667883 1:3827851-3827873 CTGGAGCCCCAGCTCCATGAGGG + Intronic
901447274 1:9316207-9316229 CCGGAGCCCCAGGGTCAGGGAGG - Intronic
901631578 1:10650822-10650844 CTGGAGCCCCAGGGTCGGGCAGG - Intronic
901792542 1:11661917-11661939 GTGGAGCCCCAGAAGCTAGATGG + Exonic
902438960 1:16416768-16416790 CCTGAGCCCCAGAAATAGGATGG + Intronic
903058651 1:20654324-20654346 CTGGAGCCCAGCAATGAGGAGGG + Exonic
903225959 1:21894385-21894407 CTGGGACCCCAGGATCAGGGAGG + Intronic
903271356 1:22190369-22190391 CAGGAGCACCAGAATGGGGAAGG + Intergenic
904377235 1:30089639-30089661 CTGGGGGCTCAGAGTCAGGAGGG + Intergenic
904494387 1:30878462-30878484 CTGGATCCCCAGAACAAGAAGGG - Intronic
904542170 1:31240303-31240325 CTGGAGCCCTAGAGACAGGGTGG - Intergenic
905477546 1:38239495-38239517 CTGGAGCCTCAGAACCAAGGTGG - Intergenic
905872698 1:41414314-41414336 CTGCAGCCCCAGGAGCAGGAGGG + Intergenic
906150893 1:43587096-43587118 CTGGAGCACCAGAGTAAGGCAGG + Intronic
907044085 1:51289098-51289120 CTGGAGCCCAAGGTACAGGATGG - Intronic
907399708 1:54217375-54217397 CTGAAGACACAGAGTCAGGAGGG - Intronic
910493163 1:87795392-87795414 CTGGAGGCTCAGAACCAGCAAGG - Intergenic
910943077 1:92558121-92558143 CAGGAGTCCCAGAAGGAGGAAGG - Intronic
913201191 1:116496332-116496354 CTGGTCCCACAGAATCAGCATGG + Intergenic
914255709 1:145960382-145960404 CTGGCGCCCCGGCATAAGGAGGG + Exonic
915076281 1:153310618-153310640 CTGGAGACCCAGAATGAAGAAGG + Exonic
915347219 1:155203637-155203659 CTGGAGCCCCAGAATAAAGATGG + Intronic
915983804 1:160442925-160442947 TTGGAGACTCAGAAGCAGGAAGG - Intergenic
916662750 1:166937046-166937068 CTGTAGCATCAGAATAAGGATGG + Intronic
917797869 1:178544701-178544723 CTGGATCCCCAGCACCTGGAAGG + Intronic
918613078 1:186513853-186513875 GTGGAGCCCAAGACTTAGGAGGG - Intergenic
920697119 1:208189406-208189428 CAGGAGGCCCAGAATAGGGAGGG + Intronic
921925846 1:220709713-220709735 ATGGAGCCCCAGAATTTGTATGG - Intergenic
924290488 1:242531226-242531248 CTAGAACCACTGAATCAGGAGGG - Intergenic
924440782 1:244083456-244083478 GTGGAGCTCCAGATTCAGGAAGG + Intergenic
1063222797 10:3986374-3986396 CTGGATCCCCAAAATCTGGTAGG - Intergenic
1063436585 10:6036965-6036987 CTGCAGCCCCAGCATCATGTAGG - Intronic
1065200008 10:23303875-23303897 GTGGAGCCCAAGACTGAGGAGGG + Intronic
1065540705 10:26763925-26763947 GTGGAGCTCCAGAAGGAGGAGGG + Exonic
1067550337 10:47229835-47229857 TTGGAAACTCAGAATCAGGAAGG - Intergenic
1067766979 10:49094196-49094218 CTGGAGCCTCAGAAGCAGTGGGG + Intronic
1067782067 10:49215000-49215022 CTGGAACCCCAGAAGCAAGGGGG + Intergenic
1067902081 10:50252716-50252738 CTGCAGACCCAGGATCAGGATGG + Intergenic
1069818057 10:71211162-71211184 CTGGGCACCCAGCATCAGGAGGG - Intergenic
1069949832 10:72011182-72011204 CTGGAGCGCCAGCACCACGATGG + Exonic
1070313072 10:75287702-75287724 ATGGAGCAGCAGAATGAGGAGGG - Intergenic
1070410150 10:76132239-76132261 TTGGAGCCCAAGAAGCAGGAAGG + Intronic
1070923656 10:80204725-80204747 CTTGATCCCCAGTTTCAGGAAGG - Intronic
1071844079 10:89503798-89503820 CTGGGGCCACAGCAACAGGAAGG + Intronic
1072872907 10:99139271-99139293 CTGGAGACTCAGAAGCAGAAGGG + Intronic
1074198012 10:111206381-111206403 CAGGAGCCCCAGACTCACCAAGG + Intergenic
1074520956 10:114223414-114223436 CTGGAGCCCAAGATTGAGGAAGG - Intronic
1075885617 10:125896643-125896665 ATGGAGCCCCAGAGTAAGGGAGG + Exonic
1076105896 10:127823410-127823432 CTGGGGCTCAAGAATCAGGCTGG + Intergenic
1076546520 10:131249087-131249109 CTGGATTCCCAGCATCAGGCTGG - Intronic
1076800709 10:132826746-132826768 CTGGAGCCACAGAGCCAGGCAGG + Intronic
1077198417 11:1293139-1293161 CTGGAGCACCAGCAGCACGAGGG + Intronic
1078294225 11:10049923-10049945 AATGAGCCTCAGAATCAGGAAGG + Intronic
1082255027 11:50024529-50024551 CTGGAGACTCAGAAGCGGGAAGG - Intergenic
1082820401 11:57541037-57541059 CTGGAGCCGCTGAACCAGGAAGG + Intergenic
1083132662 11:60640300-60640322 CTGGAGACTCAGAAGCGGGAGGG + Intergenic
1083276689 11:61600877-61600899 CTGAAGCCCCAGACTCAGGTTGG - Intergenic
1083826216 11:65205463-65205485 CTGGAGCCTCTGACTCAGAATGG + Intronic
1084153911 11:67303536-67303558 CTGGACCCGCAGGACCAGGAAGG - Exonic
1084399973 11:68937805-68937827 CTGGAGCCCCAGGCTCTGGGAGG - Intronic
1084547301 11:69820801-69820823 CTGGAGCCTCAGACTCTTGATGG + Intergenic
1085427522 11:76417851-76417873 CTGGAGCCCCAGTAGCACCATGG - Intergenic
1085677114 11:78533131-78533153 CTGGAGCCCCAGCACCAGCATGG + Intronic
1089102325 11:115973952-115973974 CTGGAGTCACAGAAACTGGATGG - Intergenic
1089394987 11:118130831-118130853 CTGGAGCTCCTGAATTGGGAGGG + Intergenic
1089662471 11:119994384-119994406 CTTAACCCCCAGAATCAGAATGG + Intergenic
1090051126 11:123380832-123380854 CTCCAGTCCCAGAATGAGGAGGG - Intergenic
1090262022 11:125328090-125328112 CTGGAACCCCAGCACCAGGAGGG + Intronic
1090969325 11:131626678-131626700 CTGGAACCCAAGAATCTGCAAGG + Intronic
1091694924 12:2622066-2622088 CTGGAGGCCAAGAGCCAGGAAGG + Intronic
1091761955 12:3093337-3093359 CCCTTGCCCCAGAATCAGGATGG - Intronic
1096004906 12:48161637-48161659 CTGGACACCCAGATTCAGGAGGG + Intronic
1096878361 12:54647792-54647814 CTGAAGCCCCAGAATCATTTTGG - Intronic
1098081607 12:66791834-66791856 CTGGAGACTCAGAAGCAGGGAGG - Intronic
1098141418 12:67453673-67453695 CTGGCGCGGCAGAATGAGGAGGG + Intergenic
1099671883 12:85704758-85704780 CTTAAGCCCCACAATCAGAAAGG - Intergenic
1103040105 12:117687914-117687936 CTGGAGACCCAGGCTCAGAAAGG - Intronic
1103424656 12:120822671-120822693 CTTGAGCCCCAGAGCAAGGAGGG + Intronic
1104924702 12:132308162-132308184 CTGGAGCCCCAGGAGCTGGGAGG + Intronic
1104970975 12:132530570-132530592 GTGGAGACCCAGAAGCAGAAGGG - Intronic
1105747205 13:23388716-23388738 CTGGAGACTCAGAAGCAGGGAGG + Intronic
1108493230 13:51001375-51001397 CTGGAGCCTGAGAAGCAGGTTGG + Intergenic
1108727582 13:53200039-53200061 CAGCAGCCACAGAATCAGCAAGG - Intergenic
1109076896 13:57846945-57846967 CGTGAGCCTCAGAATCATGATGG + Intergenic
1115467633 14:33733019-33733041 CTGGAGCCCCTGACCCAGTAAGG - Intronic
1118422186 14:65618859-65618881 ATAGAGCCCAAGACTCAGGAGGG - Intronic
1119556018 14:75553217-75553239 CTGGTGCCCTAGAAGCAGTAGGG - Intergenic
1119732367 14:76958922-76958944 GTGGAGCCCCAGGCTCAGAAGGG - Intergenic
1121119211 14:91365284-91365306 CTGGAGCCCATGAAGCAGGTAGG + Intronic
1121739822 14:96243463-96243485 CTGGAGAGCCAGAACCTGGAGGG + Exonic
1122836085 14:104431784-104431806 CTGCAGCTCCAGAAGCAGGAGGG + Intergenic
1122954866 14:105065906-105065928 CTGCAGCCCCGGGACCAGGATGG + Intergenic
1122964695 14:105117112-105117134 GTTGGACCCCAGAATCAGGAGGG - Intergenic
1202872451 14_GL000225v1_random:177297-177319 ATGGAGCCCCAGAGTAAGGGAGG - Intergenic
1124649254 15:31462927-31462949 CTGGTGACCCACAATCAGAAAGG - Intergenic
1127361220 15:58246641-58246663 GTGGAGCCTCAGGCTCAGGAAGG + Intronic
1130096738 15:80861669-80861691 CTTGAGCCCCAGAAACAAGTAGG + Intronic
1130564022 15:84979924-84979946 TTGGAGCCCCAGAAGCGGCAAGG + Intergenic
1131652179 15:94412062-94412084 ATGGAGCCACAGAATGAGGTAGG + Intronic
1131858851 15:96629622-96629644 CTGGAGCCCGGGAGTCAGGGTGG + Intergenic
1132472368 16:112647-112669 CTGGAGCGCCAGGATCAGCTTGG + Exonic
1132932186 16:2464406-2464428 CTGGAGCCTCAGAAGGAGGGAGG + Intronic
1133504395 16:6397093-6397115 TTGGAGTCCCAGAAAGAGGAAGG + Intronic
1133947132 16:10357949-10357971 CTGGAACCCCAGATTCCAGAAGG - Intronic
1135483569 16:22843837-22843859 CTGAAGACCCACAATCAGAAAGG + Intronic
1135834724 16:25814854-25814876 ATGGAGCCACAAATTCAGGAAGG + Intronic
1136285405 16:29237554-29237576 CAGCAGCCCCAGAAGCTGGAAGG - Intergenic
1136995874 16:35187821-35187843 CTGGAGCCTCAGAGCCAGGTGGG - Intergenic
1137971708 16:52991915-52991937 CTGGAGACTCAGAATGGGGAGGG + Intergenic
1138341265 16:56290521-56290543 CTGGAGACCCAGAATGAGTTTGG + Intronic
1139939667 16:70596157-70596179 CTGTAGCCTCAGAGGCAGGAGGG + Intronic
1142090730 16:88207686-88207708 CAGCAGCCCCAGAAGCTGGAAGG - Intergenic
1142133941 16:88443148-88443170 CTGGAGACCCAGGATGTGGACGG + Intergenic
1143347012 17:6257169-6257191 CCCAAGCCCCAGAATCAGGCAGG - Intergenic
1144782224 17:17813979-17814001 TTGGAGGCCCTGCATCAGGAGGG - Intronic
1145890051 17:28407845-28407867 CAGGAGTCCGAGACTCAGGATGG + Intergenic
1146369841 17:32258796-32258818 CTGGAGCTCCATATTCAGTATGG - Intergenic
1147916205 17:43888422-43888444 ATGGAGCCCCAGAGTGAGGGAGG + Intronic
1148953875 17:51337438-51337460 CAGAAGCCTCAGAATCAGGGAGG - Intergenic
1151382250 17:73733991-73734013 CTGGAGCCCCAGGAGCAAGGAGG - Intergenic
1151419715 17:73989199-73989221 CTGGAGCCCAAGGACCAGGGCGG - Intergenic
1153271563 18:3327413-3327435 ATGGACCTCCAGAATCAGGAAGG + Intergenic
1153361463 18:4202340-4202362 CTGGAGCCTCAGAATGAGGAAGG + Intronic
1153814443 18:8780427-8780449 CTCGAGCCCCAGGCTCAAGAAGG + Intronic
1155073741 18:22337816-22337838 CTGGTGCCCCAGCCTCAGGGAGG - Intergenic
1155087290 18:22470980-22471002 CTGGAGCCCCAGAAGCTGGCTGG + Intergenic
1156486343 18:37468357-37468379 CTGGAGCTCCAGAAGAAGGTTGG + Intronic
1158689571 18:59648446-59648468 CTGTAGCCCCAGCATTTGGAAGG + Intronic
1158816423 18:61103169-61103191 CTGGAGACTCAGAAGCAGGGAGG + Intergenic
1159005171 18:63004663-63004685 GTGGAGACCCAGAGCCAGGAGGG + Intergenic
1159626842 18:70704999-70705021 TTGGAGCCTCAGGGTCAGGAAGG + Intergenic
1160345550 18:78129120-78129142 CTGGAGCCCCAGAAGCTGGAGGG + Intergenic
1160774373 19:848322-848344 CCCGAGCCCCAAACTCAGGATGG + Intergenic
1160845222 19:1163342-1163364 CTGGAGCCCCGGAAGCTGGGAGG + Intronic
1160911271 19:1474884-1474906 CCGCAGCCCCAGCATCAGGAGGG + Exonic
1162086743 19:8253980-8254002 TTGGAGGCCCAGAGTCAGAAAGG - Intronic
1163255869 19:16155500-16155522 TTGAAGCCCCAGGGTCAGGAAGG + Intronic
1164397383 19:27877931-27877953 CTGGGACCCAGGAATCAGGAAGG + Intergenic
1165386667 19:35514047-35514069 CTGGAGCCCCTGAGCCAGGCTGG - Intergenic
1165474613 19:36023354-36023376 ATGGAGACCCAGAGGCAGGAAGG - Intronic
1167638734 19:50668828-50668850 CTGGGGCCCCAGAGCCAGGCGGG + Exonic
1167723677 19:51196607-51196629 TTGGAGACTCAGAATGAGGAAGG - Intergenic
926295023 2:11562760-11562782 CTGGAGCTCCTGTTTCAGGAGGG - Intronic
927473863 2:23397209-23397231 CTGGAGCCCCTGCCACAGGAGGG - Intronic
927625103 2:24707871-24707893 CTGGAGGCCCAGAGCCAGGTGGG + Exonic
928626232 2:33142572-33142594 CTTAAGAGCCAGAATCAGGAGGG + Intronic
931018534 2:58014860-58014882 CTAAAGACCCAGAACCAGGAAGG + Intronic
931263237 2:60638345-60638367 CTGGAGTCCCTGCATGAGGAGGG + Intergenic
931396823 2:61895318-61895340 GTGGAGCCCAAGATCCAGGAAGG + Intronic
932314308 2:70769207-70769229 GTGGTGCCCCAGAACCTGGAAGG - Intergenic
934476541 2:94597282-94597304 TTGGAACCTCAGAAGCAGGAGGG + Intronic
935752128 2:106245015-106245037 CTGGAGACTCACAATCAGAAAGG - Intergenic
935912540 2:107912562-107912584 CTGGAGACTCACAATCAGAAAGG - Intergenic
935950856 2:108326926-108326948 AGGAAGCCCCAGAATCAGGAAGG + Intergenic
936046676 2:109193959-109193981 CTGGTGCCCCAGAAGGAGCATGG - Intronic
938387046 2:130873962-130873984 CTGGCTCTCCAGATTCAGGAGGG + Intronic
939409857 2:141810865-141810887 GTGAAGCCCCAGTATCAGGATGG - Intronic
940206274 2:151205320-151205342 CTGGATCCCCAGAATCAGGTAGG + Intergenic
944366665 2:198928954-198928976 CTGGAGCCCATGAGGCAGGAGGG - Intergenic
944539591 2:200743059-200743081 CTGGGGCACCAGGATGAGGATGG + Intergenic
946694649 2:222342471-222342493 CGGAAGCCCCACAATCATGATGG + Intergenic
947651523 2:231790409-231790431 CTGAAGTCCCTGAATCAGAAGGG - Intronic
948112892 2:235471251-235471273 CTGGAGCAGCATAATGAGGATGG + Intergenic
948258372 2:236584679-236584701 CTGGAGCCCCAGGCACAGGGTGG + Intergenic
948627683 2:239279122-239279144 CTGATGCCCTGGAATCAGGAGGG - Intronic
948637908 2:239351934-239351956 CAGGAGCCCCACACTCAGGCAGG + Intronic
948772335 2:240258114-240258136 CTGGAGCTCTGGAATCCGGAAGG - Intergenic
949024748 2:241761746-241761768 CTGGCTACGCAGAATCAGGATGG - Intronic
1169232957 20:3905026-3905048 CTGGAGCCCCAGAATCAGGATGG - Intronic
1170411190 20:16093894-16093916 TAGGAGCCCCAGAATAAGCATGG - Intergenic
1171087074 20:22247345-22247367 CTGGAGCCACAGTAGCAGGTGGG + Intergenic
1172133686 20:32673230-32673252 CTGGAGCCACAGAGGCAGGAGGG + Intergenic
1172183005 20:33015005-33015027 ACGGAGGCCCAGAGTCAGGAAGG + Intronic
1172612544 20:36262586-36262608 CTGGTGCTCCAGACTGAGGAAGG - Intronic
1172985666 20:38986973-38986995 CAGCAGCCCCAGGCTCAGGAGGG - Intronic
1173032826 20:39378284-39378306 CTGGAGGCTCAGAAGCAGGGAGG - Intergenic
1173443308 20:43096512-43096534 CAGGAGCCCCAGGAGGAGGAGGG - Intronic
1173858509 20:46266853-46266875 CTGGAGCCCCAGATTCAGTAAGG + Intronic
1174354617 20:49989672-49989694 TCGGAGCCCCAGAGTCAGGCTGG + Intergenic
1175413158 20:58784783-58784805 CAGGAGCCCCAGGAGCAGCACGG + Intergenic
1175725208 20:61313293-61313315 CCGGAGACCCAGAAGCAGCAGGG + Intronic
1178582964 21:33851277-33851299 ATGGAGACCCAGCCTCAGGAGGG + Intronic
1178699307 21:34819855-34819877 CTGGCGGGCCAGAAGCAGGATGG - Intronic
1179085025 21:38208230-38208252 CTGGAGCCCAGGAAGCAGGAAGG - Intronic
1180034235 21:45235089-45235111 CTGGACCCCCAGCCCCAGGAAGG - Intergenic
1180285647 22:10742179-10742201 ATGGAGCCCCAGAGTAAGGGAGG + Intergenic
1180883254 22:19221567-19221589 CTGGAGTCCCAGATTCAGGAAGG - Exonic
1181349943 22:22247717-22247739 ATGGAATCCCAGAATCATGAAGG - Intergenic
1181517130 22:23421269-23421291 AAGGAGCCCCAGAAGCAGCATGG + Intergenic
1182872656 22:33662349-33662371 CAGGAGCCCCAGCATCAGTGAGG + Intronic
1183112672 22:35662343-35662365 TTGGGGCCCCAGAATCACTAAGG + Exonic
1183487558 22:38097640-38097662 ATGGGGCCCCAGGCTCAGGAAGG + Intronic
1183896958 22:40977159-40977181 CTGGAGCCTCAGAACCAGGAGGG + Intergenic
1184872928 22:47252182-47252204 CAGGAGCCCCACACTCAGGTGGG + Intergenic
1184967918 22:47995217-47995239 CTGGAGCCCCAGCAGCTGGAAGG - Intergenic
1185253253 22:49816800-49816822 CTTGGGCCCCAGAATTCGGAAGG - Intronic
949905088 3:8852480-8852502 CTGGAGCCCTGGATTCTGGAGGG + Intronic
950400296 3:12764634-12764656 CTGGAGGCCCAGGATGAGTAAGG - Intronic
952314635 3:32221938-32221960 CTGAAGCCTCAGCTTCAGGAAGG + Intergenic
954632582 3:52055449-52055471 CTGGAAGGCCAGGATCAGGAAGG - Intronic
954661435 3:52228949-52228971 CTGGAGCCCAGGAAGGAGGATGG + Exonic
955046700 3:55367815-55367837 CTGTAGCCCCAGACTCGGGTAGG - Intergenic
955458235 3:59149339-59149361 CAGGAGACCCAGAAGGAGGATGG - Intergenic
955520132 3:59767597-59767619 CTGGAGCCCAACATTAAGGATGG + Intronic
955603856 3:60677315-60677337 CTGGAGACTCAGAATGATGATGG - Intronic
956514615 3:70033290-70033312 CTTGAGCCCCTGATTCAGGCTGG + Intergenic
961821292 3:129577028-129577050 CTGGGACCCCAGAAGCAGGGAGG - Intronic
962852646 3:139319415-139319437 CTGGAGCTCCTGACTCAGGCAGG + Intronic
963049498 3:141128908-141128930 AAGGAGCCCTAGAAACAGGATGG - Intronic
963123478 3:141795081-141795103 CTGGAGTCACAGGGTCAGGAAGG + Intronic
964477480 3:157109913-157109935 CATGAGGCCCAGAATCAGGGAGG + Intergenic
965809449 3:172576994-172577016 GTGCAACCCCAGAATCACGATGG - Intergenic
968133100 3:196203642-196203664 CTGGAGATCCTGGATCAGGAGGG + Intronic
969700118 4:8763250-8763272 CTGGTGCCCCAGGGTCAGGGTGG + Intergenic
969849143 4:9943029-9943051 CTGGTGCCCCAGGATCCTGAGGG - Intronic
971676425 4:29635354-29635376 CTGGAGACCCAGAAGGATGAGGG + Intergenic
974701945 4:65462544-65462566 CTGAAGCCCCAGACTCCTGAAGG - Intronic
976593308 4:86870851-86870873 GTGGAAGCCCAGAAACAGGAAGG + Intergenic
977626785 4:99196491-99196513 CTGCAGCCCCAGAAAGAGAATGG - Intergenic
977974549 4:103249023-103249045 CTGGAGACTCAGAAGCAGGGAGG - Intergenic
978541134 4:109817171-109817193 CTTGAGAGCCTGAATCAGGATGG + Intronic
978574818 4:110179130-110179152 CTGGAGGCCTAGAATTATGAAGG - Intronic
984098425 4:175460072-175460094 GTGAAATCCCAGAATCAGGAAGG + Intergenic
984248135 4:177300331-177300353 CTGGAGTCAAAGAATCAGTAGGG + Intergenic
985655118 5:1127424-1127446 CTGGAGCCGCAGAAGTTGGAAGG + Intergenic
985723673 5:1504344-1504366 CTGGAGCCCCGGGACCAGGTGGG - Intronic
986167574 5:5288843-5288865 CTGGAGTGGCAGGATCAGGAAGG - Intronic
986776123 5:11015764-11015786 CTGGAGCCACTGATTCAGAATGG + Intronic
988004045 5:25384836-25384858 AAGGAGCTCTAGAATCAGGAAGG - Intergenic
989096477 5:37786302-37786324 CTAGAGTCAGAGAATCAGGATGG - Intergenic
990868321 5:60403754-60403776 CTGGAGAGACAGCATCAGGAAGG - Intronic
992726167 5:79609351-79609373 CTGCAGCCCCAGAAAGAGAATGG - Intergenic
993065928 5:83096563-83096585 GTGGAGCCCAAGACTTAGGAAGG - Intronic
998405031 5:141869409-141869431 GGGAGGCCCCAGAATCAGGAGGG + Exonic
999610285 5:153361988-153362010 CTTATGCCCCACAATCAGGATGG + Intergenic
1000195520 5:158953766-158953788 CAGGAGCCCCAGAATCAAAGAGG + Intronic
1001753085 5:174146391-174146413 CTGGAGCCCTGGAATCAGACAGG - Intronic
1002470377 5:179431436-179431458 CTGGAGCCACAGCATCAGCCAGG - Intergenic
1003102623 6:3188598-3188620 CTGGAGCCGCTGCATCAGGTAGG - Intergenic
1004702141 6:18089144-18089166 CTGGAATCCCAGAGTCAGAAGGG - Intergenic
1006255427 6:32828939-32828961 CTGGAGCACCAGGATCTGGTGGG + Intronic
1007567611 6:42864447-42864469 GTGGAGCCCCAGCTTCAAGATGG - Intronic
1008070648 6:47095677-47095699 CCAGAGCTCCAGAAACAGGAAGG - Intergenic
1008927275 6:56900131-56900153 CTGGAGTTCTAGAATGAGGATGG - Intronic
1010934563 6:81845837-81845859 CTGGAATCCCAGAATAAGGGAGG + Intergenic
1011626029 6:89284609-89284631 CAGGAGCCACAGAATGTGGACGG + Intronic
1013802979 6:113968867-113968889 ATGGAACCCTAGAACCAGGAGGG - Intronic
1015534931 6:134258183-134258205 CTTGAGCCCAGGAATGAGGAGGG - Intronic
1018131743 6:160738393-160738415 CTGCAAGCCCAGCATCAGGATGG - Intronic
1019358623 7:593811-593833 CAGGAGCCCCAGACCCAGGGTGG + Intronic
1019513370 7:1429365-1429387 CTGGAGCCCAAGACGCAGGGGGG - Intronic
1021088680 7:16454686-16454708 GTGGAGACCCAGCTTCAGGAGGG - Intergenic
1021950252 7:25767337-25767359 CTGGAGCCACAAAACCAGAAGGG + Intergenic
1022090372 7:27104035-27104057 CCGGTGCCCAAGGATCAGGAAGG - Intergenic
1022846171 7:34212233-34212255 CTGTAGCCACAGAATGAGGCAGG - Intergenic
1023212931 7:37827738-37827760 CTGGAGCCCAGGGATAAGGAGGG - Intronic
1023992190 7:45134875-45134897 CTGGAGCCCCAGGGCCAGGCTGG + Intergenic
1024624927 7:51198891-51198913 GTAGAGCCCCAGACTGAGGAGGG + Intronic
1024966095 7:55023087-55023109 CTGGTGCCCCGGAATAGGGATGG + Intronic
1025663950 7:63572463-63572485 CTGCAGCCCAAGACTCAGGCTGG - Intergenic
1028454940 7:91028051-91028073 CTGGAGACTCAGAAGCAGGAAGG - Intronic
1029590256 7:101502621-101502643 CTGGAGCCCCACTGTCAGGGGGG + Intronic
1029712086 7:102305143-102305165 CTGGAGCCCCCGACTCAGAACGG - Intronic
1029806854 7:103007137-103007159 CTGGAGTCCCAAAAAGAGGAAGG + Intronic
1029971792 7:104796852-104796874 CAGGAGACCCAGTCTCAGGATGG - Intronic
1031297307 7:120017405-120017427 CTGGAGCCTCAGGATAATGAAGG + Intergenic
1032017534 7:128389428-128389450 CTGGAGCCACAGAAGCTGAAAGG + Intergenic
1040970397 8:53130002-53130024 TTGGAGACTCAGAAACAGGAGGG - Intergenic
1041252686 8:55949440-55949462 CTGGAACCCCAGAATCCAGTGGG - Intronic
1041477101 8:58278799-58278821 CTGGAGCTCCAGATGCAGGCAGG - Intergenic
1042750588 8:72153709-72153731 GTGGAGCCCCAGGAGAAGGAAGG - Intergenic
1044279143 8:90336558-90336580 CTGGGCCTCCAGAATAAGGAGGG - Intergenic
1046197998 8:110888676-110888698 CTTAAGTCCCAGAATCAGAAAGG - Intergenic
1046292351 8:112179741-112179763 CTGGAGCCTTACAATCATGATGG + Intergenic
1049056110 8:140238880-140238902 CTGGAGCCCCGGCGTCAGCACGG - Intronic
1049302244 8:141877730-141877752 CTGGAGCCCCCAAAGCAGCAAGG - Intergenic
1049674503 8:143883693-143883715 CTGGAGCCCGAGGGCCAGGAGGG - Intergenic
1050604652 9:7288127-7288149 ATGAAGCCCCATAAGCAGGATGG - Intergenic
1050622841 9:7472907-7472929 ATGAAGCCCCACAATCATGAAGG - Intergenic
1051963715 9:22800754-22800776 GTGGAGCCCAAGACTGAGGAAGG + Intergenic
1053128981 9:35604970-35604992 CTGGAGCCCAGGAATCCGGCAGG + Intergenic
1053524852 9:38818032-38818054 CTGGAGACTCAGAAGCGGGAGGG - Intergenic
1053532198 9:38893854-38893876 TTGGAGACTCAGAAGCAGGAAGG + Intergenic
1054197086 9:62042448-62042470 CTGGAGACTCAGAAGCGGGAGGG - Intergenic
1054204421 9:62118263-62118285 TTGGAGACTCAGAAGCAGGAAGG + Intergenic
1054633940 9:67470101-67470123 TTGGAGACTCAGAAGCAGGAAGG - Intergenic
1054641322 9:67546246-67546268 CTGGAGACTCAGAAGCGGGAGGG + Intergenic
1055693788 9:78861125-78861147 CTGGAGCCTGAGTAGCAGGATGG - Intergenic
1056125750 9:83535423-83535445 ATGGAGCCCCAAAATAAGTAGGG - Intronic
1056303839 9:85269985-85270007 CTGCAGCCCCGGACTCTGGAAGG + Intergenic
1056554190 9:87675641-87675663 CTGGAGCCTCAGGGTCAGGATGG + Intronic
1057023840 9:91721285-91721307 AGGAAGCCACAGAATCAGGAAGG + Intronic
1057172090 9:92969160-92969182 CGGGTGGCCCAGAATCATGAGGG - Intronic
1059653146 9:116334053-116334075 CTGGAGTCCCATTATTAGGAAGG + Intronic
1060982933 9:127803841-127803863 GTGGAACCCCAGAGTCATGAGGG + Intronic
1061126865 9:128682641-128682663 CTTGAGCCTCAGAGACAGGATGG + Intergenic
1061587847 9:131579939-131579961 CTGGTGCCTCAGAGTCAGGCAGG + Intronic
1061834684 9:133321060-133321082 CTGGTTCCCCAGTATCAGGAAGG - Intergenic
1061899782 9:133666893-133666915 CTGGGGCCCCAGAAACCGCAGGG + Intronic
1062364466 9:136202303-136202325 CTGGAGCCGCAGGATGGGGAAGG - Intronic
1062435630 9:136545557-136545579 CTGGAGTCCCGGGATCAGGGAGG - Intronic
1203731999 Un_GL000216v2:99245-99267 ATGGAGCCCCAGAGTAAGGGAGG + Intergenic
1185478105 X:427315-427337 CTGATGCCCCAGAGACAGGACGG + Intergenic
1185478124 X:427396-427418 CTGATGCCCCAGAGACAGGACGG + Intergenic
1185478206 X:427737-427759 CGGGCGCCCCAGAGACAGGACGG + Intergenic
1185998961 X:4987314-4987336 TTGGAGACTCAGAAGCAGGAAGG + Intergenic
1186750761 X:12619488-12619510 GTGGAGCCCAAGACTGAGGAGGG + Intronic
1187852381 X:23604009-23604031 GAGGAGGCCCAGAGTCAGGATGG - Intergenic
1188412675 X:29893388-29893410 CTGGAGCACCAAAATCAGCCTGG + Intronic
1189280517 X:39817554-39817576 CTGGTTTCCCAGAAACAGGAGGG + Intergenic
1190101288 X:47524468-47524490 CTGCAGTCCCAGACTAAGGAAGG + Intergenic
1190832599 X:54072860-54072882 CTGAAGTCCCAGAAACAGGCAGG + Exonic
1191218598 X:57960579-57960601 CTGGACCCCAAGACTTAGGAGGG - Intergenic
1191887721 X:65906132-65906154 CTGGAGCACCAGAGACAGAAGGG - Intergenic
1191945665 X:66531815-66531837 GTGGAGCCCAAGACTGAGGAAGG - Intergenic
1195797615 X:108668428-108668450 CTGGACCCGGAGAACCAGGAGGG - Exonic
1196557934 X:117112704-117112726 TTGGAGACTCAGAAGCAGGAGGG + Intergenic
1198287093 X:135201657-135201679 CTGGAGCCCCAGAAACTCGTGGG + Intergenic
1199628885 X:149762508-149762530 CTGGGGCCCCTCTATCAGGATGG + Intergenic
1199879396 X:151961240-151961262 CTGGGGCCCCAGAAACATGCTGG - Intronic
1200266565 X:154649319-154649341 CTGGAGACACAGCTTCAGGAAGG + Intergenic
1201474833 Y:14369228-14369250 CTGGAGACTCAGAATCTGGGAGG + Intergenic
1201942792 Y:19477794-19477816 CTGGAGGCCAAGAATTATGAGGG - Intergenic