ID: 1169237275

View in Genome Browser
Species Human (GRCh38)
Location 20:3941004-3941026
Sequence ATAAGGCTGTTCCTCCGTGA AGG
Strand +
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 63
Summary {0: 1, 1: 0, 2: 0, 3: 5, 4: 57}

Found 0 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1169237275 Original CRISPR ATAAGGCTGTTCCTCCGTGA AGG Intronic
902124244 1:14195200-14195222 ATAAGGCTGTTCCTTCTTCAAGG + Intergenic
908615355 1:65914750-65914772 ATAATCCTGATCCTCCCTGAGGG + Intronic
915272884 1:154767654-154767676 ATCAGGAGGTTCCTCCCTGAGGG + Intronic
917328390 1:173856719-173856741 CTAAGGCAATTCCTCCATGAGGG - Exonic
920262296 1:204697138-204697160 ATGAGTCTGTTCCTCGGTGGGGG + Intergenic
920762161 1:208795063-208795085 ATAAGCATGTTCATCCATGAAGG + Intergenic
1062846851 10:714149-714171 ATGAGGCCGTTCCTCAGTGATGG + Intergenic
1064327852 10:14367241-14367263 CTAAGGCTTCTCCTCCATGAGGG - Intronic
1066036712 10:31496439-31496461 TTAAGGCTATTCCTCTGTAATGG + Intronic
1074923631 10:118046209-118046231 ATTAGGCTCTCCCTCCGGGAGGG - Exonic
1074949538 10:118317574-118317596 ATAAGGCTGGTGTTCAGTGATGG - Intronic
1080030358 11:27654254-27654276 AAAAGGATTTGCCTCCGTGATGG - Intergenic
1085703113 11:78762796-78762818 ATATGGCTGTTCTACAGTGAGGG + Intronic
1085964076 11:81499263-81499285 ATTAGGCTTTTCTTCCTTGAGGG + Intergenic
1089138084 11:116265409-116265431 ATAAGTCTGTCCTTCAGTGAGGG + Intergenic
1090722389 11:129488318-129488340 ATAAGGTAGTCCCTCCCTGAGGG - Intergenic
1091352533 11:134908599-134908621 ATAAGGCTCTTCCGCAGTGCAGG + Intergenic
1099734688 12:86551638-86551660 ATAAGGCTGTTACTCTGGGTGGG - Intronic
1106443360 13:29800912-29800934 ATAAGGCTGCTGCACCGTGGGGG - Intronic
1119439759 14:74620208-74620230 ATAAGTCTGTTCCTCCTGGGAGG - Intergenic
1202859445 14_GL000225v1_random:72369-72391 ACCAGGCTGTTCCTCCGCGCAGG + Intergenic
1124352269 15:28965222-28965244 AAAAGGCTGTCCCTCCTTCATGG + Intronic
1125302223 15:38268313-38268335 CTAAGGATGTACCTCCGTGTTGG - Intronic
1127514458 15:59678219-59678241 ATAAGCCTTTTCCTCCTTTATGG - Intronic
1146673018 17:34755054-34755076 AGAAAGCTGCTCCTCCCTGATGG - Intergenic
1149958272 17:61077875-61077897 ATAAGCTTGATCCTCAGTGAAGG + Intronic
1152462229 17:80447440-80447462 AAAAGGCTTTCCCTCCATGAAGG + Intergenic
1154983468 18:21524408-21524430 ATAAGGCAGGTCCTCTTTGAAGG - Exonic
1157730636 18:50001243-50001265 AGAAGGCTTTACCTCCATGATGG + Exonic
1162478866 19:10916446-10916468 GTAGAGCTGTTCATCCGTGAAGG - Exonic
1163099849 19:15088277-15088299 AAAAGGCTGATCCTCCAGGAGGG - Intergenic
928916982 2:36482848-36482870 ATAAGGTTCTTCCTCCCTGGAGG - Intronic
933799029 2:85945045-85945067 ATTAGGATGTTCCTCCCAGAAGG + Intergenic
935274554 2:101464798-101464820 ATAAGGCTGTTTCACCTTCATGG - Intronic
937040031 2:118813949-118813971 GTAAGGCTGTTTGCCCGTGAAGG + Intergenic
941851008 2:170180182-170180204 GTAAGGCTGTACCTCCGTTAGGG + Intronic
943617202 2:190106896-190106918 TTTAAGCTGTTCCTCAGTGATGG - Intronic
948409523 2:237748482-237748504 ATAAGGATGTTCCCCAGCGAGGG + Intronic
949070305 2:242020490-242020512 ATGTGGCTGTTCCTCTGTGAGGG + Intergenic
1169237275 20:3941004-3941026 ATAAGGCTGTTCCTCCGTGAAGG + Intronic
1171411939 20:24953389-24953411 ATGATCCTGTTCCTCCGTGGGGG + Intronic
1177181178 21:17746184-17746206 ATAAGGATGTTCCTTCCTGTGGG + Intergenic
1181485589 22:23229787-23229809 AGAAGGCAGTTCCCCCCTGAGGG + Intronic
951359556 3:21708940-21708962 ATAAGGCAGTTTCTCCTTAAAGG + Intronic
952834588 3:37592301-37592323 ATAAGGCTATTCCTCGTTGAAGG + Intronic
962224977 3:133598309-133598331 ACAGGGCTTTTCCTCCGTGCCGG + Intronic
968864573 4:3199761-3199783 ACTAGGCTGTTCCGCAGTGATGG + Exonic
969488866 4:7487373-7487395 ATAAGGCTGTGACTCCCTGTTGG + Intronic
974352060 4:60761151-60761173 ATATGGCTTTTCCTCTGTGCAGG - Intergenic
985021904 4:185700630-185700652 ATAAGACTGTTTCTCAGTGCTGG + Intronic
1013833067 6:114297707-114297729 ATCAGACTGTTGCTCCTTGAAGG - Intronic
1014955872 6:127615085-127615107 ATCAGCCTGTGCCTCAGTGAGGG - Intergenic
1015227063 6:130869851-130869873 ATACTCCTGTTCCTCCCTGATGG + Exonic
1020882159 7:13775798-13775820 ATAGGCGTGTTCCTCCCTGAAGG + Intergenic
1027415364 7:77968325-77968347 ATAATGCTGTTCCTTCCTCAGGG + Intergenic
1033238727 7:139659379-139659401 AAAAGGCTGCTCCTACTTGAAGG - Intronic
1035842576 8:2828357-2828379 TTGAGTCTTTTCCTCCGTGAAGG + Intergenic
1036949681 8:13129220-13129242 TGAAGGCTGTTCCTCTTTGAAGG - Intronic
1039451049 8:37675368-37675390 ATCTGGCTGTTCCTTCTTGACGG - Intergenic
1041089460 8:54288503-54288525 ATCAGGCTTTCCCTCCCTGAGGG - Intergenic
1054732983 9:68720256-68720278 ACAAGGCTGCTCCTCGGGGAAGG - Intronic
1056062312 9:82896495-82896517 ATCAGCCTGTTGCTCCCTGAGGG - Intergenic
1058351035 9:104024351-104024373 ATAAGGCTATTTCTCCATGTTGG + Intergenic