ID: 1169237344

View in Genome Browser
Species Human (GRCh38)
Location 20:3941777-3941799
Sequence GAAAATAAAAAGATGAAGCT GGG
Strand +
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 1931
Summary {0: 1, 1: 0, 2: 11, 3: 161, 4: 1758}

Found 0 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1169237344 Original CRISPR GAAAATAAAAAGATGAAGCT GGG Intronic
900251582 1:1673208-1673230 GAAAACACAAAAATGAGGCTGGG + Intronic
900261943 1:1735744-1735766 GAAAACACAAAAATGAGGCTGGG + Intronic
900304034 1:1994002-1994024 AAAAATAAAAAAATGTAGCCAGG + Intronic
900968086 1:5973424-5973446 CAAAATAAAAACATTTAGCTGGG + Intronic
900976657 1:6020976-6020998 GAAAATAAAAATTTTAGGCTGGG - Intronic
901326437 1:8368483-8368505 GAAAAAAAAAAAAAAAAGCTTGG + Intronic
901560316 1:10065102-10065124 AAAAATAAACTGATGAATCTAGG - Intronic
901608845 1:10480688-10480710 CAAAATAAAAAGTTGAGGCCAGG - Intronic
901725833 1:11241329-11241351 AAAAAAAAAAAAATGAGGCTCGG + Intronic
901890488 1:12259302-12259324 AAAAATAAAAAGAGTAGGCTGGG - Intronic
901948416 1:12722034-12722056 GAAAACGAAGAGATGAAGCCGGG + Intronic
902378351 1:16040914-16040936 AAAAAAAAAAAGAAGATGCTTGG - Intergenic
902927818 1:19708624-19708646 GAAATGACAAAGGTGAAGCTGGG - Intronic
902959104 1:19949565-19949587 AAAAATAAAAATAAAAAGCTGGG + Intergenic
903089630 1:20900536-20900558 GAAAAAAAAAAGAGAAATCTGGG + Intronic
903203332 1:21761592-21761614 TAAAATATAAAAATGAAGCTGGG + Intronic
903504613 1:23824771-23824793 AAAAAATAAAAGCTGAAGCTAGG - Intronic
903533320 1:24048938-24048960 AAAAATACAAAAATTAAGCTGGG + Intergenic
903618957 1:24683920-24683942 GAAAAAAAAAAAAAAAAGCTCGG - Intergenic
903643644 1:24877157-24877179 AAAAATAAAAAAATTTAGCTGGG - Intergenic
903691912 1:25180203-25180225 GAAAAGAGAAAGATGAAGATGGG + Intergenic
903996682 1:27309617-27309639 AAAAAAAAAAAAAAGAAGCTGGG - Intergenic
904088254 1:27926272-27926294 GAAAGTGAAAAGATCAGGCTGGG - Intergenic
904205449 1:28851870-28851892 AAAAAAAAAAAGAAGAAGCCGGG + Intronic
904309202 1:29615387-29615409 GAAAACAAAAAAAAGAACCTAGG - Intergenic
904504593 1:30940313-30940335 AAAAATAAAAAAAAGTAGCTGGG + Intronic
904645874 1:31965808-31965830 AAAAAAAAAAAAATGAGGCTGGG + Intergenic
905083513 1:35347300-35347322 GAAAATAAAAATAGAAGGCTGGG - Intronic
905184600 1:36187428-36187450 GAAAAAAAAAAGAAGAGGCCTGG - Intergenic
905192672 1:36247859-36247881 AAAAAAAAAAAGATGAAGATGGG - Intronic
905420733 1:37841731-37841753 GAAAAGAAAAAGAAGAAGGCAGG + Intronic
905437211 1:37965168-37965190 AAAAATAAAAAAATAAAGTTGGG + Intronic
905579753 1:39075328-39075350 AAAAAAAAAAAGAAGAAGATGGG - Intergenic
905654791 1:39679181-39679203 GAAAAGAAAGAGAAGAAGCTGGG - Exonic
905809726 1:40903117-40903139 AAAAATCAAGAGATGAAACTTGG - Intergenic
905816316 1:40953683-40953705 AAAAAAAAAAAGAAGAGGCTGGG - Intergenic
906010544 1:42520623-42520645 AAAAAAAAAAAGATGAGGCCGGG - Intronic
906038678 1:42769248-42769270 AAAAACAAAAAAATGAGGCTGGG + Intronic
906093820 1:43206119-43206141 AAAAATAAAAATAATAAGCTGGG - Intronic
906104202 1:43282267-43282289 AAAAAAAAAAAAAGGAAGCTTGG + Exonic
906316672 1:44790930-44790952 AAAAAGAAAAAGAAAAAGCTGGG + Intergenic
906690539 1:47790032-47790054 AAAATTAAAAAGATGATGGTGGG - Intronic
906832031 1:49043211-49043233 GAAAATAAAAAGATATAGAAAGG - Intronic
906843368 1:49163841-49163863 CACAATAAAAAAATGAATCTTGG + Intronic
906966455 1:50461893-50461915 GAAAAAAAAAAGAGGAAGGAGGG + Intronic
907017639 1:51032792-51032814 GAAAAAAGAACAATGAAGCTGGG - Intergenic
907039751 1:51248085-51248107 AAAAAAAAAAAGAAGAAACTAGG - Intronic
907064423 1:51466319-51466341 AAAAATATAAAGTTGAATCTAGG + Intronic
907694011 1:56702376-56702398 GAAAAGATAAAAATGATGCTGGG - Intronic
908123039 1:61003865-61003887 GAGAATGAAAAGATGAAGCGAGG - Intronic
908205442 1:61843437-61843459 CTAAATAAAAAGATGAATATAGG + Intronic
908205522 1:61844287-61844309 GAAAATAAAAACATGAAATCAGG - Intronic
908213882 1:61930996-61931018 AAAAATAAAAAAATTAGGCTGGG - Intronic
908459953 1:64339637-64339659 GAAAATAAAAACAATTAGCTGGG - Intergenic
908496588 1:64700632-64700654 TAAAATAAAAAGATGAATTAGGG - Intergenic
908757810 1:67485121-67485143 AAAAACAAAAAAATGAACCTTGG + Intergenic
908768374 1:67573998-67574020 AAAAAAAAAAAGACGAGGCTGGG - Intergenic
908803629 1:67907082-67907104 CAAAGTAAAAAGAATAAGCTGGG - Intergenic
908889093 1:68822816-68822838 GAATATATAAAGATGACGTTTGG - Intergenic
909143474 1:71896910-71896932 ATAAATGAAAAAATGAAGCTTGG + Intronic
909480832 1:76127920-76127942 GAATAGCAGAAGATGAAGCTGGG - Intronic
909606017 1:77508870-77508892 AAAAAAAAAAAGAAGAAGGTGGG + Intronic
909864933 1:80655441-80655463 AAAAAAAAAAAGATTAAGTTTGG - Intergenic
909910560 1:81252625-81252647 GAAAATAAATGGATGAAGATGGG - Intergenic
909969845 1:81968773-81968795 GAAAATAAAAACTTAAAACTTGG + Intronic
910312335 1:85838413-85838435 GAAAAGACAAAGATGATTCTAGG + Intronic
910328723 1:86043506-86043528 AAAAATAAAAAGAAGAAGTTTGG - Intronic
910334865 1:86116403-86116425 TAAAATAAAGAGATGAATCCAGG + Intronic
910481257 1:87660735-87660757 GGTAATACAAAGATGAAGCAGGG + Intergenic
910534088 1:88276661-88276683 AAGTATAAAAAGATAAAGCTAGG + Intergenic
910663075 1:89694577-89694599 AAAAAAAAAAAAAAGAAGCTGGG - Intronic
910747268 1:90587754-90587776 GAAAATACAATGATGGGGCTGGG + Intergenic
910754618 1:90674251-90674273 GAAAAAAAAAAAAAGAAGCAAGG + Intergenic
910772472 1:90844034-90844056 AAAAAAAAAAAAAAGAAGCTGGG - Intergenic
910774059 1:90857212-90857234 GAAAAAAAAAAGAAGAAGCTGGG + Intergenic
910966622 1:92814556-92814578 GAAAATAAAAAAATTAGGCCAGG - Intergenic
910991574 1:93061899-93061921 AAAAAAAAATAGAAGAAGCTGGG - Intergenic
911232213 1:95373375-95373397 GAAATTACAAAAATGAAGGTGGG + Intergenic
911280021 1:95912894-95912916 AAAAATTAAAAGATGTAGATTGG - Intergenic
911286741 1:96003613-96003635 GACAATACAAAGATAATGCTAGG - Intergenic
911435489 1:97851710-97851732 GAAAAAAAAAAAAAGAAACTGGG + Intronic
911584909 1:99679454-99679476 GGAAAAAAAAAGATAAAGCCCGG + Intronic
911821965 1:102434881-102434903 GAAAAAAAAAAGAAGAACATAGG - Intergenic
912054820 1:105581607-105581629 GAAAATACAAAAACGTAGCTGGG - Intergenic
912186042 1:107276971-107276993 GGAAAAAAGAAGAGGAAGCTGGG + Intronic
912368173 1:109151860-109151882 AAAAAAAAAAGGATGAGGCTGGG - Intronic
912572149 1:110632577-110632599 GTAAATAAAATGATGAAATTAGG + Intergenic
912626792 1:111212012-111212034 GACAATAAAAAGATAAAAATGGG - Intronic
912824988 1:112897548-112897570 GAAAAAAAAAAAAAGAAGCTTGG - Intergenic
913013541 1:114709895-114709917 AAAAATACAAAGATTAGGCTGGG + Intronic
913420532 1:118663147-118663169 GAAAATAAACAGATGAATCTAGG + Intergenic
913568994 1:120101644-120101666 GAAAATAAAAAACAGAAGTTGGG + Intergenic
913578422 1:120200555-120200577 GAAAATACAAAGAATTAGCTGGG + Intergenic
913629750 1:120697796-120697818 GAAAATACAAAGAATTAGCTGGG - Intergenic
913669622 1:121084252-121084274 AAAAATAAAAAGAATTAGCTGGG - Intergenic
914021380 1:143871651-143871673 AAAAATAAAAAGAATTAGCTGGG - Intergenic
914261501 1:146002977-146002999 AAAAATAAATAGATAAAGCTGGG - Intergenic
914289803 1:146262635-146262657 GAAAATAAAAAACAGAAGTTGGG + Intergenic
914550846 1:148713418-148713440 GAAAATAAAAAACAGAAGTTGGG + Intergenic
914560345 1:148811995-148812017 GAAAATACAAAGAATTAGCTGGG + Intronic
914612488 1:149318220-149318242 GAAAATACAAAGAATTAGCTGGG - Intergenic
914659870 1:149779569-149779591 AAAAATAAAAAGAATTAGCTGGG - Intergenic
914721120 1:150289805-150289827 CAAAAAAAAAAAATTAAGCTGGG + Intergenic
914740047 1:150456926-150456948 AAAAAAAAAAAGAAGAGGCTGGG + Intronic
914784039 1:150812115-150812137 TAAAAGAAAAAGATTAAGTTTGG + Intronic
914836001 1:151207523-151207545 AAAAAAAAAAAGATTAATCTTGG - Intronic
914894541 1:151657324-151657346 AAAAATACAAAAATGAAGCTGGG - Intronic
915186279 1:154107704-154107726 AAAAATAGAAAGAATAAGCTGGG + Intronic
915262836 1:154691036-154691058 GAAATTAGAAAGATTAGGCTGGG - Intergenic
915269388 1:154742933-154742955 GAAGATTAAAAGGAGAAGCTGGG - Intronic
915398656 1:155606358-155606380 GAAAAAAAAAAGTTGTATCTTGG - Intergenic
915437041 1:155915278-155915300 AAAAATAGAAAAATTAAGCTGGG - Intronic
915566203 1:156714483-156714505 GAAAAAAAAAAAATGAATTTGGG - Intergenic
915573902 1:156762405-156762427 AAAAATAAAAAAATTTAGCTGGG + Intronic
915691941 1:157698637-157698659 GGAAATAGAAAGATGAAGGCAGG + Intronic
915700429 1:157787667-157787689 GAAAGTGAAAAGATGAAGAAAGG + Intergenic
915971117 1:160355973-160355995 GTAAATAGAAAGAAGGAGCTAGG - Intronic
916141455 1:161702837-161702859 TAAAACAAAAAGATGGAGATAGG + Intergenic
916701531 1:167300756-167300778 AAAAATAAAAATAAGAGGCTGGG - Intronic
916792038 1:168133754-168133776 AAAAATACATAAATGAAGCTGGG - Intronic
916808398 1:168282486-168282508 GAAAATATAAAAATCAAGCAAGG - Intronic
916811558 1:168309999-168310021 CAAAATTAAAAGATGAGGCTTGG + Intronic
916951997 1:169790163-169790185 GAAAAAAAAAAGATAAATGTGGG - Intronic
916986799 1:170200499-170200521 ATAAATAAAAAGATGATGTTAGG + Intergenic
917335326 1:173919404-173919426 GAAAATAATAATAATAAGCTGGG + Intergenic
917435004 1:175011941-175011963 GAAAATAAAAAAAACTAGCTGGG + Intronic
917492292 1:175507697-175507719 GAAAACAAATAGAAGAAACTGGG - Intronic
917565946 1:176211581-176211603 GAAGAAAAAAAGAGGAAGCATGG + Intergenic
917985029 1:180307657-180307679 AAAAATAAAAAAATTAGGCTGGG + Intronic
918198823 1:182247809-182247831 GAAAAAAAAGAGAGGAAGCTGGG + Intergenic
918240945 1:182619829-182619851 GAAAATTAAAGGATAAAGCTGGG + Intergenic
918376488 1:183914283-183914305 GAGACAAAAAAGATGAAGCAAGG - Intronic
918387475 1:184024644-184024666 AAAAAAAAAAAGCTGAGGCTGGG - Intronic
918759728 1:188388051-188388073 GAAATAAAAAAGATGAACTTAGG + Intergenic
918765620 1:188479527-188479549 GAAAATAAAAAGTTAACTCTAGG - Intergenic
918835101 1:189452181-189452203 AAAAATAAAAAGATTAAATTAGG - Intergenic
918892126 1:190287753-190287775 GAAACAAAAAAGATGAAGGTGGG + Intronic
918978933 1:191529467-191529489 GAAAATAAAAAGTGCAAACTGGG + Intergenic
919092430 1:192991629-192991651 AAAAATACAAAAATGTAGCTGGG + Intergenic
919112503 1:193238305-193238327 AAAAGGAAAAAGAAGAAGCTAGG - Intronic
919365619 1:196657120-196657142 GAAAAGAAAAAAATTTAGCTAGG - Intronic
919965142 1:202515712-202515734 AAAAATAAAAAGAATTAGCTGGG - Intronic
920341455 1:205277662-205277684 AAAAATACAAAAATGAGGCTGGG - Intergenic
920612821 1:207458268-207458290 AAAAAAAAAAAAATGAAGCTTGG - Intronic
920903764 1:210138783-210138805 GAAAATTGAAAGATAAAGTTAGG - Intronic
921035186 1:211370998-211371020 GAAAATAAATATATAAAGATAGG + Intronic
921113974 1:212069148-212069170 GAAAAAAAAAAGGTGAGGCTGGG - Intronic
921145254 1:212349855-212349877 GAAAAACAAAAGATGAAGTAGGG + Intronic
921204455 1:212836317-212836339 GTAAATAAAAAAGTGAAGCGTGG - Intronic
921412118 1:214846710-214846732 GAAAATAACAAGATGTAGCAAGG + Intergenic
921650521 1:217672915-217672937 GAAGATACAAAGATGAAGATAGG - Intronic
921689670 1:218133661-218133683 GAAGTCAAATAGATGAAGCTGGG + Intergenic
921756879 1:218867939-218867961 AAAAAAAAAAAGATGAAACATGG + Intergenic
922465102 1:225841274-225841296 AAAAATAAATAAATAAAGCTGGG - Intronic
922502557 1:226108144-226108166 GAAAATGAAAATAAGAAGCTAGG - Intergenic
922520616 1:226247831-226247853 GAAAATAAAAAAAATTAGCTGGG - Intronic
922655397 1:227377991-227378013 GAAACTCAAAATATGAATCTTGG - Intergenic
922678103 1:227565515-227565537 TAAAATAAAAAGAATTAGCTGGG - Intronic
922745978 1:228044193-228044215 CAAAATAAAAAGTTAAACCTGGG - Intronic
922882897 1:228995826-228995848 AAAAATAAAAAGAGAATGCTAGG - Intergenic
922904265 1:229162063-229162085 GAAAATTAAAAAACGTAGCTGGG - Intergenic
922942049 1:229475812-229475834 TAAAATAAAAAGCTAAGGCTAGG + Intronic
923261548 1:232272656-232272678 GAATCTAAAGAGATGAAGCCAGG - Intergenic
923307168 1:232698859-232698881 AAAAATAAAAAAATCAAGCCAGG + Intergenic
923394612 1:233549062-233549084 AAAAAGAAAAAGCTGTAGCTAGG - Intergenic
923509300 1:234635785-234635807 GAAAAAAAAAAGATTTAGTTGGG - Intergenic
923623929 1:235598884-235598906 AAAAATACAAAAATTAAGCTAGG - Intronic
923802351 1:237222413-237222435 AAAAAAAAAAAAAGGAAGCTTGG + Intronic
923826979 1:237511305-237511327 AAAAAAAAAAAGAGTAAGCTGGG + Intronic
923832516 1:237573823-237573845 GAAAATAAAAAGATGCTGTTAGG + Intronic
924049166 1:240063103-240063125 GAAAAAAAAAAGAAGAAGCGAGG - Intronic
924196946 1:241618021-241618043 AAAAATAAAAAAAAGAAGGTGGG + Intronic
924222483 1:241892636-241892658 AAAAATACAAAAATGAAGCTGGG - Intronic
924414146 1:243840818-243840840 AAAAATAAAAGGAAGAAGGTAGG + Intronic
924534674 1:244924751-244924773 GTAAATAAAAAAGTGAGGCTGGG - Intergenic
924600585 1:245485376-245485398 AAAAAAAAAAAAATGATGCTAGG - Intronic
924636770 1:245795555-245795577 GAAATTAAAAAGATATAGCTAGG - Intronic
924873442 1:248073664-248073686 AAAAATAAAAAAAAGAAGCATGG + Intronic
1062988770 10:1795560-1795582 GACAGAAAATAGATGAAGCTTGG + Intergenic
1063208172 10:3854636-3854658 AAAAAAAAAAAAATGTAGCTGGG - Intergenic
1063333171 10:5182747-5182769 GAAAATACAAAAAATAAGCTGGG + Intergenic
1063712822 10:8496055-8496077 GAAAATAAAAATATACAGCCGGG - Intergenic
1063829756 10:9938919-9938941 GAACATAAAAAAATGGAGCTGGG - Intergenic
1064028073 10:11865172-11865194 GAAAATCAAAGGATGGATCTGGG - Intronic
1064173458 10:13054163-13054185 AAAAAAAAAAAGAGGAAACTTGG + Intronic
1064226290 10:13488646-13488668 GAAAATAAAAAAAAATAGCTAGG - Intronic
1064653550 10:17534337-17534359 AAAAATATACAGATGAGGCTGGG + Intergenic
1064669433 10:17695465-17695487 GAAAATGAATAGATTAAACTAGG - Intronic
1064734992 10:18372968-18372990 TAAAATAAAAAAAATAAGCTGGG - Intronic
1064762878 10:18639331-18639353 AAAAATACAAAAATGAAGCCAGG + Intronic
1064905526 10:20341697-20341719 AAAAAAAAAAAAAGGAAGCTTGG - Intergenic
1064929232 10:20605134-20605156 GAAAATCATAAGATGAAAGTTGG - Intergenic
1065015196 10:21456342-21456364 AAAAATAAAAAAAATAAGCTGGG - Intergenic
1065182921 10:23144994-23145016 GAAAAGAAAAAGAAAAATCTGGG - Intergenic
1065345453 10:24743850-24743872 GAAAATGAAAAGAGCAGGCTGGG - Intergenic
1065608869 10:27450368-27450390 GAAAATAAAAAGGAGAAGTGAGG - Intergenic
1065666028 10:28062209-28062231 TAAAACAAAAAGATTAGGCTGGG + Intronic
1065675236 10:28166700-28166722 AAAAATTAAAAGATAAGGCTGGG - Intronic
1065821456 10:29529417-29529439 GAAAATAGAAACATGAAACTTGG - Intronic
1065854144 10:29815996-29816018 GAAAATCAAAAGATGTATTTTGG + Intergenic
1065901127 10:30209086-30209108 GAAAATCAACAGAGGAAGCATGG - Intergenic
1065932603 10:30492883-30492905 GAAAATACAAAAAATAAGCTGGG + Intergenic
1066086694 10:31978623-31978645 AAAAATAAAAAAATAAAGATAGG - Intergenic
1066109472 10:32183229-32183251 CAAAAAAAAAAGAAGAGGCTAGG + Intergenic
1066133291 10:32415989-32416011 AAAAATAAAAAGGCCAAGCTCGG - Intergenic
1066384872 10:34933554-34933576 AAAAAAAAAAAGAAGAAGCTGGG + Intergenic
1066472863 10:35716368-35716390 AAGAAAAAAAAAATGAAGCTTGG - Intergenic
1066486366 10:35849057-35849079 AAAAAAAAAAAAAAGAAGCTGGG + Intergenic
1066539103 10:36425232-36425254 GAATATAAAAAATTGAATCTAGG - Intergenic
1066572299 10:36786929-36786951 AAAAAAAAAAAAAGGAAGCTGGG - Intergenic
1066615626 10:37290766-37290788 CAAAATAAAAAGAACAAACTGGG - Intronic
1067124037 10:43500168-43500190 AAAAATATAAAGATGAAGCCAGG - Intergenic
1067307337 10:45076617-45076639 AAAAAGAAGAAGAAGAAGCTGGG + Intergenic
1067572133 10:47379459-47379481 GAAAATGAGGAGATGAAACTAGG + Intronic
1067780366 10:49198231-49198253 AAAAAAAAGAAGAAGAAGCTTGG + Intergenic
1068154077 10:53173349-53173371 TAAAATAAGAAGACAAAGCTGGG - Intergenic
1068198581 10:53750845-53750867 GAAAATAAAGATTTGAATCTAGG - Intergenic
1068261073 10:54582751-54582773 GAAAATTAAAAAATATAGCTGGG + Intronic
1068360458 10:55970884-55970906 AAATATAAAAAGTTAAAGCTGGG - Intergenic
1068448413 10:57153727-57153749 GAAAATTAAAAGGAAAAGCTGGG - Intergenic
1068520189 10:58069060-58069082 GAAAATAAACAGTTGGAGATGGG - Intergenic
1068539338 10:58273542-58273564 AAAAAAAAAAAGCTGAAGATTGG + Intronic
1068547590 10:58366737-58366759 AAAAATAAAAATAATAAGCTGGG - Intronic
1068634902 10:59337973-59337995 GAAAATGAAAAGTTCAGGCTGGG - Intronic
1068659534 10:59609693-59609715 AAAAAAAAAAAGATAAACCTTGG - Intergenic
1068758578 10:60682388-60682410 AAAAAAAAAAAAATGAGGCTCGG - Intronic
1068765440 10:60758173-60758195 GAAAATACAAAGATAAAGCTAGG + Intergenic
1069002707 10:63283525-63283547 GAAAATAAAAAAAATTAGCTGGG - Intronic
1069006042 10:63318323-63318345 GGAAAAGAAAAGATCAAGCTGGG - Intronic
1069050055 10:63782844-63782866 GAAAAAAGAAAGATAAAGCTGGG + Intergenic
1069195487 10:65545902-65545924 GAAAAAAAAAAGAAGTGGCTGGG + Intergenic
1069660625 10:70121242-70121264 AAAAAAAAAAAGATGAGGGTAGG + Intronic
1069673003 10:70225638-70225660 AAAAAAAAAAAGTTAAAGCTTGG - Intronic
1070340848 10:75496982-75497004 GAAAAGAAAAAAAAAAAGCTAGG - Intronic
1070496904 10:77032952-77032974 GAAAATACAAAGAGGAGGTTTGG + Intronic
1070594605 10:77823818-77823840 AAAAATGAAAGGAAGAAGCTGGG - Intronic
1071081149 10:81812979-81813001 GACAGTAAAAAGATCAAGCTGGG + Intergenic
1071174669 10:82911252-82911274 GATAATGAAAAGATGAATCAAGG - Intronic
1071345306 10:84686428-84686450 AAAAAAAAAAAGAAGAAGCTGGG + Intergenic
1071453957 10:85827681-85827703 AAAAAAAAAAAGATGAAGAACGG + Intronic
1071575719 10:86724441-86724463 AAAAATAAAAAAATATAGCTGGG + Intronic
1072091417 10:92131500-92131522 GAAAATAAAAATATTTAGCTTGG + Intronic
1072635189 10:97173482-97173504 AAAAAAAAAAGGATGGAGCTGGG - Intronic
1072674838 10:97458073-97458095 AAAAAAAAAAAAATTAAGCTGGG - Intergenic
1072886955 10:99285629-99285651 GAAAATATATAAATGAGGCTGGG + Intergenic
1072953007 10:99864698-99864720 TAAAATAAATAGATGATGCTGGG - Intergenic
1073020387 10:100438492-100438514 GAAAATAAAAAGCTAAAATTAGG - Intergenic
1073113208 10:101074969-101074991 AAAACTTAAAAGATGAGGCTGGG - Intergenic
1073356803 10:102861419-102861441 GAAAAAAAAAAAAAGAGGCTGGG + Intronic
1073707911 10:106007226-106007248 GAAAAAAACAAGATAAAGTTAGG - Intergenic
1074052371 10:109891840-109891862 GAAAAAAAAAAGAAGAAGAAAGG + Intronic
1074133060 10:110599912-110599934 GAAAATATTAAAATGAGGCTTGG + Intronic
1074442193 10:113487778-113487800 GTAAATAAATACATGAAACTGGG - Intergenic
1074602100 10:114925027-114925049 AAAAAAAAAAAAAAGAAGCTGGG - Intergenic
1074811995 10:117114052-117114074 TAAAATAAAAAAAAAAAGCTGGG + Intronic
1075104487 10:119529291-119529313 AAAAATAAAAAAAAGTAGCTGGG + Intronic
1075387458 10:122066560-122066582 GAAAATACAAAAATTAAGCTGGG - Intronic
1075699945 10:124462636-124462658 TAAAATAAAAACATGAAAATGGG + Intronic
1075762643 10:124868650-124868672 AATAATAAAAAAAAGAAGCTAGG + Intergenic
1075918316 10:126188915-126188937 GATAATAAATAGATGATGCATGG - Intronic
1076019359 10:127058364-127058386 GAAAATAAAAGGATGGAAATAGG - Intronic
1076162388 10:128255344-128255366 CAAACAAAAAAGATGAAGTTGGG - Intergenic
1077030472 11:463543-463565 GAAAACAAAAAAATAAGGCTGGG - Intronic
1077117557 11:892130-892152 GAAAAGAAAAAGACGCAGCGTGG + Intronic
1077260130 11:1613239-1613261 GAGAATGAAAAGATGAACCAAGG - Intergenic
1077808770 11:5616244-5616266 AAAAGTAAAAAGATGAGGCCGGG - Intronic
1078076135 11:8162618-8162640 AAAAAAAAAAAGAAGAAGCATGG - Intronic
1078193133 11:9109946-9109968 ATAAATAAATAAATGAAGCTAGG + Intronic
1078380924 11:10839866-10839888 CAAAATAAAAAGTTTACGCTGGG + Intronic
1078792847 11:14562009-14562031 AAAAGCAAAAAGAGGAAGCTAGG + Intronic
1078976372 11:16483335-16483357 GAAAAAAAAAAGATTTATCTTGG - Intronic
1079619966 11:22541999-22542021 TAAAATATAGAGATGAAGCCAGG + Intergenic
1079654579 11:22972659-22972681 GAAAGGAAAAATATGAAGATTGG - Intergenic
1079716954 11:23759453-23759475 GCACATAAAAAGGTGAAGATAGG - Intergenic
1079808917 11:24970841-24970863 GACCATAAAAAGCTGGAGCTTGG - Intronic
1079883458 11:25955884-25955906 GAAAACATGAAGATGAAGGTTGG - Intergenic
1079886339 11:25993845-25993867 GAAACTTTAAGGATGAAGCTTGG - Intergenic
1079924878 11:26481471-26481493 GAAATTAAAAAGATGATGAAGGG + Intronic
1079965463 11:26974959-26974981 GAAAAAATAAAAATGAAGTTTGG - Intergenic
1079967047 11:26992689-26992711 GAAAAGAAACAGAGGAAGCATGG - Intergenic
1080160105 11:29163404-29163426 GAAAAAAAAAAAAAAAAGCTTGG - Intergenic
1080198340 11:29638060-29638082 TTAACTAAAATGATGAAGCTTGG - Intergenic
1080831743 11:35900450-35900472 AAAAATAGAAAAATGGAGCTGGG + Intergenic
1080980936 11:37404651-37404673 GAAGATAGAAAGATGAAACAAGG - Intergenic
1081222950 11:40485052-40485074 GAAAATTAGAAGGTGAACCTGGG + Intronic
1081973153 11:47214025-47214047 AAAAATAAAAAAATTAGGCTTGG + Intergenic
1082033680 11:47626326-47626348 GAAAAAAAAAAAAAAAAGCTGGG - Intronic
1082058058 11:47836252-47836274 GAAAATAAAAAGAGGGAGGGAGG + Intronic
1082071122 11:47940590-47940612 GAAAAGAAAAGAATGAATCTGGG - Intergenic
1082076308 11:47978896-47978918 AAAAAAAAAAAGAAGAGGCTGGG - Intergenic
1082079302 11:47999852-47999874 AAAAAAAAAAAGAAGAATCTCGG - Intronic
1082185316 11:49173079-49173101 GCAACTAAGAAGATGAAGATGGG - Intronic
1082649951 11:55777301-55777323 GAAAAGAAAATAATGATGCTTGG + Intergenic
1082803911 11:57434686-57434708 GAAAATATCAAGGTGGAGCTTGG + Intergenic
1082882888 11:58055637-58055659 GAAAATACAAAAATGTAGCCAGG + Intronic
1083030046 11:59584104-59584126 AAAAATAAAAAAATTTAGCTGGG - Intronic
1083181901 11:60992172-60992194 AAAAATAAAAAAATGAGGCTGGG - Intronic
1083253647 11:61483459-61483481 GAAATGAAAAAGATGGGGCTGGG - Intronic
1083515370 11:63252612-63252634 GCAAATAAAAACATAAAGTTGGG + Intronic
1083602780 11:63959258-63959280 AAAAATAAAAAAATTAGGCTGGG + Intergenic
1083624686 11:64066309-64066331 AAAAAAAAAAAGATGAATTTAGG + Intronic
1083694111 11:64431188-64431210 GAAGATACAAAGGTGAAGCCAGG - Intergenic
1083695259 11:64438316-64438338 AAAAAAAAAAAGAAGAGGCTGGG - Intergenic
1083892449 11:65602817-65602839 GAAAATAGCAAGAGCAAGCTGGG + Intronic
1083982172 11:66181371-66181393 GAAAATAAAAAAAATTAGCTGGG - Intronic
1084308395 11:68301240-68301262 GATAATAAAATTATGAGGCTGGG - Intergenic
1084350821 11:68597817-68597839 GAAAAAAAAAAAAAAAAGCTGGG + Intronic
1084458123 11:69280294-69280316 GACAAGAAATAGATGATGCTGGG - Intergenic
1084513611 11:69622371-69622393 GTAAATAAAAAGAGGAATTTGGG - Intergenic
1084645031 11:70451582-70451604 GAAAATAAAAAAAAATAGCTGGG + Intergenic
1084969613 11:72763895-72763917 AAAAATAGAAAACTGAAGCTTGG + Intronic
1085094274 11:73746607-73746629 AAAAATAAAAAAATTTAGCTGGG + Intronic
1085102667 11:73814696-73814718 GAAAAAAAAAAAGTGAGGCTGGG + Intronic
1085113697 11:73911341-73911363 AAAAATAAAAAAAAGTAGCTAGG - Intronic
1085407736 11:76273539-76273561 AAAAAAAAAAAAAAGAAGCTGGG + Intergenic
1085430354 11:76442844-76442866 AAAAAAAAAAAGCTAAAGCTGGG - Intergenic
1085677744 11:78540627-78540649 GAATACATAAAGATGAAGCATGG + Intronic
1085894110 11:80616778-80616800 GAATATAAAATGGTGGAGCTAGG - Intergenic
1086082982 11:82924517-82924539 AAAAATAAACAAATGAGGCTGGG + Intronic
1086451146 11:86918216-86918238 GTAAATGCAGAGATGAAGCTTGG + Intronic
1086497085 11:87415425-87415447 AAAATTAAAAAAATTAAGCTAGG + Intergenic
1086681009 11:89672259-89672281 GCAACTAAGAAGATGAAGATGGG + Intergenic
1086717429 11:90079496-90079518 GAAAAAAAAAAAAAGTAGCTGGG - Intergenic
1087297628 11:96395821-96395843 AAAAAAAAAAAGAAGAAGTTGGG + Intronic
1087501481 11:98960085-98960107 AAAAATAAAAAAATAAAGCTTGG - Intergenic
1087781231 11:102303200-102303222 AAAAAAAAAAAGATGTAGCATGG - Intergenic
1088038502 11:105348251-105348273 TAACATAAAAAAATTAAGCTAGG + Intergenic
1088243335 11:107792887-107792909 GAAAATAAAAAGATTATGAGAGG - Intronic
1088388571 11:109288507-109288529 GAAAGAAAAAAGATGAAGGCTGG - Intergenic
1088519701 11:110682158-110682180 GAAATTAAAAAGATGAAAGATGG - Intronic
1088695728 11:112364349-112364371 GAAGATAAATAGATGAAGGAGGG + Intergenic
1088706556 11:112469099-112469121 GAAAATAAACAGATAAACATAGG - Intergenic
1088720351 11:112586755-112586777 GAAAAAAAAAAAAAAAAGCTAGG - Intergenic
1088826989 11:113504225-113504247 GGAAAAAAAAAAATGGAGCTGGG + Intergenic
1089427121 11:118387490-118387512 GAAAACAAAAGGATGGATCTAGG + Intronic
1089543285 11:119204084-119204106 AAAAATAAAAAAATGAGGCCGGG - Intergenic
1089592947 11:119556479-119556501 ACAAAAAAAAAGATTAAGCTGGG + Intergenic
1089927165 11:122270875-122270897 AAAAAAAAAAAAATGAAGCAGGG - Intergenic
1089965353 11:122650992-122651014 CAAAAAAAAAAAAAGAAGCTGGG + Intergenic
1090018488 11:123106610-123106632 GAAAATAAAAACATCAACTTTGG + Intronic
1090024009 11:123152360-123152382 AAAAATACAAAAATGTAGCTGGG + Intronic
1090153513 11:124411278-124411300 GAAACTAATGAAATGAAGCTAGG - Intergenic
1090155127 11:124429100-124429122 GGAGATAAAAAGATAAAGCCTGG + Intergenic
1090349279 11:126097199-126097221 GAAAATACAAAAATTAGGCTGGG - Intergenic
1090463875 11:126915681-126915703 GAAAATACAAAGCTGAGCCTTGG - Intronic
1090514978 11:127415515-127415537 GAAAGAAAAAAGAAGAAGCATGG - Intergenic
1090539637 11:127687042-127687064 TAATATAAAAAGAAGAAGCAGGG + Intergenic
1090550469 11:127814110-127814132 GAAATAAAAGAGATGAAGCCAGG + Intergenic
1090762836 11:129852224-129852246 TAAAATAAAAGGATGAGGGTGGG - Intronic
1090898915 11:131007938-131007960 CAAAAAAAAACGATGAAGTTCGG + Intergenic
1090963253 11:131575619-131575641 GAAAGTAGAAAGATCAGGCTGGG - Intronic
1091042947 11:132299132-132299154 GAAAATAAAAAAAATTAGCTGGG + Intronic
1091564317 12:1637001-1637023 AAAAAGAAAAAAATTAAGCTGGG - Intronic
1091756195 12:3053691-3053713 AAAAAGAAGAAGAAGAAGCTGGG - Intergenic
1092213699 12:6665585-6665607 GAAAATACAAAAAATAAGCTAGG - Intergenic
1092215670 12:6680350-6680372 GAAAATTAAAAAATGAAGACTGG + Intronic
1092768187 12:11871853-11871875 GAAAATGAAAAAATAAAACTGGG + Intronic
1092816090 12:12313423-12313445 GAAAAAAAAAAAAAGAGGCTGGG - Intergenic
1092816780 12:12319271-12319293 AAAAAAAAAAAAATGAAGCAGGG - Intergenic
1092870642 12:12802766-12802788 AAAAAAAAAAAGATCAGGCTGGG + Intronic
1093224396 12:16464302-16464324 GAGAAAAGAAAGATGAAGCTTGG - Intronic
1093237056 12:16622685-16622707 GAAAACAAAATGATAAAGCAAGG + Intergenic
1093246464 12:16743880-16743902 GAAAATACAAAAAATAAGCTGGG + Intergenic
1093252429 12:16823617-16823639 GAAACTAAAAAAAGGAAGCAAGG - Intergenic
1093382518 12:18510264-18510286 GAAAATTAAAAAATGAAGATAGG - Intronic
1093386454 12:18561480-18561502 GAAAATAAAAAAAGGAAGTAGGG + Intronic
1093473305 12:19528318-19528340 AAAAATAAAAAAATTAGGCTGGG + Intronic
1093560935 12:20538939-20538961 GAAAAAAAAAAAATAAGGCTAGG - Intronic
1093729170 12:22548234-22548256 GTAAATAAAAAACTGAAGCCAGG - Intergenic
1093888194 12:24487836-24487858 GAAAAAAAAAAGAGGACACTGGG - Intergenic
1094084984 12:26580395-26580417 CAAATTAAAAAGAAGAGGCTGGG - Intronic
1094198489 12:27774726-27774748 GAAAATAAAAAGCAGGGGCTGGG + Intergenic
1094309838 12:29067734-29067756 GAAATTAAAAAGAGGATGCTGGG - Intergenic
1094665813 12:32519640-32519662 TAAAATAAAAAAATAAAGCTGGG + Intronic
1095240830 12:39856883-39856905 GAAAATATAAATATGAAACAAGG - Intronic
1095282961 12:40377993-40378015 GAAAATAAAAAGAAAAGGCATGG + Intergenic
1095427659 12:42094360-42094382 AAAAAAAAAAAGATGAGGCTGGG + Intronic
1095651108 12:44610371-44610393 GAAAAGAAACATCTGAAGCTGGG + Intronic
1095823669 12:46508688-46508710 GAGAATAGAAAGATCAAGGTGGG + Intergenic
1096058625 12:48677484-48677506 GAAAAAAAAGGAATGAAGCTGGG + Intronic
1096114219 12:49045827-49045849 TAAAATAAGGAGATGAAGCTAGG + Intronic
1096118839 12:49073159-49073181 AAAAAAAAAAAAAAGAAGCTAGG + Intergenic
1096278601 12:50232220-50232242 AAAAATAAAAAAATTAAGCCAGG - Intronic
1096299651 12:50415679-50415701 AAAAACAAAAAAAAGAAGCTGGG - Intronic
1096391586 12:51233528-51233550 AAAAAAAAAAAAATGAGGCTGGG - Intergenic
1096617645 12:52843069-52843091 GAAAGAAAAGAGATGAAGCTGGG + Intronic
1096824497 12:54264314-54264336 AAAAATAAAAAAATGTAGCCAGG - Intronic
1097284400 12:57866323-57866345 GAAAAGAAAAATATGAAGGGTGG - Intergenic
1097371932 12:58794557-58794579 GAATATGTAAAGATGAGGCTGGG + Intronic
1097387755 12:58969923-58969945 CAAGTTAAAAAGATGAAGCTGGG + Intergenic
1097665631 12:62474411-62474433 GAAAAGAAAAAGAAGAGGCCAGG - Intronic
1097667857 12:62501924-62501946 GAAAATAAAATGAAAAGGCTGGG + Intronic
1097724358 12:63058028-63058050 AACAATAAAAAGAAGAAGATAGG - Intergenic
1097734014 12:63162246-63162268 GAAGATGAAAATATGAAGATGGG + Intergenic
1098048085 12:66422958-66422980 GAAAATTAAAACATGGGGCTAGG - Intronic
1098507277 12:71267853-71267875 GAAAATTAAAAGATTAAACAAGG - Intronic
1098739152 12:74148898-74148920 GAAAAATAAAATATGAAGCATGG - Intergenic
1098838242 12:75446802-75446824 GGAAAAAAAAACATGGAGCTTGG + Intergenic
1099035476 12:77582102-77582124 CAAAATAAAAAGATGCAACCTGG - Intergenic
1099642363 12:85308035-85308057 GAGAAGAAAAAGAGGCAGCTGGG + Intergenic
1099718661 12:86332359-86332381 GAAAATAATAAAATGAAGAACGG + Intronic
1099982543 12:89623343-89623365 AAAAAAAAAAAGATGTAGCTTGG - Intronic
1100325160 12:93533440-93533462 AAAAATAAAAAAAAGTAGCTGGG + Intergenic
1100446815 12:94668624-94668646 GAAAAAAAAAAAAAAAAGCTGGG + Intergenic
1100588733 12:96004316-96004338 AAATATACAAAGATAAAGCTAGG - Intronic
1100904582 12:99283039-99283061 GAGAATAAAAGGAAGCAGCTGGG + Intronic
1100977014 12:100133079-100133101 AAAAATAAAAAAATTTAGCTGGG + Intronic
1101039837 12:100744329-100744351 GAAAAGAAAAAAAAGAGGCTAGG + Intronic
1101108868 12:101466388-101466410 AAAAAAAAAAAAATGAGGCTGGG + Intergenic
1101180830 12:102215908-102215930 TAAAATAAAAAAAGTAAGCTAGG - Intergenic
1101377921 12:104187019-104187041 AAAAATAAAAAAATGTAGCTGGG - Intergenic
1101474517 12:105031906-105031928 GAAATTAAAAAGATGAAAATTGG - Exonic
1101483619 12:105128936-105128958 AAAAAAAAAAAAATGTAGCTGGG - Intronic
1101644897 12:106622613-106622635 AAAAAAAAAAAAATGCAGCTTGG - Intronic
1101771461 12:107755752-107755774 TAGAATAAGAAAATGAAGCTAGG + Intronic
1102141112 12:110615633-110615655 AAAAATAAAAAAAGCAAGCTGGG - Intronic
1102161693 12:110774330-110774352 AAAAATACAAAAATTAAGCTGGG + Intergenic
1102165756 12:110805260-110805282 AAAAAAAAAAAAATGAGGCTGGG - Intergenic
1102193907 12:111010546-111010568 GAAAATACAAAAATTTAGCTGGG + Intergenic
1102206897 12:111096983-111097005 AAAAAGAAAAAGAAGAAGTTGGG + Intronic
1102240391 12:111321171-111321193 AAAAATACAAAAATTAAGCTGGG + Intronic
1102249890 12:111379527-111379549 CAAAAAAAAAAGAAGAGGCTGGG + Intergenic
1102334009 12:112062099-112062121 GAATAAAAAAAGAAGAGGCTGGG + Intronic
1102361097 12:112288325-112288347 AAAAAAAAAAAGATGCAGCAAGG + Intronic
1102449430 12:113029705-113029727 AAAAAAAAAAAAATGAAGATTGG - Intergenic
1102452704 12:113053701-113053723 AAAAATAAAAAGAGGAAGGAAGG + Intergenic
1102473477 12:113173834-113173856 GAAAATAATATGATGAACCCCGG - Intronic
1102694768 12:114790246-114790268 GAAAAAAAAAAAAAAAAGCTGGG - Intergenic
1102857343 12:116305816-116305838 AAAAAAAAAAAAAGGAAGCTGGG - Intergenic
1102944599 12:116974904-116974926 ATAAATAAAAAGATGAAGGTAGG + Intronic
1103031439 12:117616858-117616880 AAGAATAAAAAGATGAATCATGG - Intronic
1103594470 12:122015737-122015759 AAAAATAAAAAAATAAAGTTAGG + Intergenic
1103769366 12:123308806-123308828 AAAAATAAAAAAATTAGGCTGGG + Intronic
1103770544 12:123319566-123319588 GAAAATACAAAAATTTAGCTGGG - Intronic
1103782105 12:123405811-123405833 GAAAAAAAAAAAGGGAAGCTGGG - Intronic
1104195564 12:126534174-126534196 GAAGATAAGAAGATGCAGATGGG + Intergenic
1104330806 12:127842964-127842986 GAAAAGAAAAAGATGGATCAAGG - Intergenic
1104497218 12:129252202-129252224 TAAAACCAAAAGATGGAGCTGGG + Intronic
1105275087 13:18914622-18914644 GCAAATAAAAACATAAAGTTTGG + Intergenic
1105285218 13:18998000-18998022 GAAAATTAAAAGATGGATGTTGG + Intergenic
1105332226 13:19428459-19428481 GAAAAGAAAAAGAAAAAACTTGG + Intronic
1105520551 13:21127157-21127179 GAAAAAAAAAAAAAGAAGCCAGG - Intergenic
1105862393 13:24427362-24427384 AAAAAAAAAAAAAAGAAGCTTGG - Intronic
1105870404 13:24500016-24500038 GAAAATAATAGGATGAAAATAGG + Intronic
1106121062 13:26860413-26860435 AGAAGTAAAAGGATGAAGCTGGG + Intergenic
1106688463 13:32087577-32087599 TAAAATCACAAGAGGAAGCTGGG - Intronic
1107155047 13:37155977-37155999 GCAAAAAAAAAGATGAAGGGAGG - Intergenic
1107376334 13:39808553-39808575 TAAAATGAAAATATGAAGGTGGG - Intergenic
1107422033 13:40256200-40256222 GAAAAAAATAAAATGAAACTAGG + Intergenic
1107502926 13:40999156-40999178 GAAAATATAAAGATAATGCATGG + Intronic
1107765067 13:43725804-43725826 AAAAAAAAAAAAAAGAAGCTAGG + Intronic
1107859024 13:44643160-44643182 AAAAACAAAAAGATGAGGCCAGG - Intergenic
1107888587 13:44894575-44894597 GCAAATACAAAGGTCAAGCTAGG + Intergenic
1107907582 13:45075604-45075626 TAAAATAATAAAATGAGGCTGGG + Intergenic
1107962695 13:45572655-45572677 GAAAATACCAAGAAGAAGGTTGG + Intronic
1108068138 13:46599975-46599997 TAAAATAAAAAAATTAAGATCGG - Intronic
1108135918 13:47359549-47359571 AAGAATAAAAAGATAAAGTTAGG - Intergenic
1108391713 13:49953614-49953636 GTAAATAAATAAATAAAGCTGGG - Intergenic
1108460210 13:50658367-50658389 TAAAAAAGAAAGATGAAGCAAGG - Intronic
1108538376 13:51410914-51410936 GAAAATAAGCACATGGAGCTGGG + Intronic
1108557653 13:51610952-51610974 AAAAATAAAATCATGAATCTAGG - Intronic
1108603316 13:52012711-52012733 GGAAAAAAAAAGCTGAAGCAGGG - Intronic
1109080253 13:57890552-57890574 AAAAAAAGAAAGATGGAGCTGGG - Intergenic
1109151138 13:58848468-58848490 GAAAACAAAATGATGAAAGTAGG - Intergenic
1109199806 13:59417678-59417700 GCAGATACAAAGATGAACCTTGG - Intergenic
1109240295 13:59878267-59878289 GAAAATAAAAGAATGGAGATGGG + Intronic
1109444972 13:62424586-62424608 TAAAATGAAAAGATTAGGCTAGG + Intergenic
1109493779 13:63140777-63140799 AAAAAAAAAAAAAAGAAGCTTGG + Intergenic
1109767627 13:66925851-66925873 CATAATAAATAAATGAAGCTCGG - Intronic
1110193579 13:72759802-72759824 AAGAAAAAGAAGATGAAGCTTGG - Exonic
1110301333 13:73931150-73931172 GAAAATTAAAATATGTGGCTAGG - Intronic
1110476867 13:75926248-75926270 TGAAATAACAAGATGAAACTAGG - Intergenic
1110883377 13:80601143-80601165 AAAAATAAAAATAATAAGCTGGG - Intergenic
1111230452 13:85339447-85339469 GAAAATAAATAGAAGACACTGGG - Intergenic
1111230954 13:85343189-85343211 GAAAATAAAGAGTTCAAGGTAGG + Intergenic
1111302595 13:86365221-86365243 CTTAATAAAAAGATGAAGTTTGG + Intergenic
1111368539 13:87284557-87284579 GAAAATAAAGAGAAGAAGGAAGG + Intergenic
1111736449 13:92146106-92146128 GAAAATAAATAGATGAGAATTGG + Intronic
1111761737 13:92475107-92475129 GAAAATAAACAGTTGAAGTCAGG + Intronic
1111891819 13:94091948-94091970 GAAAATAAATAAAATAAGCTTGG - Intronic
1111963790 13:94840044-94840066 GAAAATAAACATGTGAAGTTGGG + Intergenic
1111977812 13:94986036-94986058 AAAAATAAAAAGATAGGGCTGGG + Intergenic
1112124997 13:96455378-96455400 GAAAAAAAAAAAATGTAGCTGGG - Intronic
1112148709 13:96731814-96731836 AAAAATAAAAACATTTAGCTGGG - Intronic
1112274654 13:98005190-98005212 GAAAAAAAAAAAAAGAAGCCAGG - Intronic
1112432949 13:99368600-99368622 GAAAATAAATATATAAAGCAGGG + Intronic
1112496283 13:99907696-99907718 AAAAATAAATAAATAAAGCTGGG + Intergenic
1112546640 13:100377473-100377495 TAAAATAAAAAGATGGAGGCTGG - Intronic
1112742670 13:102492817-102492839 AAAAAAAAAAAGATGCACCTGGG + Intergenic
1112870508 13:103964899-103964921 AAAAAAAAAAAGATGATGGTAGG + Intergenic
1112883774 13:104143427-104143449 AAACATAAAAATATCAAGCTGGG - Intergenic
1112994563 13:105557250-105557272 GAAGATAAAAAGAGGAAGAGGGG + Intergenic
1113006475 13:105708270-105708292 GGTAATATGAAGATGAAGCTGGG - Intergenic
1113067526 13:106387384-106387406 GAAAATGAAAAGATGATTCAGGG + Intergenic
1113475783 13:110580183-110580205 AAAAATAAAAAAATTTAGCTGGG - Intergenic
1113833977 13:113316714-113316736 GAAAAAAAAATGCTGCAGCTGGG - Intronic
1113837956 13:113341560-113341582 GATAAGAAAAAAATGTAGCTGGG - Intronic
1114056303 14:18969969-18969991 GAAAATACAAAGAATTAGCTGGG + Intronic
1114106248 14:19431757-19431779 GAAAATACAAAGAATTAGCTGGG - Intronic
1114143113 14:19939922-19939944 AGAAACAAAAATATGAAGCTTGG + Intergenic
1114152833 14:20064143-20064165 AAAAAAAAAAAGGTGAAGCTGGG - Intergenic
1114161177 14:20169453-20169475 AAAAATACAAAAATGTAGCTGGG + Intergenic
1114291667 14:21293581-21293603 AAAAATACAAAAATTAAGCTGGG + Intronic
1114324704 14:21576929-21576951 GAAAACAAAAAGAGGTAACTGGG - Intergenic
1114428568 14:22640814-22640836 GAAAATATCAAGAAGAGGCTGGG - Intergenic
1114968737 14:27999920-27999942 AAAAATAAAAAAAAGAAGTTAGG - Intergenic
1115329587 14:32181643-32181665 AAAAAAAAAAAAGTGAAGCTTGG - Intergenic
1115382760 14:32758436-32758458 GAAACAAAAAAAATGAGGCTGGG + Intronic
1115734202 14:36306413-36306435 AAAAATAAAAAAAATAAGCTGGG - Intronic
1115773109 14:36687110-36687132 GAAAATACAAAAATTTAGCTGGG - Intronic
1115908010 14:38222891-38222913 AAAAATAAAAAGATTAAGGTGGG - Intergenic
1116004501 14:39277951-39277973 ATTAAAAAAAAGATGAAGCTGGG - Intronic
1116244882 14:42397088-42397110 GAAAACAAAATGATGTAGTTTGG + Intergenic
1116515509 14:45800353-45800375 AAAAATAAAAAGAATTAGCTGGG + Intergenic
1116562824 14:46402872-46402894 GAAAATAAATATATAAATCTGGG - Intergenic
1116943320 14:50811958-50811980 AAAAAAAAAAAAATGTAGCTGGG + Intronic
1117051246 14:51861550-51861572 CAAAATAAAAAAGTGCAGCTGGG + Intronic
1117052429 14:51874569-51874591 GAAAATAAAAAAAATTAGCTGGG + Intronic
1117109517 14:52435816-52435838 AAAAACAAAAAAATGAAGCCAGG + Intronic
1117163674 14:53013277-53013299 CAAAATAAAAATATGAAGGCCGG - Intergenic
1117181292 14:53194434-53194456 AAAAATAAAAAAAGAAAGCTGGG - Intergenic
1117256148 14:53980172-53980194 GAAGATAAAAGGAGGAAGCCTGG + Intergenic
1117292896 14:54350886-54350908 GAAAATACAAAAATTTAGCTGGG - Intergenic
1117309125 14:54504664-54504686 GAAATTAAAAAGAAAAAGCTAGG + Intergenic
1117825675 14:59700768-59700790 GAAAACAAACAAATGAATCTTGG + Intronic
1117965948 14:61206808-61206830 GAAAAAAAAAAGATGTTGGTGGG + Intronic
1118169404 14:63372087-63372109 GAAAAAAAAAAGAGAAAGGTGGG + Exonic
1118171071 14:63389122-63389144 AAAAAAAAAAAAATGAGGCTTGG - Intronic
1118196083 14:63627790-63627812 GAAAAAAAAAAAATTCAGCTGGG + Intronic
1118196246 14:63629311-63629333 GAGAATAAAGAGATGAAGTTTGG - Intronic
1118297951 14:64587755-64587777 GAAAAAAAAAAGAGGAGGCTGGG - Intronic
1118348461 14:64956925-64956947 AAAAAAAAAAAATTGAAGCTAGG - Intronic
1118456447 14:65949165-65949187 GAAATAAAACAAATGAAGCTTGG - Intergenic
1118952732 14:70449300-70449322 GAAAAAAAAAACATGAAATTTGG - Intergenic
1119241396 14:73063120-73063142 GATAATAAAAACAGGAACCTGGG - Intronic
1119398433 14:74346001-74346023 GCACATAAAAAGATGAAAATGGG + Intronic
1119458432 14:74777404-74777426 AAAAATAAAAAAATTTAGCTGGG + Intronic
1119459822 14:74791371-74791393 GAAAATAAAATGATGGGCCTTGG + Intronic
1119492307 14:75046017-75046039 GAAAATAAAAAAATTTAGCTGGG + Intronic
1119585512 14:75831425-75831447 GAAAATAAAAAGATAATGCTGGG - Intronic
1119830289 14:77696347-77696369 GAAAATAAAAAAAATTAGCTGGG - Intronic
1119851765 14:77871354-77871376 CAAAAAAAAAAGAAGAAGTTAGG - Intronic
1119987673 14:79157400-79157422 GAAAATAAATGGACAAAGCTGGG + Intronic
1120041824 14:79762457-79762479 GAAAAAAAAAAAGTGAAGCCAGG - Intronic
1120139690 14:80915172-80915194 GAAAAAAAAAAAATTTAGCTGGG - Intronic
1120534948 14:85683314-85683336 GTAAATAAAAAGAGGGAGCCAGG + Intergenic
1120790304 14:88574536-88574558 AAAAATATAAATATGAGGCTGGG - Intronic
1121136452 14:91503284-91503306 GAAAAAAAAAAAATGTAGCTCGG - Intronic
1121172293 14:91864766-91864788 AAAAAAAAAAAGATGAAGGCAGG - Intronic
1121351884 14:93180124-93180146 AAAAAAAAAAAAATGAAGCATGG - Intergenic
1121373266 14:93380513-93380535 GAAAATAAAAGAAGGAAGCAAGG - Intronic
1121477088 14:94218791-94218813 GAAAATAAAAAGGATAATCTTGG + Intronic
1121927033 14:97936941-97936963 GAGAATTAAGAGATGAAGTTAGG - Intronic
1122014943 14:98787355-98787377 GAAAAAAAAAAGATGGAGAAGGG - Intergenic
1122073520 14:99221009-99221031 AAATATAAAAAAATGTAGCTGGG - Intronic
1122225345 14:100273522-100273544 AAAAATAAAAAAATTAAGCCTGG - Intronic
1122523225 14:102361671-102361693 CAAAATAAAAAAATGAAGTTTGG + Intronic
1122530626 14:102423772-102423794 GAAAGAAAAAATATCAAGCTTGG + Intronic
1123635171 15:22299513-22299535 GACTATAAAAGGATGATGCTTGG + Intergenic
1123668628 15:22630273-22630295 AAAAAAAAAAAAATGGAGCTGGG - Intergenic
1123953371 15:25307083-25307105 AAAAAAAAAAAAATGAATCTAGG - Intergenic
1123981167 15:25605596-25605618 GAAAAAAACAATATGAAGTTGGG - Intergenic
1124052742 15:26213689-26213711 GAAAATGAAAAAATGTAGTTGGG + Intergenic
1124116791 15:26851103-26851125 AAAAATCAAAAGAAGAGGCTGGG - Intronic
1124190337 15:27569972-27569994 GGGAATAAAAAGCTGTAGCTTGG - Intergenic
1124228498 15:27918430-27918452 CCAAATAAAAACATGAAGGTTGG + Intronic
1124463283 15:29912713-29912735 AAAAAAAAAAAGAGGGAGCTTGG + Intronic
1124799556 15:32817700-32817722 GGAAATAAAGAAATGAGGCTTGG + Intronic
1124928331 15:34094244-34094266 AAAAATAAAAAAATCAAGCCAGG + Intronic
1125199364 15:37087368-37087390 GAAAATAGATACAAGAAGCTAGG + Intronic
1125398455 15:39274976-39274998 CAAAAACAAAAGGTGAAGCTTGG + Intergenic
1125704717 15:41723574-41723596 GAATATAAAAAGCTTTAGCTGGG - Intronic
1125832072 15:42724071-42724093 GAAAGTTAAAACATGAATCTTGG - Exonic
1125885879 15:43229128-43229150 AAAAAAAAAAAGCTGAAGCCTGG + Intergenic
1126006175 15:44260043-44260065 GAAAATAAAAAGACCAGCCTGGG + Intergenic
1126042109 15:44601546-44601568 AAAAAAAAAAAGAAGAGGCTGGG - Intronic
1126471826 15:49020666-49020688 GAAAATAAAAAAAATTAGCTGGG - Intronic
1126581241 15:50244461-50244483 AAAAATTAAAAAATGTAGCTGGG - Intronic
1126625705 15:50684344-50684366 GGAAATAAAGAGTAGAAGCTGGG + Intronic
1126635906 15:50779654-50779676 GAAAATAAAAAAAACTAGCTGGG + Intergenic
1126651996 15:50932357-50932379 GAAAATAAATTGATGAATCTAGG - Intronic
1126840051 15:52709095-52709117 CAAAAAAGAAAGATGAACCTAGG + Intronic
1127040578 15:54971486-54971508 GACAAAAAAAAAATCAAGCTCGG + Intergenic
1127206030 15:56720040-56720062 TAAAATAAGACAATGAAGCTTGG + Intronic
1127611556 15:60642235-60642257 GAAAAAAAAAAGAAGAAAATGGG + Intronic
1127671794 15:61201998-61202020 AAAAAAAAAAAGATCAAGCAGGG - Intronic
1127712219 15:61610892-61610914 GAAAATAGAAAGACGAGTCTGGG + Intergenic
1127737808 15:61861262-61861284 GAAAATAAGGAGATGAAAATAGG - Intronic
1128069605 15:64786569-64786591 AAAAATAAAAAAATTAGGCTGGG + Intergenic
1128332935 15:66767948-66767970 AAAAAAAAAAAGATGCAGCTTGG - Intronic
1128340271 15:66817792-66817814 AAAAAAAAAAAAAAGAAGCTGGG + Intergenic
1128367860 15:67017396-67017418 AAAAAAGAAAAGATGCAGCTGGG + Intergenic
1128467770 15:67927276-67927298 AAAAAAAAAAAAAAGAAGCTAGG - Intergenic
1128508393 15:68297098-68297120 CAAAATAAAAAGAATTAGCTGGG - Intronic
1128776834 15:70326931-70326953 GAAAAGAAAAAAATAAAGTTGGG - Intergenic
1128957105 15:71959853-71959875 AAAAAAAAAAAGATGAAGTATGG + Intronic
1128957730 15:71966207-71966229 GAAAGTAAAAAGATGGAGAAAGG - Intronic
1128975502 15:72150122-72150144 TAAAATAAAAAAATAAATCTGGG - Intergenic
1128987797 15:72233869-72233891 AAACAAAAAAAGATCAAGCTTGG + Intergenic
1129067256 15:72915818-72915840 TAAAATATAAAAATGAGGCTGGG - Intergenic
1129280802 15:74483471-74483493 AAAAATAAAAATATTTAGCTGGG + Intergenic
1129300971 15:74625275-74625297 CAAGATAAAAACATGAAGTTGGG + Intronic
1129575400 15:76738131-76738153 AAAAAGAAAAAAATAAAGCTGGG - Intronic
1129633647 15:77290546-77290568 AAAAAAAAGAAGAAGAAGCTGGG - Intronic
1129770343 15:78199653-78199675 GAAAAAAAAAAAAAAAAGCTGGG - Intronic
1130534860 15:84777117-84777139 GAAAAAAAATAGAAGAAACTAGG - Intronic
1130761520 15:86825620-86825642 GAAAATAAAAAAAGGAAGGAAGG + Intronic
1130958155 15:88641614-88641636 AAAAATAAAAAGAGGAAGTTTGG - Intronic
1131216308 15:90538762-90538784 AAAAAAAAAAAGGTGAAGTTTGG - Intronic
1131522046 15:93123858-93123880 AAAAAAAAAAAGATCCAGCTAGG - Intergenic
1131545159 15:93309718-93309740 AAAAATACAAAAATTAAGCTTGG + Intergenic
1131674794 15:94660947-94660969 TAAAATAAAAAGATCAAACTAGG - Intergenic
1131740968 15:95390923-95390945 GAAAATCAAAAGAATTAGCTGGG + Intergenic
1131793822 15:95992976-95992998 AAAAAAAAAAAGACTAAGCTAGG + Intergenic
1131803528 15:96097733-96097755 TAAAAAAAAAAAATGAAACTAGG - Intergenic
1132895264 16:2226099-2226121 AAAAAAAAAAAGATGCAGATTGG + Intronic
1132942823 16:2516633-2516655 GAGAAAAAAAAGGGGAAGCTGGG - Intronic
1133122599 16:3619520-3619542 AAAAATACAAAAATGGAGCTAGG - Intronic
1133249416 16:4470650-4470672 AAAAATAAAAAAATGAGGCCGGG + Intronic
1133266939 16:4590721-4590743 AAAAATACAAAGATTAGGCTGGG + Intronic
1133311387 16:4848798-4848820 TTAAATAAAAACATGAATCTTGG + Intronic
1133549006 16:6835590-6835612 AAAAATAAAAAAAAGTAGCTGGG + Intronic
1133632640 16:7636109-7636131 GAATAGAAAAAGAGGTAGCTTGG - Intronic
1133754043 16:8748866-8748888 GAAAGTAAAAAGATGGAGAAAGG - Intronic
1133754319 16:8751242-8751264 AAAAATAAAAAAATTAGGCTGGG - Intronic
1133754607 16:8753081-8753103 AAAAAAAAAAAGAATAAGCTTGG - Intronic
1133943595 16:10330202-10330224 GAAAATAAAAAAAATTAGCTGGG - Intronic
1134130463 16:11646146-11646168 AAAAAAAAAAAGAAGAGGCTGGG - Intergenic
1134194387 16:12147873-12147895 CAAAATAAAAAGAAGTTGCTTGG - Intronic
1134366544 16:13584314-13584336 GAAAATAAAATGATAAGGCTAGG + Intergenic
1134591856 16:15461126-15461148 AAAAAAAAAAAAAAGAAGCTAGG + Intronic
1134746982 16:16595977-16595999 GAAAAAAAAAAAAAAAAGCTGGG + Intergenic
1135011241 16:18880967-18880989 GAAAAAAAAAAAAAAAAGCTGGG + Intronic
1135035109 16:19070571-19070593 AAAAATATAAAAATGTAGCTGGG + Intronic
1135104457 16:19635886-19635908 CAAAATAAAAAGTTAAAGCCAGG + Intronic
1135139086 16:19906566-19906588 CAAAAAAAAAAGATGAAGAGAGG - Intergenic
1135141811 16:19928405-19928427 GAAAATCAATAGATTAGGCTGGG - Intergenic
1135158086 16:20071579-20071601 GAACTTAAAAGGATGAAGCTAGG - Intronic
1135263985 16:21005672-21005694 AAAAAAAAAAAAATGAGGCTGGG - Intronic
1135440753 16:22470347-22470369 GAAAAAAAAAAAAAAAAGCTGGG - Intergenic
1135490230 16:22903129-22903151 GAGAATATAAAAATGAATCTTGG - Intronic
1135573805 16:23569392-23569414 GAAAATACAAATATTTAGCTGGG + Intronic
1135686518 16:24502319-24502341 GAAAATAAAAAAAATTAGCTGGG - Intergenic
1135742461 16:24987789-24987811 TAAAATGAAAAAATGAAGCATGG + Intronic
1135754773 16:25087824-25087846 TAAAATGAAAAAATGAAGCATGG + Intergenic
1135904669 16:26500263-26500285 GAAAAAAAAAAGAAGAAGGTGGG + Intergenic
1135925114 16:26687251-26687273 TAAAATAAGAAGATGAGGCCTGG - Intergenic
1136129841 16:28212612-28212634 AAAAATAAAAAAATTTAGCTGGG - Intergenic
1136130260 16:28215892-28215914 AAAAATACAAAAATGAGGCTGGG + Intergenic
1136318656 16:29468378-29468400 AAAAAAAAAAAGGTCAAGCTGGG - Intergenic
1136347050 16:29682673-29682695 GAAAAAAACATGATGAGGCTGGG - Intronic
1136433228 16:30207724-30207746 AAAAAAAAAAAGGTCAAGCTGGG - Intronic
1136447197 16:30329702-30329724 GAAAACAAAAAAAAGTAGCTGGG + Intergenic
1136592838 16:31227934-31227956 ATAAAATAAAAGATGAAGCTGGG - Intergenic
1137015694 16:35372139-35372161 TAAAATAAAAAAATTTAGCTGGG + Intergenic
1137406332 16:48192449-48192471 AAAAAAATAAAAATGAAGCTGGG + Intronic
1137431752 16:48423804-48423826 AAAAATACAAAGATTAGGCTGGG - Intronic
1137649909 16:50110864-50110886 GAAAATGCTAAGATGACGCTTGG + Intergenic
1138523067 16:57583260-57583282 GAAAGTAAAAAGATGAATCAAGG + Intronic
1138932894 16:61683018-61683040 GAAAATAAATGAATTAAGCTTGG + Intronic
1139293373 16:65878044-65878066 GAAAATAAATACATTAAGATTGG - Intergenic
1139412857 16:66779435-66779457 AAAAATAAAAATAATAAGCTGGG + Intronic
1139564995 16:67769090-67769112 GAAATTAAAAATATAAAGCATGG - Intronic
1139579877 16:67866459-67866481 GAAAAAAAAAAAATTAGGCTTGG - Intronic
1139684709 16:68593996-68594018 CAAAAAAAAAAGATGTTGCTGGG - Intergenic
1139697135 16:68683087-68683109 AAAAAGAAAAAAATGAAGATGGG + Intronic
1139878938 16:70168033-70168055 GAAAAAAAAAAAAAGTAGCTGGG + Intergenic
1139904964 16:70358324-70358346 AAAAATAAAAAAATAAGGCTGGG - Intronic
1139913396 16:70412888-70412910 AAAAATAAAAAAATTAAGCGTGG + Intronic
1140052929 16:71498852-71498874 AAAAAAAAAAAGATGAAGTAGGG - Intronic
1140243170 16:73223012-73223034 CAATATAAAAAAATGAATCTAGG + Intergenic
1140373580 16:74427460-74427482 GAAAAAAAAAAAAAGTAGCTGGG - Intergenic
1140395032 16:74619024-74619046 AAAAAAAAAAAAAAGAAGCTGGG + Intergenic
1140413597 16:74757040-74757062 GAAAAAAAAAACATTAAGCAAGG + Intronic
1140443735 16:75007048-75007070 AAAAAAAAAAAGATTAAACTTGG - Intronic
1140460074 16:75132378-75132400 AAAAAAAAAAAAATGAAGCAGGG + Intergenic
1141108697 16:81254507-81254529 GCACATAAAAAGGTGAGGCTAGG - Intronic
1141113363 16:81288421-81288443 AAAAATAAAAAGAATGAGCTAGG - Intronic
1141371355 16:83489088-83489110 CACAAGAAAAAGATGAAGCATGG + Intronic
1141452159 16:84111903-84111925 AAAAAAAAAAAAATGCAGCTGGG + Intronic
1141532937 16:84659296-84659318 GAAATTAAACAGAAGAGGCTGGG - Intronic
1141683661 16:85557952-85557974 GAAAAAAAAAAGATCAAGAATGG - Intergenic
1141824671 16:86470774-86470796 AAAAAAAAAAACATGAAGTTTGG + Intergenic
1141848044 16:86624364-86624386 ATAAAGAAAAAGATGCAGCTAGG - Intergenic
1141929648 16:87193552-87193574 AAAAATAAAAAAATTTAGCTGGG - Intronic
1141980767 16:87548710-87548732 GAAAATAGAAAGATGGAGGCCGG + Intergenic
1142320746 16:89381169-89381191 AAAAATAAAAATAATAAGCTGGG + Intronic
1142541264 17:661224-661246 GAAAAAAAAAAGTTGCAGCTGGG + Intronic
1142695938 17:1633685-1633707 AAAAAAAAAAAAATAAAGCTCGG + Intergenic
1142786196 17:2225342-2225364 AAAAAAAAAAAGAAAAAGCTGGG + Intronic
1142893702 17:2961217-2961239 CAAAAAAAAAAGAAGAGGCTGGG + Intronic
1143051553 17:4130156-4130178 AAAAATAAAAATATGAGGTTGGG + Intronic
1143546827 17:7601928-7601950 AAAAAAAAAGAAATGAAGCTAGG + Intronic
1143561860 17:7701262-7701284 AAAAATACAAAAATGAGGCTGGG - Intronic
1143566008 17:7721167-7721189 AAAAATAAAAAAAATAAGCTGGG - Intronic
1143622892 17:8091175-8091197 GAGATTAGAAAGAGGAAGCTGGG - Intergenic
1143666792 17:8367018-8367040 GAAAATAAGTAGATGAAGGAAGG - Intergenic
1143741339 17:8956216-8956238 AAAAAAAAAAAGATGCAGGTTGG + Intronic
1143825724 17:9605414-9605436 GACAATAAAAAGATCAGGCTGGG + Intronic
1143828508 17:9632066-9632088 GAAAAAAAAAAGTGGAGGCTGGG - Intronic
1143876675 17:9996797-9996819 AAAAATATAAAAATGAACCTGGG - Intronic
1143953276 17:10650269-10650291 TATAATAAAAAGATCAGGCTGGG - Intronic
1143958184 17:10691730-10691752 GTGAATAAAAAGGTGAAGCTAGG - Intronic
1144295589 17:13872113-13872135 GAAAAAAAAATGATGATGCCAGG - Intergenic
1144535132 17:16081388-16081410 AAAAAAAAAAAGCTGAATCTAGG + Intronic
1144762192 17:17713478-17713500 GAAAATACAAAAATTTAGCTGGG + Intronic
1144800884 17:17926176-17926198 GAAAAAAAAAAAAAAAAGCTAGG + Intronic
1145165252 17:20609085-20609107 GAAAAAAAAAAGATTGGGCTGGG - Intergenic
1145353648 17:22115316-22115338 GCAAGTAATAAGCTGAAGCTGGG + Intergenic
1145715853 17:27020346-27020368 AAAAATACAAAAATGTAGCTGGG + Intergenic
1145726118 17:27126444-27126466 GAAAAAGAAAAGATGAAGAAAGG + Intergenic
1145754975 17:27383716-27383738 GAAAATAAAAAAAATTAGCTGGG - Intergenic
1145927288 17:28657718-28657740 TAAAAGAAAAAAAAGAAGCTGGG + Intronic
1145951579 17:28822462-28822484 AAAAATACAAAAATTAAGCTGGG + Intronic
1146020093 17:29270331-29270353 AAAAAAAAAAAGATGACGATCGG + Intronic
1146044071 17:29487568-29487590 GGAAAGCACAAGATGAAGCTAGG + Intronic
1146204443 17:30890182-30890204 AAAAAGAATAATATGAAGCTGGG - Intronic
1146287365 17:31582873-31582895 GAAAATGAAGAGATGAGGCCAGG + Intergenic
1146349178 17:32081204-32081226 AAAAAAAAAAAGATTAGGCTGGG - Intergenic
1146829763 17:36058349-36058371 AATACTAAAGAGATGAAGCTGGG + Intergenic
1146945897 17:36873295-36873317 AAAAATAAAAAGAATTAGCTGGG - Intergenic
1147007049 17:37411777-37411799 GAAAAATAAACGATGAAGTTAGG + Intronic
1147013540 17:37471799-37471821 AAAAATAAAAAGTTTAGGCTGGG - Intronic
1147225087 17:38970225-38970247 GAAAAGAAAAACATAAGGCTGGG - Intergenic
1147275756 17:39315090-39315112 GCAAATACAAAAATTAAGCTGGG - Intronic
1147293078 17:39459419-39459441 TAAAATAAAAAGATCAGGCCAGG - Intergenic
1147297919 17:39499502-39499524 GAAAAAAAAAAAAAGAGGCTGGG - Intronic
1147366035 17:39959907-39959929 GAAAAGAAAAAGACGCAGCTGGG + Intergenic
1147371517 17:39996125-39996147 AAAAAAAAAAAGAAGAAGCTGGG + Intronic
1147385451 17:40078716-40078738 AAAAAAAAAAAGATGAAGGCTGG - Intronic
1147603778 17:41762380-41762402 GAAAAGAAAAACAGGAGGCTGGG - Intronic
1147634754 17:41956876-41956898 GAAAATAAGAAAATAAGGCTAGG - Intronic
1147750107 17:42726172-42726194 AAAAAAAAAAAGCAGAAGCTGGG - Intronic
1147855534 17:43476776-43476798 GAAAAGAAAAAGAATAAGTTGGG + Intergenic
1147941182 17:44049436-44049458 AAAAATAAAAAAAAGTAGCTGGG - Intronic
1147960372 17:44163756-44163778 AAAAATAAAAAAATTAGGCTGGG - Intergenic
1148004784 17:44418152-44418174 GAAAAGAAAAAGAGGAAGAAAGG + Intronic
1148016588 17:44525956-44525978 GAAAAAAAAAAAAAGAAGCCAGG + Intergenic
1148061129 17:44837195-44837217 AAAAAAAAAAAGATGTAGCTGGG + Intergenic
1148100668 17:45088770-45088792 AAAAAAAAAAAGAGGCAGCTTGG + Intronic
1148164443 17:45473291-45473313 GAAAAAAAAAGAATGAGGCTGGG + Intronic
1148612157 17:48971702-48971724 GAAATTGAAAAGATGACCCTGGG + Intergenic
1149193721 17:54094330-54094352 AAAAATAAAAATGTGATGCTGGG + Intergenic
1149514235 17:57267984-57268006 GAAAAGATAATGATGAAGCTGGG - Intronic
1149785770 17:59433702-59433724 CAATATAAAATGAGGAAGCTGGG + Intergenic
1150006683 17:61474156-61474178 GAAAATAAAATTATGATGCAGGG + Intronic
1150046590 17:61919568-61919590 GAAAATAAAAAAAATTAGCTGGG - Intronic
1150149217 17:62795371-62795393 AAAAAAAAAAAAAAGAAGCTAGG + Intronic
1150586463 17:66522813-66522835 AAAAAAAAAAAGAAGAAGCCAGG + Intronic
1150660862 17:67076840-67076862 AAAAAAAATAAGATGAGGCTGGG - Exonic
1150775159 17:68075319-68075341 GTAAATAAAAATATGAGGCCGGG - Intergenic
1150856098 17:68754287-68754309 AAAAAAAAAAAGATGAAAGTGGG + Intergenic
1150918521 17:69460034-69460056 GGAAAGAAAAAGATGAAGGGAGG - Intronic
1150968078 17:69994849-69994871 GAAAATAAATAGCTGAGACTTGG - Intergenic
1151013025 17:70523444-70523466 GAAAATAAAAATATTAGGCCAGG + Intergenic
1151208079 17:72523017-72523039 AAAAATAAAAACAATAAGCTGGG + Intergenic
1151285880 17:73110764-73110786 AAAAAAAAAAAGATGAAATTTGG + Intergenic
1151472960 17:74329285-74329307 GAAAATACAAAAATTTAGCTGGG + Intronic
1151648774 17:75452502-75452524 GAAAAGAAAAAAAGGGAGCTGGG - Intronic
1152087349 17:78228446-78228468 AAAAAAAAAAAGAAGAGGCTTGG + Intergenic
1152090973 17:78247599-78247621 AAAAAAAAAAAAATGAAGCCAGG - Intergenic
1152105664 17:78327281-78327303 AAAAATACAAAAATTAAGCTGGG + Intergenic
1152112227 17:78363367-78363389 AAAAAAAAAAAAAAGAAGCTTGG - Intergenic
1152222805 17:79078349-79078371 AAAAATAAAAAAAGGAAGGTTGG + Intronic
1152584998 17:81185046-81185068 GAAAATAAAAAGAAGGGGCCGGG + Intergenic
1203192878 17_KI270729v1_random:205755-205777 GAAAATAAAAAGATGATTGAAGG - Intergenic
1203202242 17_KI270730v1_random:5190-5212 GAAAATAAAAAGATGATTGAAGG - Intergenic
1153025439 18:668218-668240 GATTTTAAAAAGATGAACCTTGG - Intronic
1153062684 18:1010541-1010563 GAAAAAAATAAAATGAACCTTGG - Intergenic
1153066465 18:1050899-1050921 GAAAATAAAAAGGGGAAGAAAGG - Intergenic
1153171826 18:2325498-2325520 GAAAACAAAAAAATGGAGCTGGG + Intergenic
1153308139 18:3651495-3651517 AAAAATAGAAAGATTCAGCTGGG + Intronic
1153379359 18:4419628-4419650 GAAAATAATAAGATAAAGGATGG + Intronic
1153478295 18:5520566-5520588 AAAAAAAAAAGGATGAGGCTAGG + Intronic
1153701766 18:7701437-7701459 AAAAATAAAAAAAAGTAGCTGGG + Intronic
1153808166 18:8728893-8728915 TAAAACAAAAAGAAAAAGCTGGG - Intronic
1153848737 18:9072991-9073013 GAAAATACAAAAATTAGGCTGGG + Intergenic
1154228886 18:12535613-12535635 GAAAATAAAATAATGGTGCTTGG + Intronic
1154249739 18:12734492-12734514 GAAAATAAATAAATAAAACTAGG + Intergenic
1154264216 18:12865646-12865668 TAAAATAAAAAGAGTGAGCTGGG + Intronic
1154381213 18:13851756-13851778 AAAAATACAAAGAAGCAGCTAGG + Intergenic
1154465064 18:14635690-14635712 AAAAATAAAAAAATAAAGATGGG + Intergenic
1154466715 18:14651762-14651784 GCAAATAAAAACATAAAGTTTGG + Intergenic
1155344359 18:24843819-24843841 AAAAAAAAAAAAATGAGGCTGGG - Intergenic
1155390978 18:25336321-25336343 TAAATTAAAAAGATAAATCTGGG - Intronic
1155400322 18:25431937-25431959 GAAAATATAAAGATGAACCTAGG + Intergenic
1155432294 18:25772274-25772296 GAAAATAAGAAAATGGGGCTGGG + Intergenic
1155463646 18:26111782-26111804 AAAAATAGAAAAATTAAGCTGGG - Intergenic
1155688562 18:28586718-28586740 GAAAATGAAAAGATTACACTTGG - Intergenic
1155802669 18:30128553-30128575 AAAAATAAAAAGATGATTCCAGG - Intergenic
1155951240 18:31915599-31915621 AAAAATACAAAAATGAAGCCGGG + Intronic
1156341499 18:36213944-36213966 AAAAAAAAAAAGAAGAAGCCGGG + Intronic
1156889332 18:42171773-42171795 TAAAAGAAAAAAATGAGGCTGGG - Intergenic
1156917266 18:42476462-42476484 GAAAATGTAAGGATGAAGATGGG + Intergenic
1157354754 18:46922496-46922518 AAAAATAAAAAGTTGAGGCTGGG + Intronic
1157440793 18:47710156-47710178 GAACAAAAAAAAATGAGGCTTGG + Intergenic
1157869378 18:51215891-51215913 AAAAATAAAAAAATTTAGCTGGG - Intronic
1157894568 18:51452788-51452810 GAAAATAAAAACATGAATGGTGG - Intergenic
1158015516 18:52778667-52778689 GAAAAGAAAAAGAAAAAACTAGG - Intronic
1158356560 18:56626971-56626993 AAAAAAAAAAAAATGTAGCTTGG - Intronic
1158442773 18:57492074-57492096 AAAAAAAAAAAAATTAAGCTGGG - Intergenic
1158590958 18:58778446-58778468 GAAAAAAAAAAGCTTCAGCTGGG + Intergenic
1158662141 18:59397713-59397735 AAAAAAAAAAAGAAGAAACTAGG + Intergenic
1158880141 18:61770262-61770284 TAAAATAAACAGATGATCCTGGG + Intergenic
1159000474 18:62970467-62970489 TAAAATAAGAAAATGAGGCTGGG + Intronic
1159221588 18:65471775-65471797 GAAAATAAAACAATGAATCTCGG + Intergenic
1159242664 18:65762831-65762853 GAAAAAAAAAAGATGAAGTTGGG + Exonic
1159433826 18:68389660-68389682 GCAAAGACAAACATGAAGCTTGG + Intergenic
1159598758 18:70408823-70408845 GAAAATCAAAAGATAAATGTTGG - Intergenic
1159624262 18:70673528-70673550 TAAAAAAAAATCATGAAGCTCGG - Intergenic
1159749294 18:72280505-72280527 GAAAATGAAAAAAAGAAACTGGG + Intergenic
1160180362 18:76629644-76629666 GCAAACAAAAACATAAAGCTGGG - Intergenic
1160983034 19:1825344-1825366 GAAAACAGAGGGATGAAGCTGGG + Intronic
1161114762 19:2490430-2490452 AAAAAAAAAAAAATGAGGCTGGG - Intergenic
1161229526 19:3166307-3166329 AAAAAAAAAAAGAGGAGGCTGGG - Intergenic
1161742197 19:6028709-6028731 AAAAAAAAAAAGATGAAACTTGG + Intronic
1161861320 19:6800603-6800625 CAAAACAAAAAAAAGAAGCTGGG - Intronic
1161951039 19:7468254-7468276 AAAAAAAAAAAAATGAAGCTGGG + Intronic
1161980355 19:7627082-7627104 GAAAATAAAGACATGAATCACGG + Intronic
1162038295 19:7954138-7954160 AAAAATACAAAGATTTAGCTGGG - Intergenic
1162051602 19:8037285-8037307 GAAAAGAGAAAGAAGAAGCTGGG - Intronic
1162083193 19:8231986-8232008 AAAAAAAAAAAGAAAAAGCTGGG - Intronic
1162092176 19:8287652-8287674 AAAAAAAAAAAGAGGAAGCCAGG + Intronic
1162144709 19:8606560-8606582 AAAAATACAAAAATGTAGCTGGG - Intronic
1162213912 19:9116317-9116339 AAAAAAAAAAAGATGAGGCTGGG - Intergenic
1162310633 19:9905024-9905046 GAAAAAAAAAAGTTGAGGCCAGG + Intronic
1162311190 19:9908283-9908305 AAAAATAAAAAGAATTAGCTGGG - Intronic
1162457507 19:10794769-10794791 GAAAGAAAAAAGAAAAAGCTGGG + Intronic
1162545738 19:11328343-11328365 AAAAAAAAAAAGAAGAAGGTTGG + Intronic
1162570606 19:11470057-11470079 AAAAATAAATAAATAAAGCTGGG + Intronic
1162677682 19:12312643-12312665 GAAAAAAAAAAGAAAAAGCAGGG - Intergenic
1162764331 19:12909145-12909167 GAAGATACAAAGATGAAGGATGG - Intronic
1162838107 19:13334871-13334893 GAAAAATAAAAAATGTAGCTGGG + Intronic
1162957835 19:14109185-14109207 AAAAATAAAAAAATGAGGCCAGG + Intronic
1162983238 19:14252754-14252776 AAAAAAAAAAAGATTAGGCTGGG + Intergenic
1163036843 19:14574690-14574712 AAAAATAAAAAAATAAAGCCAGG - Intergenic
1163140245 19:15342992-15343014 AAAAAAAAAAAATTGAAGCTGGG + Intergenic
1163147627 19:15391830-15391852 AAAAATAAAAACATAAGGCTGGG - Intronic
1163278637 19:16301570-16301592 AAAAATAAAAAAATAAAGCCAGG + Intergenic
1163316549 19:16544335-16544357 TAAAATAAAAAGAGGAAGAAAGG + Intronic
1163486252 19:17588299-17588321 AAAAAAAAAAAAATCAAGCTGGG + Intergenic
1163503440 19:17689262-17689284 TAAAATAAAAAAAAAAAGCTGGG - Intergenic
1163511523 19:17738346-17738368 CAAATTAAAAAGAGAAAGCTGGG + Intergenic
1163578835 19:18126059-18126081 AAAAAAAAAAAGATGTAGCTGGG + Intronic
1163939569 19:20479426-20479448 GAGAATATAAAGAGGAGGCTTGG + Intergenic
1164064354 19:21702800-21702822 AAACATAAAAAGCTGAGGCTGGG + Intergenic
1164109984 19:22147348-22147370 AAAAATAAAAAAATTTAGCTGGG - Intergenic
1164314805 19:24077930-24077952 GAAAATAAAAAAAAAGAGCTTGG + Intronic
1164628273 19:29743882-29743904 AAAAATAAAAAAAAGTAGCTGGG + Intergenic
1164635234 19:29786736-29786758 AAAAATAAAAAAATTTAGCTGGG - Intergenic
1164659798 19:29953967-29953989 GAAACTAAAAAAATAAAACTGGG + Intronic
1164848340 19:31454984-31455006 GAAAGTAAAAAAATGAAGACAGG + Intergenic
1164890859 19:31821921-31821943 AAAAATAAATAAATGAGGCTGGG + Intergenic
1164983271 19:32630061-32630083 AAAAATAACAAGATGAAGCTGGG - Intronic
1165084678 19:33335850-33335872 AAAAAAAAAAAGAAGATGCTTGG - Intergenic
1165173523 19:33909990-33910012 GAAAATACAAAGAATTAGCTGGG + Intergenic
1165294379 19:34914984-34915006 CAAGACAGAAAGATGAAGCTGGG + Intergenic
1165430528 19:35769298-35769320 AAAAAAAAAAAAAAGAAGCTGGG - Intronic
1165456592 19:35915098-35915120 GAAAAGAAAAAAAAGAGGCTGGG + Intergenic
1165647830 19:37458164-37458186 GAATATAAAAATATCAGGCTGGG - Intronic
1165648004 19:37460592-37460614 ACAAGTAAAGAGATGAAGCTAGG + Intronic
1165665044 19:37621122-37621144 AAAAAAAAAAAGATTAATCTGGG - Intronic
1165726494 19:38116550-38116572 GAAAAGAAAAAGAACAGGCTGGG + Intronic
1165732754 19:38157001-38157023 AAAAATAAAAAAATATAGCTAGG + Intronic
1165768121 19:38363333-38363355 AAAAATAAAAAGTTAAGGCTGGG - Intronic
1166090476 19:40505394-40505416 AAAAAAAAAAAGAAGAAGCCGGG + Intronic
1166124861 19:40708610-40708632 CAAAATAAAAAGTTGAGGGTAGG - Intronic
1166124955 19:40709396-40709418 TAAAATAAAAAGTTGAGGGTAGG - Intronic
1166314951 19:41984517-41984539 AAAAATAAAATAATGAGGCTGGG - Intronic
1166549225 19:43654127-43654149 AAAAAAAAAAAAATGTAGCTGGG + Intronic
1166787653 19:45378659-45378681 AAAAATAAAAAAATTAAGCCAGG - Intergenic
1166962950 19:46510299-46510321 AAAAAAAAAAAGATGATACTGGG + Intronic
1167010127 19:46801728-46801750 AAAAAAAAAAAGAAGAAGCTGGG - Intergenic
1167025771 19:46916714-46916736 AAAAAAAAATAGATGAATCTGGG - Intergenic
1167102389 19:47411833-47411855 GAAAAAAAAAAGATAAGGCCGGG - Intronic
1167130834 19:47584568-47584590 AAAAAAAAAAAGATGTGGCTGGG + Intergenic
1167256681 19:48434412-48434434 AAAAATAAAAAGAACTAGCTGGG - Intronic
1167400550 19:49265411-49265433 GAAAAAAAAAAAAAGAGGCTAGG + Intergenic
1167745521 19:51349439-51349461 GAAAAAAAAAAAAAGAAGCAAGG - Intronic
1167946081 19:52990241-52990263 AAAAAAAAAAAAAAGAAGCTGGG + Intergenic
1168085737 19:54044397-54044419 GAAAATATAAAAAATAAGCTGGG + Intronic
1168090319 19:54078660-54078682 AAAAATACAAAAATGAGGCTGGG - Intronic
1168298952 19:55392526-55392548 AAAAAAAAAAAGATGAGGCTGGG - Intronic
925103212 2:1267064-1267086 GTGAAGAGAAAGATGAAGCTGGG - Intronic
925477181 2:4230294-4230316 GAACATGAAAAGTTGAAGTTGGG - Intergenic
925623043 2:5812539-5812561 CAAAACAAAAAGATCAAGCTGGG - Intergenic
925659793 2:6190326-6190348 AAAAATAAAAGGTTGAAGCCAGG + Intergenic
925897865 2:8487360-8487382 TAAAATAAAACGCAGAAGCTGGG - Intergenic
925955320 2:8958349-8958371 AAAAATAAAAATATGAAAGTTGG + Intronic
926206464 2:10837441-10837463 GAAAAAAATAAGATGAAGCCAGG + Intronic
926309793 2:11667196-11667218 CAAAATAAAAAATTGAAGCAAGG - Intronic
926659725 2:15451209-15451231 GAAAATAAAAATAATTAGCTGGG - Intronic
926975344 2:18511043-18511065 AGAGATAAAAAGCTGAAGCTTGG - Intergenic
927292897 2:21422159-21422181 GAAAACAACAGGATGAAGCTTGG + Intergenic
927912302 2:26908887-26908909 GAAAAGAAAAAGAGGAAGAAGGG - Intronic
927970055 2:27299966-27299988 AAAAATAAATAAATGGAGCTGGG - Intronic
928009361 2:27593621-27593643 CAAAACAAAAAGATGTATCTTGG + Intronic
928151059 2:28829646-28829668 GAAAATACAAAAATTAGGCTGGG + Intronic
928161330 2:28928487-28928509 GAAATTAAAAAGTTGAAACTAGG - Intronic
928340847 2:30441921-30441943 GAAAATAAAAAAATACAGCCGGG + Intergenic
928546412 2:32333098-32333120 AAAAATAAATAGAAGAGGCTGGG + Intergenic
928571322 2:32612034-32612056 GAAAATAAAAAAATTTAACTGGG - Intronic
928868055 2:35942091-35942113 AGGAATAAAAATATGAAGCTGGG - Intergenic
928972639 2:37047046-37047068 AAAAAAAAAAAAAAGAAGCTGGG + Intronic
929004167 2:37379386-37379408 AAAAATAAAAAAAAGTAGCTAGG + Intergenic
929009827 2:37430214-37430236 GAAAAAAAAAAGATGGATCAAGG - Intergenic
929117006 2:38452913-38452935 GAAAAAAAAAAAAGGAAGCAGGG + Intergenic
929432661 2:41901584-41901606 GGAAAGAAAAAGATGGAGCCAGG - Intergenic
929639711 2:43565439-43565461 AAAAAAAAAAAGATGAATCTAGG + Intronic
929751539 2:44719266-44719288 GAAATTAAAAAGATTAGGGTAGG - Intronic
929898394 2:45981123-45981145 GAAAATGCAACAATGAAGCTAGG + Intronic
930015380 2:46966785-46966807 GAAAAAAAAAAAAAAAAGCTGGG - Intronic
930039475 2:47109013-47109035 AAAAATAAAAACATAAAGGTGGG - Intronic
930073016 2:47383596-47383618 AAAAAAAAAAAGAAGAAGCCGGG - Intronic
930082769 2:47467431-47467453 AAAAAAAAAAAGATAAGGCTGGG - Intronic
930102905 2:47616994-47617016 TAAAAAAAAAAATTGAAGCTTGG - Intergenic
930376327 2:50571828-50571850 AAAAACAAAAAGAGGCAGCTGGG + Intronic
930531247 2:52591104-52591126 AAAAATAAAAAAATTTAGCTAGG - Intergenic
930997552 2:57738990-57739012 GTAATTAAAGAGATAAAGCTTGG + Intergenic
931277937 2:60760586-60760608 GAAAATTTAAAGATGAAGGAGGG + Intronic
931356732 2:61543654-61543676 GAAAATAAAACAAAGTAGCTGGG - Intergenic
931435755 2:62244759-62244781 TAAAAAAAAAAAATCAAGCTAGG + Intergenic
931518053 2:63063501-63063523 GAAAATAGAAAGATGAGACTTGG - Intergenic
931615564 2:64153068-64153090 GAAAAAAAAAAAAAAAAGCTGGG - Intergenic
931922510 2:67036751-67036773 CAAAAAAAAAAAATGAAGCCAGG + Intergenic
932116703 2:69056832-69056854 TAAAATAAAAAAATTTAGCTGGG - Intronic
932195048 2:69776133-69776155 AAAAATATAAAAATTAAGCTGGG - Intronic
932502093 2:72191976-72191998 GAAAATAGAAATATGGAGCCTGG + Intronic
932766100 2:74471168-74471190 AAAAAAAAAAAGATGGAACTGGG + Intergenic
932790830 2:74653478-74653500 AAAAAAAAAAAGAAGGAGCTAGG + Intergenic
932872796 2:75420287-75420309 GAAAAGAAAAAGAAAAAGCAAGG - Intergenic
933054874 2:77649255-77649277 AAAAAAAAAAAGGTGAATCTTGG - Intergenic
933079804 2:77971902-77971924 AAAAATACAAAAATGTAGCTGGG + Intergenic
933242374 2:79936536-79936558 GAAAAAAAAAAAAGGACGCTTGG - Intronic
933407009 2:81873367-81873389 TAAAATAAAAAGATTATTCTGGG - Intergenic
933493401 2:83017536-83017558 GGAAATAAAAAGAGCAGGCTTGG + Intergenic
933511579 2:83246783-83246805 AAAAATACAAAAATTAAGCTGGG + Intergenic
933660396 2:84922929-84922951 GAAAATACAAAGAATTAGCTGGG + Intergenic
933690476 2:85175713-85175735 GAACATTAAAATAGGAAGCTGGG + Intronic
933890164 2:86760769-86760791 GACAACAGCAAGATGAAGCTAGG + Intronic
934473046 2:94573232-94573254 AAAAATACAAAAATTAAGCTGGG - Intergenic
934730778 2:96655707-96655729 TCAAAAAAAAAGAAGAAGCTTGG - Intergenic
934732914 2:96670623-96670645 CAAAAAAAAAAAATGTAGCTGGG + Intergenic
934770287 2:96903434-96903456 GAAAAGAAAACCATGAAGTTTGG - Intronic
934878752 2:97953059-97953081 GAAAATAATAAAAGGCAGCTTGG + Intronic
935306364 2:101740683-101740705 GAAAATAAATATTTGAAGATAGG + Intronic
935345479 2:102104002-102104024 AAAAAAAAAAAGAGGAGGCTTGG + Intronic
935434237 2:103011267-103011289 GAAAAAAAAAAGGAGAAGTTGGG - Intergenic
935455297 2:103260273-103260295 AAAAAAAAAAAAATTAAGCTGGG - Intergenic
935526349 2:104172588-104172610 AAAAAAAAAAAAATGAAGCAGGG + Intergenic
935813252 2:106820829-106820851 GGAATTAAAAAGATGAATTTTGG + Intronic
935878722 2:107539557-107539579 AAAAAAAAAGAGGTGAAGCTAGG + Intergenic
936074393 2:109392504-109392526 AAAAAAAAAAAGAAGAAGCAAGG - Intronic
936447539 2:112607527-112607549 AAAAAAAAAAAAAAGAAGCTGGG - Intergenic
936611994 2:114010648-114010670 AAAAATAAAAAGATTAGGCCAGG + Intergenic
936738151 2:115471556-115471578 GAAAAGAAAAAGAAGAATCCTGG - Intronic
937024279 2:118684355-118684377 AAAAAAAAAAAGATGAGGTTGGG + Intergenic
937191285 2:120101853-120101875 GAAAATAAAAAGGAGAAAATGGG - Intronic
937532511 2:122846157-122846179 TAAAATAAAATGATGAAAGTAGG - Intergenic
937562018 2:123237776-123237798 GAAATTAAAGAGAGGAAGCGTGG + Intergenic
937818496 2:126280528-126280550 GAATATAATAAGAGGAAGCCTGG - Intergenic
938411409 2:131067886-131067908 AAAATTCAAAACATGAAGCTGGG + Intronic
938782688 2:134599682-134599704 AAAAAAAAAAAGATAAAGTTGGG - Intronic
939035860 2:137130362-137130384 AATAATAAAAAGGTGAGGCTTGG - Intronic
939082532 2:137679943-137679965 GAAAAAAATAAGAAGAAACTGGG - Intergenic
939152727 2:138492676-138492698 GAAAATAAAAAGAAAAGGCCAGG - Intergenic
939407419 2:141776288-141776310 GAAAGGAAAAATATGAAGATGGG + Intronic
939766753 2:146260203-146260225 CTAAATATAAAGAAGAAGCTGGG - Intergenic
939927889 2:148196717-148196739 GAAAATAACAAGAGGAATCATGG - Intronic
940159405 2:150695261-150695283 CAAAATCATAAGATGAAGCTAGG - Intergenic
940220956 2:151350834-151350856 GAAAATACAAAAATGAACCTGGG + Intergenic
940305700 2:152223939-152223961 GAAAGAAGAAAGATGAAGGTAGG - Intergenic
940688955 2:156890524-156890546 AGAAGTAAAAAGATGAAGTTTGG + Intergenic
941623033 2:167800115-167800137 GAATATAAAAAGTTCATGCTGGG + Intergenic
941780141 2:169435026-169435048 GAAAATAAAAAGATCAATGAAGG + Intergenic
941781427 2:169449825-169449847 GAAAATACAAATATTCAGCTGGG + Intergenic
941831267 2:169962592-169962614 AAAAATTAAAAGATCAATCTAGG - Intronic
941984108 2:171492473-171492495 AAAAAAAAAAAGATGGAGCACGG + Intergenic
942019579 2:171853170-171853192 AATAAGAAAAAGATGAAGCCAGG - Intronic
942059906 2:172219008-172219030 GAAAATACGAAAATTAAGCTGGG - Intergenic
942354546 2:175095256-175095278 AAAAATACAAAAATTAAGCTGGG - Intronic
942419012 2:175788331-175788353 AAAAATAAGAGAATGAAGCTGGG + Intergenic
942646384 2:178114754-178114776 AAAAATAAAAAAAATAAGCTGGG - Intronic
942804524 2:179914230-179914252 AAAAAAAAAAAAAAGAAGCTTGG - Intergenic
943342264 2:186694680-186694702 GAAAAGAAAAAGATCAATCCAGG - Intronic
943464651 2:188214232-188214254 GAAAATCAAAAGATAAGCCTGGG - Intergenic
943560574 2:189456806-189456828 GAAAATTAAAAGATGAACTTAGG - Intronic
943602315 2:189936972-189936994 GAAAATAAAAAAATGTATGTGGG + Intronic
943711900 2:191106362-191106384 GAAAAAAAAAAAATTAGGCTGGG + Intronic
943748771 2:191489497-191489519 GAAAAGAGAGAGAAGAAGCTTGG - Intergenic
943899787 2:193418888-193418910 AAAAATACAAAAATGTAGCTAGG - Intergenic
944115926 2:196185935-196185957 AAAAATAAAAAAAAAAAGCTGGG - Intergenic
944407452 2:199401250-199401272 GAAAATAATAGGATGAGGCTGGG + Intronic
944527066 2:200630225-200630247 AAAAAAAAAAAAAGGAAGCTGGG + Intronic
944563035 2:200960773-200960795 GAAAAAAAAAAGAAGAAGTTAGG - Intronic
944571538 2:201050049-201050071 AAAAATAAAAAAAATAAGCTGGG + Intronic
944579609 2:201120179-201120201 AAAAAAAAAAAAATGTAGCTGGG - Intronic
944595006 2:201253282-201253304 AAAAAAAAAAAGATCAGGCTAGG - Intronic
944639351 2:201707424-201707446 AAAAAAAAAAAAATGTAGCTGGG - Intronic
944889992 2:204107623-204107645 AAAAAAAAAAAGATGTACCTAGG - Intergenic
944998820 2:205325686-205325708 CAAAATAATAGGATGAAGCTGGG - Intronic
945000566 2:205345873-205345895 TAAAAAAAGAAGATGCAGCTGGG + Intronic
945005388 2:205399648-205399670 TAAAAAAAGAAGATGCAGCTGGG - Intronic
945073407 2:206013689-206013711 TAAAATGAAAATATGCAGCTGGG + Intronic
945259982 2:207834423-207834445 AAAAAAAAAAAGAAGAGGCTGGG - Intronic
945356989 2:208852384-208852406 CAAAAAAAAAAGAAAAAGCTAGG - Intronic
945793396 2:214332717-214332739 AAAGATAAAAAGATGGAGCGTGG - Intronic
945808265 2:214516659-214516681 AAAAAAAAAAAAAGGAAGCTGGG + Intronic
945991144 2:216396318-216396340 AAAAAAATAAAGATGTAGCTGGG + Intergenic
945991194 2:216396629-216396651 AAAAAAAAAAAAATGTAGCTGGG + Intergenic
946089744 2:217210309-217210331 GAAAAGAAAAAAAAGAAACTTGG + Intergenic
946221335 2:218230265-218230287 GAAAAAAAAAAGAAAAGGCTGGG - Intronic
946239969 2:218347890-218347912 AAAAAAAAAAAGATGAAATTTGG + Intergenic
946270204 2:218585796-218585818 AAAAATAAAAAAATGTAGCCAGG - Intronic
946436525 2:219659980-219660002 TAAAATTAAAAGTTGAGGCTGGG + Intergenic
946755563 2:222943105-222943127 ACAAAAAAAAAGATGAACCTAGG + Exonic
946833388 2:223747691-223747713 GGAAATAAAAATAAGAAGTTTGG - Intergenic
946899288 2:224356816-224356838 AAAAAAAAAAAGAAGAAGCCGGG + Intergenic
946909237 2:224443526-224443548 AAAAATTAAAAAATGAAGCCTGG - Intergenic
947328849 2:229007002-229007024 GAAAATTCACAAATGAAGCTTGG + Intronic
947423654 2:229962970-229962992 TAAAAAAGAATGATGAAGCTGGG - Intronic
947779104 2:232741425-232741447 GAAAAAAAAAAAAGGAAGCCAGG - Intronic
948093946 2:235318669-235318691 AAAAAAAAAAAAATGTAGCTAGG + Intergenic
948327158 2:237133798-237133820 AAAAAAAAAAAGAGGAAGCTAGG - Intergenic
948865108 2:240771223-240771245 GAGAGAAAAAAGATGAAGATGGG + Intronic
1168993327 20:2113349-2113371 TAAAATAAAAATATGAAACTAGG + Intronic
1169086983 20:2832788-2832810 GAAATTAAAAATATGGAGGTAGG + Intergenic
1169120804 20:3094516-3094538 GAAAAAAAAAAGATTGGGCTTGG + Intergenic
1169237344 20:3941777-3941799 GAAAATAAAAAGATGAAGCTGGG + Intronic
1169281354 20:4269535-4269557 TAAAATAAAAAGCTGAAGCTGGG - Intergenic
1169427404 20:5507342-5507364 GAAAAAAAAAAAAAAAAGCTGGG + Intergenic
1169544127 20:6633575-6633597 GCAAATAAAAAGAGGAAGGGTGG - Intergenic
1169873508 20:10271933-10271955 CAAAATATAAAGATGGAGCGTGG + Intronic
1169933282 20:10856767-10856789 TGAAATAAAAAGAGGAATCTGGG - Intergenic
1170021093 20:11837356-11837378 AAAAAAAAAAAGAGGAAGCCAGG + Intergenic
1170168715 20:13387352-13387374 AAAAATACAAAAATTAAGCTGGG - Intergenic
1170626326 20:18032983-18033005 AAAAATAAAACAATGAAGCGAGG + Intronic
1171142251 20:22753500-22753522 GAAAATAAATAGAGGAATCTAGG - Intergenic
1171211916 20:23323803-23323825 CAATCTAAAAAGAAGAAGCTGGG - Intergenic
1171302101 20:24072102-24072124 CAAAATAAACAGATGAATCTTGG - Intergenic
1171425191 20:25044464-25044486 AAAAATAAAAAGCTTAGGCTTGG + Intronic
1171968242 20:31546760-31546782 AAAAAAAAAAAGACTAAGCTTGG + Intronic
1172065040 20:32213475-32213497 AAAAATATAAAGATGAGGCTGGG + Intronic
1172137169 20:32694777-32694799 AAAAAAAAAAAAAAGAAGCTGGG - Intergenic
1172415521 20:34764077-34764099 CAAAAAAAAAAAATGTAGCTGGG - Intronic
1172489433 20:35323366-35323388 AAAAATAACAGGATGAAGCAAGG + Intronic
1172582202 20:36057287-36057309 AAAAATACAAAAATGAAGCTGGG + Intergenic
1172589591 20:36108137-36108159 AAAAATAAAAAAATTTAGCTGGG - Intronic
1172607393 20:36223191-36223213 GAAAATATAAAAATTAGGCTGGG - Intronic
1172824709 20:37771507-37771529 GAAAATGAAAAGGTCAAACTGGG - Intronic
1173551469 20:43935764-43935786 GAAAATACAAAAATTTAGCTGGG + Intronic
1173607820 20:44344284-44344306 AAAAAAAAAAAAGTGAAGCTTGG + Intronic
1173635777 20:44556200-44556222 GAAAATAAAAAGATTATTTTAGG - Intronic
1173716023 20:45207060-45207082 GAAAGTACAAAGATGATGTTGGG - Exonic
1173959652 20:47061152-47061174 GAGAGTAAAGAGATGAAGTTGGG - Intronic
1173983190 20:47240713-47240735 GAAAATAAAAAAAATTAGCTGGG - Intronic
1174009360 20:47437149-47437171 AAAAATAAAAATATGGGGCTGGG + Intergenic
1174268769 20:49351523-49351545 GAAAATTAAAAGAGAAAGCGGGG - Intergenic
1174361685 20:50032804-50032826 AAAAATACAAAAATTAAGCTAGG + Intergenic
1174375358 20:50123257-50123279 AAAAAAAAAAAGAACAAGCTTGG - Intronic
1174957362 20:55114262-55114284 GAAAAAAAAAAAATGAATGTTGG - Intergenic
1175163426 20:57025451-57025473 TAAAACAAACAGATGAAACTTGG + Intergenic
1175415979 20:58801256-58801278 TAAAATAAAAAGTGGCAGCTGGG + Intergenic
1175436809 20:58958421-58958443 AAAAATAATAATATGAGGCTGGG + Intergenic
1175672133 20:60912647-60912669 GAAAATACAAAAATTTAGCTAGG + Intergenic
1175841926 20:62033439-62033461 GAAAATAAGAAGTGGGAGCTGGG + Intronic
1175850101 20:62085785-62085807 GAAAATACAAAGAATTAGCTGGG - Intergenic
1176203435 20:63874979-63875001 AAAAATAAAAAAATTTAGCTGGG + Intronic
1176208168 20:63902347-63902369 AAAAAAAAAAAGATGAGGCCAGG - Intronic
1176807802 21:13505910-13505932 GCAAATAAAAACATAAAGTTTGG - Intergenic
1176897823 21:14403536-14403558 GTAATCAAAAAGATGAGGCTGGG - Intergenic
1177014306 21:15765267-15765289 GAGAATATAAAGATGTAACTGGG + Intronic
1177017495 21:15810516-15810538 GAAAAGAAAAAAATGAATTTTGG + Intronic
1177057011 21:16318714-16318736 GAAAATAAAAAGATGGTGAGAGG - Intergenic
1177060953 21:16373581-16373603 AAAAAAAAAAAGTTGAAGATTGG + Intergenic
1177185989 21:17796877-17796899 GAAATTAAACAGATGATGCTGGG + Exonic
1177633605 21:23757915-23757937 GAAAATAAAAACAAGAGGCCGGG + Intergenic
1177702457 21:24656206-24656228 GAAAAAAAAAAGATGATGATGGG - Intergenic
1177863999 21:26491076-26491098 GAAAAGAAAAATATGAAACATGG + Intronic
1177879329 21:26673456-26673478 GAAAATTTAAAAATGTAGCTGGG - Intergenic
1177938621 21:27381589-27381611 GAAAAAAAAAAGATATAACTAGG + Intergenic
1177940148 21:27400048-27400070 GATCACAAAAAGATGAAACTAGG + Intergenic
1178130761 21:29570339-29570361 AAAAATAAAAAAATATAGCTGGG + Intronic
1178170897 21:30038771-30038793 AAAAATAAAGAGAAGAAGATGGG + Intergenic
1178182486 21:30178140-30178162 GAAATAAAAAAGATGAACATGGG - Intergenic
1178661060 21:34508185-34508207 GAAAAAAAAAAAAAAAAGCTAGG - Intergenic
1179058773 21:37960242-37960264 AAAAAAAAAAAGACGAAACTAGG + Intronic
1179197685 21:39181294-39181316 AAAAATAAAAAAATGAAGCCAGG - Intronic
1179278697 21:39915152-39915174 GAAAAAAATAACATGAAGCAGGG + Intronic
1179329506 21:40385067-40385089 TAAAATAAAAAGTCGAAACTGGG - Intronic
1179381366 21:40902463-40902485 GAAAACACAAAGACCAAGCTGGG - Intergenic
1179630728 21:42676876-42676898 GTAAATAAAAATATGAGGCAGGG + Intronic
1180029494 21:45195599-45195621 GAAAAAAAAAAAAAGAATCTAGG - Intronic
1180165072 21:46021339-46021361 AAAAAAAAAAAGATGAAGTGAGG + Intergenic
1180186306 21:46141294-46141316 GAAAAAAAAAAAATAAAGCCAGG - Intronic
1180644340 22:17326171-17326193 CAAAATACAAAAATGTAGCTGGG + Intergenic
1180674504 22:17577970-17577992 GAAAAAAAAAAAAAGAAGCAGGG - Intronic
1180688651 22:17691160-17691182 GAAAATAAATAAATAAGGCTAGG - Intronic
1181117159 22:20639310-20639332 AAAAATAAAAAAATAAAGATGGG - Intergenic
1181122095 22:20677260-20677282 GAAAATAAAAAAAATTAGCTGGG - Intergenic
1181330241 22:22085485-22085507 GAAAATATAAATATGGAGCCAGG - Intergenic
1181653564 22:24276006-24276028 GAAAAAAAAAAGTTTAGGCTGGG - Intronic
1181816677 22:25442763-25442785 AAAAATAAAAAAATTAGGCTGGG - Intergenic
1181926947 22:26367502-26367524 AAAAATAAAAAAATTTAGCTGGG - Intronic
1182401589 22:30081734-30081756 AAAAATAAAAAAATTTAGCTGGG - Intronic
1182592911 22:31396186-31396208 GAAAATAAAAAAAATTAGCTGGG - Intergenic
1182628567 22:31666669-31666691 TAAAATTAAAAAATGAGGCTGGG - Intergenic
1182669856 22:31986829-31986851 AAAAATAAAAAGAATTAGCTGGG + Intergenic
1182702504 22:32251932-32251954 GAAAATAGACAGATGTAGCTGGG + Intronic
1182838993 22:33369432-33369454 GAAAATAGAAAAAAGAAGCTTGG - Intronic
1183226804 22:36556032-36556054 AAAAAAAAAAAGAAGAAGGTGGG - Intergenic
1183440710 22:37821686-37821708 AAAAAAAAAAAGAAGAGGCTGGG - Intergenic
1183485410 22:38085505-38085527 AGAAAAAAAAAGATGAAGCGGGG - Intronic
1183570409 22:38648975-38648997 AAAAAAAAAAAGAAAAAGCTGGG + Intronic
1183682301 22:39339648-39339670 GAAAATAAAAAAAATTAGCTGGG - Intergenic
1183903669 22:41023911-41023933 AAAAATACAAAAATTAAGCTGGG - Intergenic
1183982920 22:41552969-41552991 AAAAATACAAAAATGAGGCTGGG - Intergenic
1183989910 22:41590744-41590766 AAAAAAAAAAAGAAGAATCTGGG - Intergenic
1183995077 22:41626933-41626955 GAAAATACAAACATTAGGCTGGG - Intronic
1183998708 22:41656222-41656244 AAAAAAAAAAAGATGAAGGCTGG + Intronic
1184003561 22:41692714-41692736 AAAAAAAAAAAGAAGAGGCTGGG - Intronic
1184193242 22:42908957-42908979 AAAAATAAAAAGAGGAAGAGGGG - Intronic
1184589798 22:45474465-45474487 AAAAGAAAAAAAATGAAGCTTGG + Intergenic
1184890745 22:47377537-47377559 GAAAATTTAAAGAAGAAGGTAGG + Intergenic
1184984503 22:48120346-48120368 GGAAAGCAAAAGATGGAGCTGGG - Intergenic
1184997969 22:48224284-48224306 GAAAATCAAAAGATAAATCTTGG + Intergenic
1185407984 22:50666549-50666571 GAAAATACAAAAACGTAGCTGGG - Intergenic
1203322926 22_KI270737v1_random:86074-86096 GAAAATAAAGAGGTGAAGGAAGG - Intergenic
949361462 3:3236629-3236651 GAAAATAAAAACATCAGGCAAGG - Intergenic
949382384 3:3460640-3460662 TAAAAAAAAAAGAAAAAGCTAGG + Intergenic
949475740 3:4443466-4443488 TAAAATAAAAAGAAGAGGCCAGG + Intronic
949575752 3:5337833-5337855 GAAAACAACAAGATAAAGTTTGG - Intergenic
949685933 3:6570692-6570714 GAAAATAAAAAAAATTAGCTGGG - Intergenic
949805382 3:7949950-7949972 CAAAAATAAAAGATGAAGCAAGG + Intergenic
949929600 3:9068333-9068355 GAAAATAAAAAAAGAAAACTAGG - Intronic
949963138 3:9331340-9331362 AAAGATGAAGAGATGAAGCTTGG + Intronic
950035577 3:9882840-9882862 GAAAAGAAAAAGAAAAGGCTGGG - Intergenic
950041330 3:9921151-9921173 GGAAATAGAAAGATGAATCTTGG + Intronic
950075226 3:10182262-10182284 AAAAAGAAAATGATGTAGCTGGG - Intronic
950141395 3:10618612-10618634 GAAAAGCAAAAGGTGATGCTGGG - Intronic
950351577 3:12359303-12359325 GAAAATAAAATGAGGAAGTTTGG + Intronic
950515501 3:13462297-13462319 AAAAATAAAAAAATTTAGCTGGG + Intergenic
950782839 3:15407313-15407335 GAATATTTAAAGGTGAAGCTGGG - Intronic
950815832 3:15701347-15701369 AAAAAAAAGAAGATTAAGCTGGG + Intronic
950841705 3:15974269-15974291 AAAAAAAAAAAAAGGAAGCTGGG + Intergenic
950979310 3:17285062-17285084 AAAAAAAAAAAGATGAAAATAGG + Intronic
951435133 3:22653985-22654007 GAAATTAAAAAGAGGAATTTTGG - Intergenic
951443088 3:22745092-22745114 GAAAATAGCAATATGTAGCTTGG - Intergenic
951664264 3:25104481-25104503 GAAAATATAAAAATTTAGCTTGG + Intergenic
951726336 3:25765162-25765184 CAAGATAAAAAGTTGCAGCTGGG + Intronic
951741105 3:25924588-25924610 GGAGCTCAAAAGATGAAGCTTGG + Intergenic
951891159 3:27569396-27569418 AAAAATAAAAAGATTAATTTGGG - Intergenic
951987797 3:28640300-28640322 TAAAATAAAAAGATGGAGAAGGG - Intergenic
952043538 3:29289297-29289319 GTAAATAAAAATATGCAGTTGGG - Intronic
952391019 3:32880322-32880344 AAAAATAAATGGATGAGGCTGGG - Intronic
952421786 3:33138845-33138867 AAAAATAAAAAAATTAGGCTGGG + Intronic
952620761 3:35338617-35338639 GAAAATAAAAAAATATGGCTGGG + Intergenic
952993208 3:38851090-38851112 AATAATAAAAAGATGAATCTTGG + Intronic
953004585 3:38966416-38966438 TACAAAAAAAAGATGAAGCAAGG + Intergenic
953501123 3:43435510-43435532 GAAAAAAAAAAAAAAAAGCTGGG + Intronic
953514386 3:43575796-43575818 AAAAATAAAAAAATTTAGCTGGG - Intronic
953889220 3:46738242-46738264 GAAAGTAAAAAGATGTGGCTGGG + Intronic
953963567 3:47284630-47284652 GAAAATAAGAAGAGCAGGCTGGG - Intronic
953995891 3:47519416-47519438 GAAAATAATGTGATGAACCTAGG - Intergenic
954032333 3:47828474-47828496 AAAAAAAAAAAGATGAGGCTGGG + Intronic
954206044 3:49059715-49059737 GAAAATAAATAAATAAGGCTAGG - Intronic
954341372 3:49956631-49956653 AAAAATAAAAAAATAAAGCGTGG - Intronic
954344008 3:49980770-49980792 AAAAAAAAAAAGTTGAACCTGGG + Intronic
954657135 3:52201597-52201619 AAAAATAAAAAGAATTAGCTGGG + Intronic
954739889 3:52740636-52740658 AAAAATACAAAAATGTAGCTGGG + Intronic
954862304 3:53701292-53701314 TAAAATAAAAAGAATTAGCTGGG - Intronic
954931098 3:54282162-54282184 GAGAAAAAAAATATTAAGCTAGG + Intronic
954932315 3:54294951-54294973 GAAAAAAAAAAGTGGAAGCAAGG - Intronic
954965221 3:54604554-54604576 GAAGAAACAAAGATGATGCTAGG - Intronic
954977354 3:54709000-54709022 AAAAAAAAAAAGATGAAGATGGG - Intronic
955225858 3:57060015-57060037 AAAAATAAATAGATGAAGTGAGG + Intronic
955245004 3:57217067-57217089 GAAAAGAACAAGATGTACCTGGG - Intronic
955276318 3:57550671-57550693 GAAAAAAAAAAAATTTAGCTGGG - Intergenic
955311170 3:57888095-57888117 GAAAACAGAAAGAGGAAGGTGGG + Intronic
955559948 3:60178217-60178239 TGAAATAAAAAGATGGGGCTTGG - Intronic
955788659 3:62565969-62565991 GAAAAAACAAAGATGAAGAGAGG - Intronic
955931537 3:64062366-64062388 GATAATACAGAAATGAAGCTGGG + Intergenic
956008368 3:64804696-64804718 GAAAACAAAATCATGAAGTTTGG - Intergenic
956090556 3:65662040-65662062 AGAAATACAAAGATGAGGCTGGG - Intronic
956177202 3:66484171-66484193 GGAAATACACAGATGAAGCCTGG + Intronic
956258683 3:67312546-67312568 GAAAAAAAAAAGATGGAATTTGG - Intergenic
956291714 3:67667583-67667605 AAAAAAAAAAAGATGAAGATGGG + Intergenic
956426640 3:69142826-69142848 TAAAAAAAAAAGATGATGTTGGG - Intergenic
956464455 3:69505215-69505237 AAAAATAAAAAAAATAAGCTGGG + Intronic
956484131 3:69703427-69703449 AAAAAAAAAAAGAAGAAGATAGG + Intergenic
956769208 3:72510237-72510259 GAAAATAAAGAGGAGAGGCTGGG + Intergenic
957516161 3:81254213-81254235 TAGAATAAAAATATGAGGCTGGG + Intergenic
957736626 3:84211838-84211860 GAAGAGAAAAAGATGATGCATGG - Intergenic
957737987 3:84226750-84226772 TAAAAAAAAAACAAGAAGCTGGG + Intergenic
958579034 3:95991922-95991944 AAAAATAAAAAGATGTAGGAGGG + Intergenic
958606884 3:96369908-96369930 TAAAATAAAAAGCTGCAGTTGGG - Intergenic
959041421 3:101426638-101426660 GAAAATAAAAAAAATTAGCTGGG - Intronic
959340464 3:105123201-105123223 GAAAATAAAAGGGTGAGGGTTGG + Intergenic
959706287 3:109341445-109341467 GAAAATAAAAAGGCGAGTCTGGG + Intergenic
959737218 3:109673334-109673356 GAAAAAAAAAAAAAGAAGCAAGG - Intergenic
959785177 3:110288330-110288352 GAAATTAAAAAGATGGGGCTGGG - Intergenic
959916858 3:111826146-111826168 AAAAATAAAAAGAATTAGCTAGG + Intronic
960112468 3:113858385-113858407 AAAAAAAAAAAAATGTAGCTGGG - Intronic
960178869 3:114550659-114550681 GAAAATAAAGAGATCAAGAATGG - Intronic
960192822 3:114727399-114727421 GAAAAGAAAAAGGTGAACCAAGG - Intronic
960205603 3:114893714-114893736 GAAAAAAAAAAGATGAGGAAGGG + Intronic
960222764 3:115134472-115134494 GAAAAAAAAAAGATGAGATTTGG - Intronic
960230226 3:115217414-115217436 CAAAATAAAAAGATGTAGCTCGG + Intergenic
960307877 3:116084356-116084378 GAAAAAAAAAAGAGGAACATTGG + Intronic
961062789 3:123845649-123845671 AAAAATAAAAAAATATAGCTGGG - Intronic
961097842 3:124173290-124173312 AAAAATAAAAAGAGAAAGCTTGG + Intronic
961266713 3:125648895-125648917 GAAAAAGAAAAGATAAGGCTTGG + Intergenic
961947673 3:130711018-130711040 GAAAAAAAAAAAAACAAGCTGGG + Intronic
961980134 3:131068538-131068560 GACACTAAAAAAAAGAAGCTTGG - Intronic
962127489 3:132636520-132636542 TGTAATGAAAAGATGAAGCTAGG + Intronic
962223605 3:133585653-133585675 AAAAATACAAAGATGTAGCGGGG - Intronic
962333243 3:134499809-134499831 AAAAAAAAAAAGATGAAGATGGG - Intronic
962490824 3:135892646-135892668 GAAAATACAAAAAAAAAGCTGGG + Intergenic
962542303 3:136394949-136394971 AAAAAAAAAAAAATGTAGCTAGG + Intronic
962720709 3:138172286-138172308 TTAAATAAAGGGATGAAGCTGGG + Intronic
962771056 3:138610578-138610600 AAAAATAAAAAAATGAAACTTGG - Intronic
962851346 3:139310577-139310599 GAACATGAAAAGATGTCGCTGGG + Intronic
962869940 3:139479926-139479948 GAAAATAAAATCCTAAAGCTTGG + Intronic
962893307 3:139692063-139692085 GAAAAGAAAGAGAGGAAGTTAGG - Intergenic
963455573 3:145542309-145542331 GAAAATAAATAAATGAAACCTGG - Intergenic
963559653 3:146847183-146847205 AAAAATAAATAAATTAAGCTCGG - Intergenic
963722364 3:148877198-148877220 GAAAATAGGAAGATGAGGCCGGG + Intronic
963861457 3:150314744-150314766 AAAAAAAAAAAGAAAAAGCTAGG - Intergenic
963964310 3:151348565-151348587 AAAAAAAAAAAAAAGAAGCTAGG - Intronic
964106151 3:153042175-153042197 TAAAATAAAAAGTTCAAGGTAGG + Intergenic
964192622 3:154022026-154022048 AAAAATAAAAAAATTTAGCTGGG - Intergenic
964221371 3:154350034-154350056 AAAAATAAAAAAATTTAGCTAGG + Intronic
964346258 3:155757450-155757472 AAAAATACAAAAATGTAGCTGGG + Intergenic
964465801 3:156990599-156990621 ATAAATAAATAGATGAAGGTAGG - Intronic
964589566 3:158345065-158345087 AAAAAAAAAAAAATGTAGCTGGG + Intronic
964735233 3:159910672-159910694 GAGAAAAAAAAAATGAAGCCTGG + Intergenic
964797425 3:160514759-160514781 TAACATAAAAAGATTAAGATAGG - Intronic
964833173 3:160908929-160908951 AAAAATACAAATATGAAGGTGGG + Intronic
964864363 3:161239639-161239661 GATCACAAAATGATGAAGCTAGG + Intronic
964961015 3:162426958-162426980 TAAAATAAAAAGCTGACACTAGG - Intergenic
964969526 3:162542361-162542383 GAAAATAAAGAAATGAAGTAGGG - Intergenic
965010972 3:163090385-163090407 GAAAATGAATGGATGAGGCTAGG + Intergenic
965177078 3:165348652-165348674 GAAAATAGAAAGAATAGGCTGGG - Intergenic
965301836 3:167014602-167014624 GAAAAAAAAAAGATAAAGATAGG + Intergenic
965577732 3:170235060-170235082 AAAAATTAAAATATCAAGCTGGG - Intronic
965695217 3:171401116-171401138 AAACAAAAAAAGAAGAAGCTGGG + Intronic
966181411 3:177192100-177192122 AAAAAAAAAGAGTTGAAGCTGGG + Intronic
966367540 3:179206216-179206238 GAAAATACAAAAAATAAGCTGGG - Intronic
966378034 3:179317049-179317071 AAAAATACAAAGAAGTAGCTGGG - Intergenic
966443352 3:179972997-179973019 GAAAACAAAAAGAACAAGGTTGG + Intronic
966512774 3:180782654-180782676 GGAAGTAAAAAGATGAAAATAGG - Intronic
966524911 3:180910324-180910346 AAAAATACAAAGATTAGGCTAGG + Intronic
966571539 3:181449502-181449524 GAAAATACAAAAAATAAGCTGGG + Intergenic
966583653 3:181597349-181597371 GAAAATAAAAAGATTGAAGTTGG - Intergenic
966600711 3:181772644-181772666 GAAAATAAATTAATGGAGCTAGG + Intergenic
966774007 3:183528318-183528340 GGAAGAGAAAAGATGAAGCTTGG - Intronic
966974749 3:185073959-185073981 AAAAAAAAAAAGAAGAGGCTGGG - Intergenic
966983990 3:185163321-185163343 GAAAAGAACAAGATGGAGTTGGG - Intergenic
967050106 3:185775027-185775049 AAAAAAAAAAAGAGGGAGCTGGG + Intronic
967110890 3:186292808-186292830 AAAAAAAAAAAGAAGAAACTCGG + Intronic
967166020 3:186780117-186780139 AAAAATAAAAAAATTAGGCTAGG - Intergenic
967510524 3:190305813-190305835 GAATATAAAAAGATCAAAATTGG + Exonic
967569244 3:191009095-191009117 GAAAAGAGACATATGAAGCTAGG + Intergenic
967707563 3:192669424-192669446 GAAAATACAAAAATTTAGCTGGG + Intronic
967710220 3:192697981-192698003 GAAAAAAAAAAGATCAGGCAAGG - Intronic
967798371 3:193624938-193624960 AAAAATAAAAAGAGGAAAATGGG - Intronic
968397001 4:248437-248459 CATAATAAAAAAATGAAACTAGG - Intergenic
968408698 4:365830-365852 GATAATCAAAAAATGAAACTAGG - Intronic
968415663 4:431350-431372 CATAATAAAAAAATGAACCTAGG - Intronic
968558560 4:1263779-1263801 AAAAATAAAAATAAGAGGCTGGG - Intergenic
969643962 4:8415575-8415597 GAAAATAAAAAAATGAAAAGGGG + Intronic
969708028 4:8823290-8823312 AAAAATACAAAAATTAAGCTGGG + Intergenic
969918523 4:10513808-10513830 AAAAAAAAAAAGATGACTCTGGG - Intronic
970051035 4:11915508-11915530 GAAAATTGAGAGATGAAGATTGG + Intergenic
970690921 4:18619638-18619660 GATAATAAAAACTTGAAACTAGG - Intergenic
970903434 4:21186933-21186955 TTAAATAAAAAGATTGAGCTGGG - Intronic
970962782 4:21892322-21892344 CAAAAAAAAAAGGTGAATCTAGG + Intronic
971189415 4:24413231-24413253 AAAAAAAAAAAAATGAAGCCAGG - Intergenic
971195363 4:24468244-24468266 CAACATCAAAAGATAAAGCTCGG + Intergenic
971208914 4:24597380-24597402 GAAAAAGAAAAAATGAAGCAGGG - Intergenic
971248711 4:24953375-24953397 GAAAAGACAAAAATGAAGCAGGG - Intronic
971303443 4:25460927-25460949 AAAAAAAAAAAGAAGAGGCTGGG + Intergenic
971596412 4:28534793-28534815 AAAAATAAAAAAATAAAGCTAGG + Intergenic
971942314 4:33231264-33231286 GTAAACAAAATGATGAAGTTGGG - Intergenic
972017727 4:34267017-34267039 GAAAAGAAAAAAATATAGCTGGG - Intergenic
972088192 4:35246530-35246552 GAAAAAAAAAAGAGGAATATTGG - Intergenic
972116648 4:35643837-35643859 GAAAATGAAAAGAGGAAATTGGG - Intergenic
972488521 4:39564914-39564936 TATAAGAAAAAGATTAAGCTGGG + Intronic
972520583 4:39851634-39851656 AGAGATAAAAAGATGGAGCTAGG + Intronic
972537178 4:40009364-40009386 GAAAAAAAAAAAAAAAAGCTGGG - Intergenic
972551580 4:40140085-40140107 TAAAATAAAAAAATAAGGCTGGG - Intronic
972603398 4:40592404-40592426 GAAAAAAAAAAGATTAAGCCAGG - Intronic
972813259 4:42613877-42613899 GAAAAAAAAAAAATGAGGCCAGG - Intronic
972823719 4:42732216-42732238 GAAAATCAAAATTTGAAGCTTGG - Intergenic
973238531 4:47932334-47932356 AAAAAAAAAAAAATGTAGCTAGG + Intronic
973763693 4:54144443-54144465 GAAAAAAAAAAAAAGAAGCCAGG - Intronic
974155702 4:58069405-58069427 AAAAAAAAAAAAATAAAGCTCGG - Intergenic
974281371 4:59798677-59798699 GCAAATAAAAACATAAAGTTTGG - Intergenic
974400521 4:61399460-61399482 GAACCTAAAAAGATGAAATTGGG - Intronic
974514643 4:62893870-62893892 TAAAATAAAAAGATGAGGCAAGG - Intergenic
974578545 4:63762521-63762543 TAAGACAAAAAGAAGAAGCTAGG + Intergenic
974737785 4:65960958-65960980 GAAAATAAAAAGATGATTTTTGG + Intergenic
975351532 4:73352523-73352545 GGAAATAAGAAGATGAGGCAAGG - Intergenic
975564531 4:75739836-75739858 AACAATACAAAGATGAGGCTGGG - Intronic
975603157 4:76125128-76125150 AAAAATACAAAGAAGTAGCTGGG + Intronic
975907090 4:79226403-79226425 AAAAAGAAAAAGATTTAGCTGGG - Intronic
975919433 4:79366776-79366798 GAAAAAAAAAAAAAAAAGCTTGG + Intergenic
975990747 4:80257575-80257597 AAAAATAAAAACATGTATCTGGG + Intergenic
976214388 4:82702119-82702141 AAAAAAAAAAAGATGATGATGGG - Intronic
976308332 4:83583685-83583707 AAAAAAAAAAAAATGAAGCTGGG + Intronic
976419492 4:84824147-84824169 GAAAATAAAACCATGAAAATGGG - Intronic
976447572 4:85149470-85149492 ACAAATAAAAAACTGAAGCTTGG - Intergenic
976606215 4:86985513-86985535 AAAAAAAAAAAAATGTAGCTCGG + Intronic
976647536 4:87401309-87401331 AAAAAAAAAAAGAAGAATCTAGG - Intergenic
976972033 4:91115795-91115817 AAAAAAAAAAAGAAAAAGCTAGG - Intronic
977226278 4:94396212-94396234 GAAAGTAGAAAGATTAGGCTGGG + Intergenic
977435905 4:96993935-96993957 GAAGAGAAAAAGGGGAAGCTGGG + Intergenic
977546085 4:98380087-98380109 AAAAAAAAAAAGATAAACCTTGG + Intronic
977726853 4:100305941-100305963 GAAAATCTAAAGATGAATTTTGG - Intergenic
977743231 4:100512643-100512665 AAAAATAAAAAAATTTAGCTGGG + Intronic
977807020 4:101312507-101312529 GAATGTAAAAAGATGATTCTAGG - Intronic
978057742 4:104293314-104293336 AAAAAAAAAAAGGTGAGGCTAGG - Intergenic
978097413 4:104795101-104795123 GATGATAAAAAGAGGAAGATAGG + Intergenic
978141016 4:105317321-105317343 GAAACTATAAAGAAGAAGATAGG - Intergenic
978282251 4:107033459-107033481 TAAAACATAAAGAAGAAGCTAGG + Intronic
978306713 4:107336561-107336583 AAAAAAAAAAAGATAAAGATTGG - Intergenic
978321409 4:107499901-107499923 GAAAATATAAATATCAACCTGGG - Intergenic
978432105 4:108643577-108643599 AAAAAAAAAAAAATTAAGCTAGG - Intergenic
978600569 4:110423295-110423317 AAAAATAAAAAGAAGAAGGCTGG + Intronic
978674095 4:111289573-111289595 AAAAAAAAAAATATGAATCTAGG - Intergenic
978756016 4:112303704-112303726 AAAAAAAAAAAGATGTGGCTGGG - Intronic
978793901 4:112690023-112690045 AAAAAAAAAAAAAAGAAGCTGGG + Intergenic
979072703 4:116229853-116229875 GAACATAAAAAGATGAAAAAAGG + Intergenic
979366414 4:119829764-119829786 GAAAAAAACAAGATGAAACAAGG + Intergenic
979497589 4:121401175-121401197 AAAAATAAAAAAATTAAGGTAGG + Intergenic
979708370 4:123748364-123748386 GAAAATAAGAAAATGCAGCAGGG - Intergenic
979860619 4:125688323-125688345 AATAATAAAAAAAAGAAGCTAGG + Intergenic
980400110 4:132272854-132272876 TAAAATAAAAAAATAAAGTTGGG - Intergenic
980477788 4:133341377-133341399 GAAAGTAAAAAGAAGTATCTCGG - Intergenic
980689235 4:136271841-136271863 AAAAAAAAAAAGAAGAAGCGGGG + Intergenic
980970330 4:139561193-139561215 GAAAAAAAAAAAATGAGGCCAGG + Intronic
981080961 4:140638627-140638649 AAAAATAAAAAAATAAAGATTGG + Intronic
981164325 4:141539698-141539720 GAAAATAAAAAAAATTAGCTGGG - Intergenic
981536341 4:145803913-145803935 CAAAAAAAAAATATGAAGTTAGG - Intronic
981614353 4:146631497-146631519 GAGAATAAAAACATGCAGGTGGG + Intergenic
981673025 4:147309566-147309588 AAAAATAAATAAAGGAAGCTTGG - Intergenic
981738889 4:147982535-147982557 AAAAAAAAAAAGATTTAGCTGGG - Intronic
981978256 4:150758732-150758754 GAAAATAAAAAGAATTAGTTGGG - Intronic
982008271 4:151083420-151083442 AAAAATACAAAAATGTAGCTGGG + Intergenic
982025370 4:151248257-151248279 GAAATTAAGAAAATAAAGCTGGG - Intronic
982201647 4:152967264-152967286 AAAAATACAAAAATTAAGCTGGG + Intronic
982273576 4:153616562-153616584 GAAAATAAAAAGCCAAAGCTAGG - Intronic
982346669 4:154367709-154367731 GAAACAAAAAAGATGAAGAGGGG - Intronic
982527178 4:156492553-156492575 GAAAATTAAAATATGAAATTTGG - Intergenic
982600188 4:157439594-157439616 AACAATAAAAATAAGAAGCTTGG + Intergenic
982841445 4:160192845-160192867 GAAAATATAAAGATTAAAATTGG - Intergenic
982910055 4:161128966-161128988 GAAAATTGAAAGATGAACATAGG - Intergenic
983037260 4:162882456-162882478 GAAAATAAAAAGAGGAAAAGTGG + Intergenic
983607381 4:169604472-169604494 GAAATAAAAAAGAGCAAGCTAGG - Intronic
984000243 4:174232586-174232608 GAAAATGAAAAGAAGAAGAGAGG - Intergenic
984113168 4:175645107-175645129 AAAAATAATAAGCTGAAACTAGG + Intronic
984137573 4:175960252-175960274 GCAAATAAAAAAATTAAACTAGG + Intronic
984263503 4:177470110-177470132 GAAAATAAAAAAATTAGGCGTGG - Intergenic
984369578 4:178845583-178845605 TAACATAAAAAGATGGAGTTTGG + Intergenic
984890505 4:184488345-184488367 GATAATTAAACTATGAAGCTGGG - Intergenic
984977814 4:185245334-185245356 GAAAAAAAAAAGATACTGCTTGG - Intronic
985225792 4:187760294-187760316 GAAAAAAAAAAGGTAAAGATAGG + Intergenic
985351421 4:189066951-189066973 AAAAATGAAAAGAAGAAGTTGGG - Intergenic
986922017 5:12696688-12696710 GAGTATAAAAATATAAAGCTGGG + Intergenic
987229606 5:15879873-15879895 GAAAAGAAAACCATGAAGATAGG - Intronic
987517333 5:18929110-18929132 AAAAAAAAAAAAATGAAGTTGGG - Intergenic
987686413 5:21209342-21209364 CAAAATAAAAAGGGGAATCTTGG + Intergenic
987693986 5:21304534-21304556 AACCATAAAAAAATGAAGCTGGG + Intergenic
987978906 5:25054234-25054256 GAAAATAAACAAATAAGGCTGGG + Intergenic
988262783 5:28910356-28910378 AAAAATAGAAAGATAAAACTTGG - Intergenic
988277564 5:29101478-29101500 GAAAATATACAGATGACACTTGG + Intergenic
988371216 5:30370310-30370332 TAAAATGAAAATATTAAGCTAGG - Intergenic
988409502 5:30868948-30868970 GAAAATAAAAATAAAAAGCTTGG + Intergenic
988412286 5:30902090-30902112 GAAAATCAAAAGATGAGGTAGGG + Intergenic
988534078 5:32050487-32050509 GAAAAAAGAAAGATGAATCCTGG - Intronic
988703456 5:33699182-33699204 AAAAATAAAAAGCTTAAGTTAGG + Intronic
988706130 5:33727597-33727619 GACAATAAAGAGAATAAGCTTGG - Intronic
988792485 5:34621351-34621373 GAAAATACAGAAATGAGGCTGGG - Intergenic
988819865 5:34872125-34872147 AAAAAAAAGAAGAAGAAGCTGGG + Intronic
988920309 5:35935327-35935349 GAAAAAAAAAAAAAGAAGTTTGG - Intronic
989331574 5:40266157-40266179 GAAAAAAAAAATTAGAAGCTAGG + Intergenic
989351996 5:40497178-40497200 GAAATTAAAGAGAAGAAGTTGGG + Intergenic
989454903 5:41632300-41632322 GAAAAGAAAAGGAGGAAACTTGG + Intergenic
989497201 5:42123344-42123366 GAAAGTAAAAATATTAAGTTAGG - Intergenic
989543680 5:42647411-42647433 AAAAATAAAAAAATATAGCTGGG + Intronic
989673268 5:43945263-43945285 AAAAAAAAAAGAATGAAGCTTGG + Intergenic
990023266 5:51155114-51155136 GAAAATAAATAGATTAGGCCAGG + Intergenic
990047262 5:51448350-51448372 AAAAATGAACAGATGAACCTTGG - Intergenic
990127923 5:52541642-52541664 GAGAATAAAAAGAATAAACTTGG + Intergenic
990167027 5:53005586-53005608 AAAAAAAAAAAGATGAAAGTGGG + Intronic
990180332 5:53153894-53153916 GAAAATAAAAAGCTTAAGCTTGG - Intergenic
990265696 5:54072622-54072644 TTAAACAAAAAGATAAAGCTTGG + Intronic
990384202 5:55243521-55243543 AAAAAAAAAAAGATTTAGCTGGG + Intergenic
991299225 5:65112689-65112711 AAAAAAAAAAAGATTCAGCTGGG + Intergenic
991348933 5:65700707-65700729 GAAAAGAAAAAGAAGAATCATGG + Intronic
991413657 5:66369478-66369500 AAAAAGAAAAAGATGAAAATTGG - Intergenic
991493970 5:67210021-67210043 GGAAATAGAAAGCTGAAGTTAGG + Intergenic
991589769 5:68238048-68238070 GAAAATAAAGTGCTGAAGGTGGG + Intronic
991606275 5:68404640-68404662 AAAAATAAAAAAATGAAGGTGGG - Intergenic
991622921 5:68565135-68565157 AAAAATGAAACAATGAAGCTAGG + Intergenic
991746263 5:69744997-69745019 AACCATAAAAAAATGAAGCTGGG - Intergenic
991751442 5:69810244-69810266 AACCATAAAAAAATGAAGCTGGG + Intergenic
991797865 5:70324950-70324972 AACCATAAAAAAATGAAGCTGGG - Intergenic
991825641 5:70620311-70620333 AACCATAAAAAAATGAAGCTGGG - Intergenic
991830729 5:70685138-70685160 AACCATAAAAAAATGAAGCTGGG + Intergenic
991890208 5:71324269-71324291 AACCATAAAAAAATGAAGCTGGG - Intergenic
991981025 5:72230869-72230891 GTAAATAACAAGATGAGGCAGGG - Intronic
992055345 5:72983361-72983383 AAAAATAAAAAAATAAAGCTAGG - Intronic
992064344 5:73091770-73091792 GAAAATAACAAAATGGAGCAGGG - Intergenic
992334497 5:75751789-75751811 CAAAATAAAAGGAAAAAGCTAGG + Intergenic
992475525 5:77098271-77098293 AAAAAAAAAAAGAGGAAGGTGGG - Intergenic
992504154 5:77368905-77368927 CAAAAGAAAAAGAAGAGGCTGGG + Intronic
992521040 5:77551679-77551701 AAAAATAAAAAAATAAAGCCTGG + Intronic
992660136 5:78951205-78951227 TAAAATAAAAAAATAAAGATAGG - Intronic
992676086 5:79107797-79107819 GAAAATTAGAAGTTGAAGCTGGG - Intronic
992799256 5:80281046-80281068 GAAAATAAAAGGAAACAGCTGGG - Intergenic
992943896 5:81790483-81790505 GAAGATAAAAAGATGTAGAGTGG + Intergenic
992948707 5:81835094-81835116 AAAAATAAAGAGATGAAGGAAGG + Intergenic
993103161 5:83566572-83566594 GGAAAAAAAAAGATGATGGTGGG - Intronic
993216197 5:85025434-85025456 AAAAATACAAATATAAAGCTAGG - Intergenic
993229625 5:85217095-85217117 GAAAAAAAAAAAAACAAGCTGGG + Intergenic
993247125 5:85465377-85465399 TAAAATAAAAAAAAGAAACTGGG + Intergenic
993420050 5:87690242-87690264 AAAAAAAAAAAAAGGAAGCTGGG - Intergenic
993597652 5:89879494-89879516 CACAAAAAAAAGATGAAGATGGG - Intergenic
993629780 5:90271998-90272020 TAAAAAAAAAAAATGAAGCCTGG + Intergenic
993708279 5:91196084-91196106 AAAAAGAAAAAGATGAGGTTTGG + Intergenic
993857116 5:93090365-93090387 GAAAAAAAAAAGAAGAAGAAAGG - Intergenic
994003170 5:94805465-94805487 AAAAACAAAAAAATGTAGCTGGG + Intronic
994133557 5:96259691-96259713 GAGAAGAGAAAGAGGAAGCTAGG - Intergenic
994335119 5:98555767-98555789 GAAGATAATTAGATGAAGCTAGG + Intergenic
994456365 5:100013134-100013156 AAAAATAAAAAGAAAAAGTTAGG + Intergenic
995038248 5:107559567-107559589 GAACATAAACAGATGTAGTTGGG - Intronic
995560514 5:113376082-113376104 TAAAATAAAAAAATTAACCTTGG + Intronic
995638461 5:114223703-114223725 GGGAATAAAAGGATGAGGCTAGG + Intergenic
995874920 5:116780458-116780480 AAAAAAAAGAAGAAGAAGCTGGG - Intergenic
995946178 5:117649112-117649134 GAAAATAAGAAATTAAAGCTGGG + Intergenic
995992010 5:118251546-118251568 GATAAAAAAAGAATGAAGCTGGG + Intergenic
996096481 5:119404694-119404716 AAAAAAAAAAAGATGAACCAAGG - Intergenic
996170355 5:120282618-120282640 CAAAATAAAAGGATGAAGGAAGG + Intergenic
996210566 5:120804013-120804035 GAATAGAAAATGATGAAGATTGG + Intergenic
996827154 5:127697735-127697757 GAAAATAAAAAGTTAAAGAAAGG - Intergenic
996845731 5:127896739-127896761 GAAAATGAAAAGAATCAGCTGGG - Intergenic
996927108 5:128840754-128840776 GAAAACCATAAGATGAAGTTAGG + Intronic
997336128 5:133109831-133109853 AAAAAAAAAAAAAAGAAGCTTGG + Intergenic
997440001 5:133902493-133902515 GAAAAGAAAAAGAAGTTGCTAGG + Intergenic
997802203 5:136875051-136875073 TAAAATAGCAAGACGAAGCTGGG - Intergenic
997847968 5:137305054-137305076 GTAAATTAATAGTTGAAGCTAGG - Intronic
997926967 5:138039594-138039616 GAAAAAAAAAAAAAAAAGCTGGG - Intronic
997944785 5:138190466-138190488 GAAAAAAAAAAAAAAAAGCTGGG + Intronic
997953550 5:138260766-138260788 GAAAAAAAAAAAATGCAACTGGG + Intronic
998074773 5:139226626-139226648 AAAAATAAAAAAATTTAGCTGGG + Intronic
998490206 5:142540019-142540041 CAAAATAAAAAGATGGGGGTTGG + Intergenic
998547783 5:143045836-143045858 GAAAATACAAAAATTAGGCTGGG + Intronic
998718000 5:144907856-144907878 GAAAATAAAAAGGAAAAGCAGGG + Intergenic
998931739 5:147188703-147188725 GACAATGAAATGATGAGGCTGGG - Intergenic
999685778 5:154101788-154101810 GAAAATACAAAAAAAAAGCTGGG + Intronic
999770779 5:154774040-154774062 AAAAAAAAAAAAATGAAGCCAGG - Intronic
999909533 5:156182600-156182622 AAAAATAAAAAGAACAAGCTAGG + Intronic
1000224299 5:159244625-159244647 GAAAAGAAAAAGAAAAAACTTGG - Intergenic
1000271655 5:159690423-159690445 GAAATTAATAAGATGAATTTTGG + Intergenic
1000283674 5:159806789-159806811 GAAAATTAAAAGTTGAAGGAAGG + Intergenic
1000447682 5:161344302-161344324 GAAAATACAGAGATGGGGCTAGG + Intronic
1000482054 5:161789503-161789525 AAAAAAAAAAAAAAGAAGCTAGG + Intergenic
1000789836 5:165592254-165592276 CAAAATAAAAAGAGGAAGAAAGG + Intergenic
1000792386 5:165623820-165623842 AAAAATAAACATTTGAAGCTTGG - Intergenic
1002177187 5:177407787-177407809 AAAAAAAAAAAGATGCAGATGGG + Intronic
1002468206 5:179418480-179418502 AAAAATACAAAGAAGTAGCTGGG + Intergenic
1002552923 5:180010518-180010540 AAAAATACAAAAATGTAGCTGGG - Intronic
1003128304 6:3373592-3373614 CTAAATCAAAAGAAGAAGCTGGG + Intronic
1003666420 6:8115849-8115871 GAAAAACAAGAGAAGAAGCTCGG + Intergenic
1003694551 6:8390417-8390439 GATAGTAAAAAGATGAGGGTGGG - Intergenic
1003864951 6:10354374-10354396 GAAAATAATAATCTGAAACTTGG - Intergenic
1003953581 6:11141719-11141741 GAAAAAAAAAAAAAGAGGCTGGG + Intergenic
1004209036 6:13618728-13618750 CAAAATAAAAAAAGTAAGCTGGG + Intronic
1005007571 6:21304567-21304589 GAAAATAAAAAGACAAACCACGG + Intergenic
1005050923 6:21683316-21683338 AAAAATAACAAGAAGACGCTGGG - Intergenic
1005488547 6:26324240-26324262 AACAATAAAAAGAAAAAGCTGGG + Intergenic
1005556925 6:26995386-26995408 AACCATAAAAAAATGAAGCTGGG - Intergenic
1005702732 6:28418825-28418847 AAAAAAAAAAAGATGCAGCTAGG + Intergenic
1005740828 6:28789087-28789109 CAAACAAAAAAGATGATGCTGGG + Intergenic
1005805950 6:29474723-29474745 AAAAAAAAAAAGAAGAAGCCAGG + Intergenic
1005903857 6:30243339-30243361 AAAAATACAAAAATGAAGCCGGG + Intergenic
1006029386 6:31168227-31168249 AAAAAAAAAAAGGTGAGGCTAGG - Intronic
1006095989 6:31657146-31657168 AAAAAAAAAAAAAAGAAGCTGGG + Intronic
1006255954 6:32832471-32832493 GAGAAGAAAGAGATGAGGCTGGG + Intronic
1006370895 6:33643055-33643077 GAAAAGACAAAGATGGAGCTTGG + Intronic
1006460248 6:34153932-34153954 AAAAAAAAAAAGTTGAAGCCAGG + Intronic
1006515428 6:34542896-34542918 AAAAAAAAAAAGAAGAGGCTGGG + Intronic
1006532696 6:34670547-34670569 CAAAATTAAAAGATGAGGATAGG + Intronic
1007032755 6:38642982-38643004 AAAAATAAAAAAATAAAACTGGG - Intergenic
1007252488 6:40505534-40505556 GAAAATTAAAACATGAAATTGGG + Intronic
1007447512 6:41918511-41918533 AAAAAAAAAAAGACGAAACTTGG + Intronic
1007456399 6:41981043-41981065 GAAAATAAAAAGCATAAGATGGG + Intronic
1007678643 6:43618929-43618951 TAAAATAAAAAGTAGAAGTTGGG - Intronic
1007814109 6:44508190-44508212 AAAAAAAAAAAAAAGAAGCTTGG - Intergenic
1008000799 6:46357825-46357847 GACAATATAAAGAAGCAGCTAGG + Intronic
1008607002 6:53150283-53150305 AAAAAAAAAAAGATGAAGCAGGG - Intergenic
1008741290 6:54611808-54611830 GAAAAAAAAAATATTTAGCTGGG + Intergenic
1008780945 6:55104005-55104027 GGAAATTAAATGATGAAACTTGG + Intergenic
1008916472 6:56792906-56792928 AAAAATACAAAAATGTAGCTAGG + Intronic
1008944936 6:57087507-57087529 GAAAATAAAAAGAAAATCCTGGG - Intronic
1009421046 6:63465339-63465361 AAAAATACAAAGATTTAGCTGGG - Intergenic
1009811064 6:68667662-68667684 AAAAATAACAACATGCAGCTTGG - Intronic
1010161212 6:72858572-72858594 GAAAATATAAATATGAGGGTTGG - Intronic
1010176883 6:73038339-73038361 GAAAAAAAAAACATGCAGTTTGG - Intronic
1010333335 6:74650246-74650268 GAAAATAGAAAGTTGATGGTTGG - Intergenic
1011098071 6:83688662-83688684 AAAAATAAAAAAATTTAGCTGGG - Intronic
1011287120 6:85736785-85736807 GAAAAAAAAAAGAAAAGGCTGGG + Intergenic
1011684273 6:89811852-89811874 GAAAATACAAAGGTGTAGCCAGG - Intronic
1011726858 6:90218480-90218502 GAAAAGAAAAAGAGGAGGGTGGG - Intronic
1011913978 6:92479106-92479128 GACACTAAAAAGATAAAGGTTGG + Intergenic
1011951993 6:92978276-92978298 GAAAATACAAAGAGTTAGCTGGG + Intergenic
1011984304 6:93423491-93423513 TAAAATAACAAAATGTAGCTAGG + Intergenic
1012003154 6:93680096-93680118 GAAAAGAAAAACATGAAGCAAGG - Intergenic
1012027916 6:94021318-94021340 GAAAACAAAAACATGAAGTGTGG - Intergenic
1012455157 6:99395304-99395326 GAAAATACAAAAATTAAGCCGGG - Intergenic
1012456582 6:99413352-99413374 GAAATTAAAAAAATGTATCTTGG - Intronic
1012827771 6:104166904-104166926 GAAAATAATAAGATGAATTTTGG + Intergenic
1012867076 6:104631620-104631642 AAAAATAATAATATGCAGCTTGG + Intergenic
1012880269 6:104779030-104779052 GAAAATAAAAACATGAACAAAGG + Intronic
1013049262 6:106516231-106516253 TAAAAAAAAAAAAAGAAGCTTGG - Intronic
1013116868 6:107110036-107110058 AAAAAAAAAAAAAGGAAGCTGGG + Intronic
1013257552 6:108403649-108403671 CAAAATATAAAGAGGAAGCTAGG + Intronic
1013329872 6:109089710-109089732 GAAAATAACAAAATTAAGCATGG - Intronic
1013502522 6:110766837-110766859 GAAAATAAACAAATAAGGCTGGG + Intronic
1013679450 6:112508256-112508278 AAAAAAAAAAAAAAGAAGCTTGG - Intergenic
1013771881 6:113637168-113637190 GAAAAAACAAACATGAACCTTGG + Intergenic
1013828367 6:114242866-114242888 AAAAAAAAAAAGAAGAAGGTGGG + Intronic
1013941950 6:115675061-115675083 GAAAATACAAAGAATTAGCTGGG - Intergenic
1014289834 6:119545550-119545572 GAAAATAAAAAAAGGTAACTTGG - Intergenic
1014562677 6:122910213-122910235 AAAAAAAAAAAGATAAAACTTGG - Intergenic
1014589671 6:123248259-123248281 GAAATACAAAAGATCAAGCTGGG + Intronic
1015047816 6:128798099-128798121 GAAAATAAAAGTATGTAGATTGG + Intergenic
1015559442 6:134498590-134498612 GAAAAAATAAAGAAGAGGCTGGG + Intergenic
1015944049 6:138482151-138482173 TAAAAAAAGAAGATGAAGCCGGG + Intronic
1016155543 6:140802767-140802789 GAAAAAAGAAAGACGAAACTGGG - Intergenic
1016228919 6:141777487-141777509 TAAAATAAAAAGATTCATCTGGG + Intergenic
1016544228 6:145202520-145202542 GAAAATGGAAAGAGGAAGCATGG + Intergenic
1016809523 6:148246006-148246028 GAAAAAAAAAGAATTAAGCTGGG + Intergenic
1016824619 6:148376868-148376890 TAAAAACAAAAGATGAAACTCGG + Intronic
1016879551 6:148897473-148897495 AAAAATAAAAAGATAAGGCTGGG - Intronic
1016968566 6:149741664-149741686 GAAAATAACAAAAATAAGCTGGG - Intronic
1016976712 6:149815876-149815898 TCAGTTAAAAAGATGAAGCTGGG - Intergenic
1017289098 6:152714075-152714097 GGCAATAAAAACATCAAGCTAGG - Intronic
1017294021 6:152773806-152773828 AAAAATAAAAATATAAAGCCAGG + Intergenic
1017296861 6:152807587-152807609 GAATATGAAAAGATGCAGATGGG + Intergenic
1017495021 6:154976090-154976112 GAAAATACAAAAAATAAGCTGGG + Intronic
1017501668 6:155031425-155031447 GAAAATGAAGAGATGAGGCTGGG + Intronic
1017548365 6:155476652-155476674 CAAAATTAAAAGATGAGGCCAGG + Intergenic
1017809643 6:157975698-157975720 AAACATAAAAAGATGAAATTTGG - Intergenic
1017849774 6:158295004-158295026 GAAAAGAAAGAGAGGAAGCCAGG - Intronic
1018023346 6:159783992-159784014 CAAAAAACAAAAATGAAGCTTGG - Exonic
1018085332 6:160296581-160296603 AAAAATAAAAATATGAAGCAAGG - Intergenic
1018675906 6:166222334-166222356 AAAAATACAAAAATTAAGCTGGG - Intergenic
1019759397 7:2798879-2798901 GCAATTAAAAAGAGGAAGCCTGG + Intronic
1019763894 7:2835352-2835374 AAAAATAAAAAGAATAAACTAGG + Intronic
1019987333 7:4667225-4667247 AAAAATAAAAAAATTAAGCTGGG - Intergenic
1019987432 7:4667976-4667998 TAAAAAACAAAAATGAAGCTCGG + Intergenic
1020123475 7:5518977-5518999 GAAAATAAACAGGTCAGGCTGGG - Intergenic
1020166460 7:5811394-5811416 GAAAATAAAAAAAATTAGCTGGG - Intergenic
1020205615 7:6113062-6113084 AAAAATACAAAAATGTAGCTGGG - Intronic
1020417371 7:7961339-7961361 GAATATACAAATATGAATCTTGG + Intronic
1020520676 7:9182461-9182483 GTAAATACAAAGATGAAAGTAGG - Intergenic
1020834718 7:13134931-13134953 AAAATTAAAAAGAAGAGGCTGGG + Intergenic
1020846187 7:13286819-13286841 AAAAATAAAAAGCAGAAGCAGGG - Intergenic
1020847550 7:13306423-13306445 GAAAATACAAAAATATAGCTGGG + Intergenic
1021028204 7:15695774-15695796 CAAAACAAAAACCTGAAGCTGGG - Intergenic
1021422187 7:20458175-20458197 GAAAAAAAAAAGAAGTAGCTGGG - Intergenic
1021808887 7:24383386-24383408 GAAAATAACAAGATGAGGTGAGG + Intergenic
1021829912 7:24595340-24595362 GGAAATACAAATCTGAAGCTTGG + Intronic
1022053880 7:26708576-26708598 GAAAGTAAAAGGATTAAGGTTGG - Intronic
1022084583 7:27054748-27054770 TAATATAAAAAGAAGAAACTTGG + Intergenic
1022475798 7:30708727-30708749 AAAAAAAAAAAGAAGAAGCTGGG - Intronic
1022671422 7:32459803-32459825 GAATATCCAAAGATGCAGCTGGG + Intergenic
1022676540 7:32505167-32505189 TAAAATAAAAAGATCAGGCCGGG - Intronic
1023305701 7:38824146-38824168 GAAAAGAAATAGATTAAGTTAGG - Intronic
1023334098 7:39150453-39150475 AAAAAAAAAAAAATGTAGCTTGG - Intronic
1023422947 7:40003085-40003107 GAAAAGAAAAAGATTAAAGTAGG + Intronic
1023448370 7:40255364-40255386 GAAAATAACAGGCTGAGGCTGGG + Intronic
1023691676 7:42795628-42795650 CAAAAAACAAAAATGAAGCTTGG + Intergenic
1023890332 7:44387319-44387341 TAAAAAAAGAAAATGAAGCTGGG - Intronic
1024012055 7:45276380-45276402 AAAAATAAAAAAAATAAGCTGGG + Intergenic
1024124755 7:46281937-46281959 AAAAAAAAAAAGATAGAGCTGGG + Intergenic
1024369954 7:48570616-48570638 GAAAGTAAAAGGATGCAGCTGGG - Intronic
1024377038 7:48651895-48651917 AAAAATTAAAAGAGGAATCTAGG - Intergenic
1024394645 7:48851602-48851624 TAAAATAAAATGATTAAGGTGGG + Intergenic
1024400615 7:48921039-48921061 TAAAATAAAATGATTAAGGTGGG - Intergenic
1024769166 7:52698083-52698105 TAAAATAAAAAGAGGAAGTCAGG - Intergenic
1024847055 7:53658186-53658208 AAATATGAAATGATGAAGCTAGG - Intergenic
1024894557 7:54242987-54243009 GGAAATAACCTGATGAAGCTTGG + Intergenic
1024932733 7:54680702-54680724 GAAAATAAAAATAGGCAACTAGG - Intergenic
1025013260 7:55416445-55416467 AAAAATAAAAAGATTTAGCCAGG - Intronic
1025030551 7:55553377-55553399 GAAAATAAAAAGACTAGCCTGGG + Intronic
1025088005 7:56038846-56038868 AAAAAGAAAAAAATGAGGCTGGG + Intronic
1025223169 7:57133569-57133591 AAAAAGAAAAAGGTGGAGCTGGG + Intronic
1025273819 7:57554753-57554775 GCAAGTAATAAGCTGAAGCTGGG - Intergenic
1025488117 7:61077267-61077289 GAAAATAAACAGGTGAAGGAAGG - Intergenic
1025794158 7:64722512-64722534 AAAAAAAAAAAGAAGAAGCTAGG - Intergenic
1025888105 7:65618296-65618318 GAAAATGAATATATGATGCTGGG + Intergenic
1025934643 7:66025520-66025542 GAAAATACAAAAAAAAAGCTGGG + Intergenic
1026264682 7:68785869-68785891 AAAAAAAAAAAGAAGAAGGTTGG + Intergenic
1026418575 7:70209213-70209235 TAAAGTAAAAAGAGGAAGCAAGG + Intronic
1026456740 7:70579252-70579274 AAAAAAAAAAAGATGAAGGGAGG + Intronic
1026537520 7:71252229-71252251 AAAAAAAAAAAGATGAGGCCGGG + Intronic
1026659099 7:72283372-72283394 AAAAATAAAAAAATTTAGCTGGG + Intronic
1026887539 7:73961991-73962013 AAAAAAAAAAAGAGGAAGGTAGG - Intergenic
1026974039 7:74485624-74485646 AAAAAAAAATAGATGCAGCTGGG + Intronic
1026982911 7:74537112-74537134 AAAAATACAAACATGCAGCTGGG + Intronic
1027151488 7:75737219-75737241 AAAAATAAAAAAATTAGGCTGGG - Intronic
1027167034 7:75842170-75842192 AAAAAAAAAAAAAAGAAGCTTGG - Intergenic
1027353447 7:77334596-77334618 AAAAAAAAAAAGATGAACCTGGG + Intronic
1027444078 7:78252468-78252490 AAAAAAAAAAAAATGAAGTTAGG + Intronic
1027494444 7:78869856-78869878 GCAAATAAAAACATAAAGTTGGG - Intronic
1027520334 7:79198725-79198747 GAAAATAAAAAAAATTAGCTGGG + Intronic
1028021930 7:85787414-85787436 GAAAATAAAAATTTTAAGATGGG + Intergenic
1028276242 7:88861313-88861335 TTAAAGAAAAAGATGAAGCCAGG + Intronic
1028473393 7:91228475-91228497 AAAAATAAACAAATAAAGCTGGG - Intergenic
1028524337 7:91766945-91766967 GCAAATAAAAAAATTCAGCTGGG + Intronic
1028594298 7:92530919-92530941 AAAAATACAAAAATCAAGCTGGG + Intronic
1028598391 7:92572556-92572578 GAAAATACAAAAAAGTAGCTGGG + Intronic
1029010208 7:97252217-97252239 GGAAAGAAAAAGATAAAGTTGGG + Intergenic
1029029099 7:97449983-97450005 GATAATAAAAAGATAAGGCCAGG + Intergenic
1029180585 7:98698621-98698643 GAAAAAAGAAAGATGAACCTTGG - Intergenic
1029368196 7:100129915-100129937 AAAAAAAAAAAAATGTAGCTGGG - Intergenic
1029377395 7:100187748-100187770 AAAAAAAAAAAGATGATGCAGGG - Intronic
1029378428 7:100196630-100196652 AAAAATACAAAAAGGAAGCTGGG + Intronic
1029516280 7:101025365-101025387 GAAAAAAAAAAAAAGAGGCTTGG + Intronic
1029572613 7:101380283-101380305 AAAAAAAAAAAAATGTAGCTGGG - Intronic
1029633694 7:101769592-101769614 GGAAATGAAAGGAAGAAGCTGGG - Intergenic
1029684252 7:102134756-102134778 AAAAATAAAAAGAATTAGCTGGG - Intronic
1029710535 7:102296642-102296664 GGGAATAAGAGGATGAAGCTGGG + Intronic
1029732008 7:102444654-102444676 AAAAAAAAAAAGAAGAAGCCTGG - Intronic
1030045960 7:105495785-105495807 GAACATAAAAAAATTAAGCCAGG + Intronic
1030158433 7:106481564-106481586 TTAAATGAAAATATGAAGCTGGG - Intergenic
1030349792 7:108471202-108471224 AAAAAAAAAAAGAAGAAGTTAGG - Intronic
1030363659 7:108622404-108622426 CAAAATAAAAACATGAGACTTGG + Intergenic
1030613338 7:111712494-111712516 AAAAATAAAAAGGTGAAGTAAGG - Intergenic
1030622650 7:111807769-111807791 TAAAAAAAAATAATGAAGCTGGG - Intronic
1030854436 7:114535559-114535581 GAAAATAAAAACAGACAGCTGGG - Intronic
1030906140 7:115185097-115185119 AAAAACAAAAATATGAGGCTGGG - Intergenic
1031008214 7:116498615-116498637 GAAAATTAAAAGGTGGAGGTCGG + Intronic
1031427406 7:121622549-121622571 GAAAATAGAAAAAGAAAGCTAGG - Intergenic
1031480547 7:122273602-122273624 AAAGATAAAAAGATAAACCTGGG + Intergenic
1031518449 7:122731652-122731674 GAAAAAAAAAAGGTGAAGAGGGG + Intronic
1031691876 7:124798564-124798586 AAAAAAAAAAAGGTGAAGTTAGG - Intergenic
1032025064 7:128434667-128434689 TAAAATAAATAAATAAAGCTGGG + Intergenic
1032617332 7:133488409-133488431 AAAAAGAAAAAGATGAAGTGAGG - Intronic
1032650857 7:133876767-133876789 GAAAGGAAAAAGAAGAATCTAGG - Intronic
1032837800 7:135690018-135690040 AAAAATACAAAAATTAAGCTGGG + Intronic
1032844585 7:135741661-135741683 AAAAATAAAAAAATTTAGCTGGG + Intronic
1033047137 7:137972770-137972792 GAAAAGAAAAAGAAAAACCTAGG + Intronic
1033133531 7:138765908-138765930 GAAAATAAAAATAATCAGCTGGG - Intronic
1033204069 7:139401746-139401768 AAAAAAAAAAAAAAGAAGCTGGG - Intronic
1033330140 7:140410751-140410773 GATAATAGAAAAATGAGGCTGGG - Intronic
1033344014 7:140513283-140513305 AAAAAAAAAAATATGTAGCTGGG + Intergenic
1033391426 7:140931965-140931987 GGAAATAAAAAAATGGAACTAGG - Intergenic
1033503819 7:141980069-141980091 GAAAAAAAAAAAAAGATGCTGGG - Intronic
1033870993 7:145752660-145752682 GAAAATAAAAAAAAGAGGCCAGG + Intergenic
1033974119 7:147078908-147078930 GAAAATAAAAAAAATTAGCTGGG - Intronic
1034409935 7:150935172-150935194 GAAAAAAAAAAGAAAAATCTGGG + Intergenic
1034732295 7:153398583-153398605 GAATATTAAAAGATAAAGCATGG + Intergenic
1035092054 7:156321253-156321275 AAAAAGAAGAAGAAGAAGCTAGG - Intergenic
1035122896 7:156583373-156583395 GAAAATAAGTAGGAGAAGCTGGG - Intergenic
1035174092 7:157038205-157038227 TAAAATAAAAAGATGTGGCCAGG + Intergenic
1035308344 7:157948293-157948315 GACAATAACAACATAAAGCTGGG + Intronic
1035380334 7:158435436-158435458 GAAAAAAAAAAGATGAGTATTGG + Intronic
1035433913 7:158843553-158843575 AAAAATACAAAAATGAGGCTGGG - Intergenic
1035571249 8:674461-674483 GAAAATAAAAAAAATTAGCTGGG - Intronic
1035634967 8:1137780-1137802 AAAAATAAAAAGAGATAGCTGGG - Intergenic
1035821382 8:2595910-2595932 AAAAATAAAAAGATAAAATTGGG + Intergenic
1036106189 8:5842919-5842941 CAAAATAGAAAGCTTAAGCTGGG + Intergenic
1036162027 8:6398324-6398346 GAAAAGAAAAAAATGAGGATTGG + Intergenic
1036204173 8:6793340-6793362 GAAAATAAAAAGATGCACCCTGG + Intergenic
1036260201 8:7233528-7233550 GAAAGAAAAAAGAAAAAGCTCGG + Intergenic
1036306414 8:7605996-7606018 GAAAGAAAAAAGAAAAAGCTCGG - Intergenic
1036312238 8:7692084-7692106 GAAAGAAAAAAGAAAAAGCTCGG + Intergenic
1036357259 8:8053981-8054003 GAAAGAAAAAAGAAAAAGCTCGG - Intergenic
1036618895 8:10409896-10409918 GAAAATAAAAAGAATTAGCCTGG + Intronic
1036813983 8:11887692-11887714 AAAAAAAAAAAAAAGAAGCTGGG - Intergenic
1037012484 8:13860736-13860758 GAAATCATAAAGATGAAGATAGG + Intergenic
1037094002 8:14961191-14961213 AAAAAGAAAATGATGGAGCTGGG - Intronic
1037253727 8:16927138-16927160 GAAAATAAGAAGTTAAAGCTTGG - Intergenic
1037350159 8:17944689-17944711 GAAAATAAAAATATCTAGGTAGG - Intronic
1037433412 8:18838448-18838470 AAAAATAAATAAATGAAGTTGGG + Intronic
1037450255 8:19009728-19009750 AAAAATACAAAAATTAAGCTGGG + Intronic
1038163449 8:25062231-25062253 GAAAGAAAAAAGATGAATTTAGG - Intergenic
1038339719 8:26675086-26675108 GAAAATTAAAACATGAACCTGGG + Intergenic
1038410865 8:27358704-27358726 GAAAAGGCAAAGATGAAGCATGG - Intronic
1038669631 8:29572117-29572139 AAAAAAAAAAGGGTGAAGCTTGG + Intergenic
1038812487 8:30863629-30863651 GAAAAGAAAAAAATGAAGAAGGG - Intronic
1038849499 8:31261813-31261835 TATAATAAAAAGTTGAGGCTGGG + Intergenic
1039225473 8:35383919-35383941 AAAAATAAAAATAAGAGGCTGGG + Intronic
1039978156 8:42384436-42384458 GAAAAGAATCAGATGTAGCTGGG - Intergenic
1040037337 8:42883299-42883321 AAAAATAAAAAAATAAAGTTTGG + Intronic
1040448601 8:47521720-47521742 GAAAATAAAAAAATAAAGAGTGG - Intronic
1040640454 8:49328437-49328459 AAAAATACAAAAATTAAGCTGGG - Intergenic
1040911222 8:52521132-52521154 GAAAAAAAAAAGAAGAAGTAAGG + Intergenic
1040943637 8:52858172-52858194 AAAAATACAAAAATGTAGCTGGG - Intergenic
1041013247 8:53565087-53565109 GAAAATAAAAAAACAAGGCTGGG - Intergenic
1041089079 8:54285343-54285365 AAAAAAAAAAAGATCCAGCTGGG + Intergenic
1041311889 8:56525511-56525533 GAAACTAGAAAGAGGAAGATGGG + Intergenic
1041346879 8:56908617-56908639 TAAAATTAAAATACGAAGCTGGG - Intergenic
1041374206 8:57195844-57195866 AAAAATAAAAAAATTTAGCTAGG - Intergenic
1041545430 8:59037159-59037181 GAAAAAAAAAAAAAGGAGCTTGG - Intronic
1041926885 8:63246535-63246557 GAAAAAAAAAATATCATGCTGGG - Intergenic
1042182949 8:66110244-66110266 AAAAATAAAAACATGACACTGGG - Intergenic
1042262451 8:66873063-66873085 TAAAATAAAATGATTAAGATTGG - Intronic
1042348236 8:67749697-67749719 AAAAAAAAAAAGAAGAAGCCTGG - Intergenic
1042425729 8:68645784-68645806 GAAAATAAAAATCTGAAGAGTGG - Intronic
1042696926 8:71564672-71564694 GGAAATAAAAACATGAGGGTGGG - Intronic
1042885189 8:73541460-73541482 CAAAATAAAAATATTAATCTGGG + Intronic
1042935536 8:74054472-74054494 GAAAAGAAAATGAGGAACCTCGG - Intergenic
1043043422 8:75291032-75291054 GAAAATACAAAGAGGCATCTTGG - Intergenic
1043168785 8:76937635-76937657 GAAACTAATAAGATGAAGACAGG + Intergenic
1043314314 8:78901382-78901404 GAAAATAAAAGAATGATGTTCGG - Intergenic
1043439576 8:80265473-80265495 GAAAAGAAAAAGATGTGGCTGGG - Intergenic
1043713786 8:83455282-83455304 TAAAATTAAAAGATGAAGGAAGG - Intergenic
1043736388 8:83751016-83751038 TAAAATAATTAGATGAATCTAGG + Intergenic
1043754413 8:83985160-83985182 GAGAATTAAAAGAGGAAGATGGG + Intergenic
1044024870 8:87156403-87156425 AAAAATAAAAAAATGTAGCCGGG - Intronic
1044352279 8:91180690-91180712 GAAAATAGGAAGATGAAGGCAGG + Intronic
1044431409 8:92111990-92112012 GAAAATACAGACATGAAGCCAGG - Intergenic
1044593391 8:93935495-93935517 GAAGAAAAAATGAGGAAGCTTGG - Intergenic
1044602940 8:94024116-94024138 AAAAAGAAAAAAATGTAGCTAGG - Intergenic
1044702854 8:94979934-94979956 GAAAATAAAAAAAATCAGCTTGG + Intronic
1044980718 8:97713725-97713747 AAAAAGAAAAAGAAGAAGCAAGG + Exonic
1045052278 8:98338154-98338176 TAAAATAAAGAAATGCAGCTGGG + Intergenic
1045128693 8:99123755-99123777 GAAAAAAAAAAGATGATCCAAGG + Intronic
1045150228 8:99398022-99398044 GAAAATCAAAAGCTGAATTTTGG + Intronic
1045284943 8:100782433-100782455 AAAAATAAAAAAATATAGCTGGG + Intergenic
1045300423 8:100906107-100906129 AAAAAAAAAAAGAAGAAGCCAGG - Intergenic
1045404006 8:101847224-101847246 GAAAAAAAAAAGAAGAAGAAGGG - Intronic
1045527532 8:102954092-102954114 AAAAAAAAAAAAATGAGGCTGGG - Intronic
1045527641 8:102955064-102955086 AAAAAAAAAAAGGTGAAGTTAGG - Intronic
1045740860 8:105358246-105358268 AAAAAAAAAAAAATGAATCTTGG - Intronic
1045909593 8:107391304-107391326 GAAAATAAAAAGACTAAGCCAGG - Intronic
1046124535 8:109887875-109887897 GAAAAAAAAAAGAAGAAGAAAGG - Intergenic
1046155489 8:110284331-110284353 GAAATTATAAAGATGGGGCTGGG - Intergenic
1046210170 8:111062243-111062265 GAAAATAAAATTATCATGCTAGG - Intergenic
1046226074 8:111283048-111283070 GAAAATAGTAACATGAAGCCAGG - Intergenic
1046404729 8:113757958-113757980 TAAAATAAAAAGATCATCCTGGG + Intergenic
1046813314 8:118556268-118556290 GAATTTAAAAAGATGAACATTGG - Intronic
1046857207 8:119046370-119046392 TAAAATAAAAAGAGGTTGCTAGG - Intronic
1046992521 8:120475254-120475276 TAAGGTAAAAAGATAAAGCTAGG - Intronic
1047250673 8:123179984-123180006 GGAAAGAAAAAAGTGAAGCTTGG + Exonic
1047412128 8:124632351-124632373 GTAAAAAATAAGATGAGGCTGGG + Intronic
1047942177 8:129836723-129836745 AAAAATAAAAAGCTGTGGCTGGG + Intergenic
1047944600 8:129862629-129862651 AAAAATAAAAAAATTCAGCTGGG - Intronic
1047958392 8:129993230-129993252 GAAAATAAAAAAAATTAGCTAGG + Intronic
1048012287 8:130467459-130467481 AAAAAAAAAAAGATTTAGCTTGG + Intergenic
1048069230 8:131004288-131004310 GAACAAAGAAAGATAAAGCTGGG - Intronic
1048265981 8:132987063-132987085 AAAAAAAAAAAGATGGAGCATGG + Intronic
1048570104 8:135645498-135645520 TAAAACATAAAGATGAAGGTGGG - Intronic
1048832244 8:138488428-138488450 GAAAAAAAAAAAAGCAAGCTTGG + Intronic
1049811326 8:144574373-144574395 AAAAATAAAAAAATTAGGCTGGG + Intronic
1050026762 9:1342872-1342894 GAAAATATTAAGATAAGGCTAGG - Intergenic
1050120762 9:2304872-2304894 GAATATTAATAGTTGAAGCTGGG - Intergenic
1050298189 9:4228208-4228230 AAAAAAAAAAAGAAGAAGATGGG + Intronic
1050341518 9:4644207-4644229 AAAAAAAAAAAAATGTAGCTGGG + Intronic
1050354009 9:4765713-4765735 GAAAAGTAAAAGATGAGTCTGGG + Intergenic
1050433862 9:5588863-5588885 GAAAAGAAAAATATAAAACTGGG - Intergenic
1050579647 9:7039093-7039115 GAAAATATACTGATGAAGTTAGG - Intronic
1050849696 9:10268104-10268126 AAAAAAAAAAAGATGGAGATGGG - Intronic
1051113733 9:13670368-13670390 GAAACTAAAAAGCTTAAACTGGG - Intergenic
1051295188 9:15587939-15587961 GAAATTAAAAATATGAGGCCAGG + Intronic
1051657400 9:19396251-19396273 AAAAAAAAAAAAATGCAGCTTGG - Intergenic
1051703177 9:19846864-19846886 AAAAATAAAAAAATGAGGCATGG + Intergenic
1051936519 9:22447956-22447978 GATAATGAAAAAATGAAGCATGG + Intronic
1052061988 9:23971545-23971567 GACATTAAAAACATGTAGCTGGG - Intergenic
1052133374 9:24879403-24879425 GAAAAGAGAAAAATGAAGCAGGG - Intergenic
1052422127 9:28256187-28256209 AAAAATAGAAAAATGAAGCAAGG - Intronic
1052457358 9:28717349-28717371 AAAAAAAAAAAGATGAAGGGGGG + Intergenic
1052607870 9:30728667-30728689 GAAAGTCAAAAGATGGAGATTGG - Intergenic
1052797365 9:32935578-32935600 TAAAAAAACAAGAAGAAGCTGGG + Intergenic
1052879958 9:33595685-33595707 GAAAATGCACAGATGCAGCTTGG + Intergenic
1052917822 9:33937610-33937632 AAAAAAAAAAAAATTAAGCTGGG + Intronic
1052936885 9:34100491-34100513 TAAAAAAAAAAAAAGAAGCTGGG - Intronic
1053310144 9:37012952-37012974 AAAAATATATAGATTAAGCTAGG + Intronic
1053328307 9:37177361-37177383 AAAAATAAAAGCATGGAGCTAGG + Intronic
1053496015 9:38548535-38548557 GAAAATGCACAGATGCAGCTTGG - Intronic
1053580329 9:39397285-39397307 AAAAAAAAAAAGAAGAAGCCTGG + Intergenic
1053844832 9:42225376-42225398 AAAAAAAAAAAGAAGAAGCCTGG + Intergenic
1053935255 9:43143569-43143591 AAAAATACAAAAATTAAGCTGGG + Intergenic
1053944434 9:43291951-43291973 GAAAATAAAGAGGTGAAGGAAGG - Intergenic
1054101916 9:60956090-60956112 AAAAAAAAAAAGAAGAAGCCTGG + Intergenic
1054123287 9:61231467-61231489 AAAAAAAAAAAGAAGAAGCCTGG + Intergenic
1054298385 9:63350736-63350758 AAAAATACAAAAATTAAGCTGGG + Intergenic
1055047403 9:71943525-71943547 AAAAACAAAAAAAAGAAGCTGGG - Intronic
1055548375 9:77406710-77406732 AAAAAAAAAAAGATGAGGCTGGG - Intronic
1055767329 9:79678403-79678425 TTAAAAAAAAAGATGAAGTTAGG - Intronic
1055833600 9:80412745-80412767 GAAAAAAAAAAGAGGAAGAGAGG - Intergenic
1055873512 9:80915248-80915270 GAAAATAAAAAAAAAAAGCAGGG - Intergenic
1055896466 9:81182187-81182209 GACAATAAAAAGATAGAGGTAGG + Intergenic
1055959929 9:81810633-81810655 GTAAATAAATAGATGGAGCTGGG + Intergenic
1056401371 9:86230594-86230616 GAAAATAAAACTATCCAGCTGGG - Intronic
1056586124 9:87928346-87928368 GAAAATGCACAGATGCAGCTTGG - Intergenic
1056610758 9:88124597-88124619 GAAAATGCACAGATGCAGCTTGG + Intergenic
1057311935 9:93948397-93948419 AAAAAAAAAAAGAAGAAGCGCGG - Intergenic
1057614424 9:96576116-96576138 AAAAACAAAAAAATTAAGCTGGG + Intronic
1057673770 9:97120448-97120470 AAAAAAAAAAAGATGGAGATTGG + Intergenic
1057675944 9:97136053-97136075 GAAAATGCACAGATGCAGCTTGG - Intergenic
1057949794 9:99360563-99360585 CAAAACAGAAAAATGAAGCTGGG - Intergenic
1058159032 9:101547501-101547523 CAAAATGAAAAGCTGAAGGTAGG + Exonic
1058427776 9:104890418-104890440 GAAAATACAAAAAAGTAGCTGGG + Intronic
1058533870 9:105934336-105934358 GCCAATAAAAAGATGAGGCTGGG - Intergenic
1058696290 9:107561903-107561925 AAAAAAAAAAAAAGGAAGCTGGG - Intergenic
1058797959 9:108516738-108516760 AAAAATCAAAATATGAAACTAGG - Intergenic
1059281580 9:113138519-113138541 AAAAAGAAGAAGAAGAAGCTTGG + Intergenic
1059333679 9:113554464-113554486 AAAAATACAAAAATGTAGCTGGG - Intronic
1059474216 9:114531165-114531187 AAAAATAAAAAGAAAATGCTGGG + Intergenic
1059481567 9:114594681-114594703 GAATGTAAAAATATGAAGATGGG - Intronic
1059800246 9:117742877-117742899 TAATATAAAAAGATGTATCTGGG + Intergenic
1059860743 9:118458383-118458405 AAAAATAAATAGATGCAGATAGG + Intergenic
1059937703 9:119327910-119327932 GAAAAAAAAAAGAAGAAGAAAGG + Intronic
1060008308 9:120020010-120020032 GTAAAGAAAAAGATGAAAATGGG + Intergenic
1060095391 9:120784622-120784644 GAAAAAAAAAAAATGCGGCTGGG + Intronic
1060122446 9:121006546-121006568 GAAAATAAAGACTTGAGGCTGGG + Intronic
1060177081 9:121505093-121505115 CAAAATAAAAAGACCAACCTGGG - Intergenic
1060180595 9:121530963-121530985 AAAAATAAAAAAATTAGGCTGGG - Intergenic
1060296087 9:122343777-122343799 AAAAATAAAAAGAATTAGCTGGG - Intergenic
1060460980 9:123854398-123854420 AAAAAATAAAAAATGAAGCTGGG + Intronic
1060639401 9:125225987-125226009 GAAAAAAAAAAAATTTAGCTGGG + Intronic
1060646301 9:125283352-125283374 AAAAATAAAAATAATAAGCTGGG - Intronic
1060775985 9:126374979-126375001 GGAAATAAAAAGGTGAAGGTGGG - Intronic
1060780251 9:126406821-126406843 AAAAAAAAAAAGATGAAGAAAGG - Intronic
1061179704 9:129017466-129017488 AACAATAAAAATATGAGGCTGGG + Intronic
1061317491 9:129805433-129805455 AAAAAAAAAAAGATGGAGCCTGG + Intronic
1061320489 9:129825182-129825204 AAAAATAAAAAGCTGAGGCCAGG - Intergenic
1061348949 9:130048776-130048798 CAAAAAAAAAAGAGGAAACTGGG - Intergenic
1061452642 9:130676901-130676923 GAAAAAAAAAAGAAGAAGAAGGG - Intronic
1061562064 9:131411094-131411116 AAAAATAAAAAGAATTAGCTGGG + Intronic
1061601595 9:131673928-131673950 GATAATAAAAATATGGAACTCGG + Intronic
1061703073 9:132430809-132430831 AAAAAAAAAAAGAAGATGCTAGG + Intronic
1062246228 9:135567855-135567877 GAAAATAAAAAAAATCAGCTGGG + Intergenic
1062496618 9:136834771-136834793 TAAAATAAAAATGTGAGGCTGGG - Intronic
1062557985 9:137124913-137124935 AAAAATAAAAAAATTAGGCTGGG + Intergenic
1062666494 9:137676077-137676099 AAAAATAAAAAAATTAGGCTGGG - Intronic
1203447630 Un_GL000219v1:74656-74678 GAAAAAAAAAAAATTTAGCTGGG - Intergenic
1203587570 Un_KI270747v1:20529-20551 GAAAATAAAGAGGTGAAGGAAGG - Intergenic
1185520183 X:732805-732827 GAAAAAAAAAAAAAGAACCTGGG + Intergenic
1185590414 X:1272784-1272806 AAAAAGAAAAAGAAGAAGCTAGG - Intronic
1185722111 X:2390431-2390453 TAAAAAAAAAAAATGCAGCTGGG - Intronic
1185847391 X:3450830-3450852 AAAAAAAAAAAGATCAGGCTGGG - Intergenic
1186033567 X:5395823-5395845 AAAAATAAAAATATCAGGCTGGG + Intergenic
1186220742 X:7346770-7346792 GAAAAATATAAGATGATGCTGGG + Intronic
1186478710 X:9879231-9879253 AAAAATAAAAACAATAAGCTGGG - Intronic
1186604481 X:11076311-11076333 GAGAATACAAAGAGGTAGCTAGG + Intergenic
1186665941 X:11717605-11717627 GAAAATAAAGATAAGAATCTAGG - Intergenic
1186848747 X:13558217-13558239 AAAAAAAAAAAGGTTAAGCTTGG - Intergenic
1187015671 X:15326049-15326071 GAAAATATAAAGTTGAATGTTGG + Intronic
1187360259 X:18619479-18619501 GTAAATAGAAAAATGAAGGTAGG + Intronic
1187382033 X:18811346-18811368 GAAAAAAGAGAGATCAAGCTGGG - Intronic
1187435395 X:19263494-19263516 GAAAAGAAAAAAATGAATGTAGG + Intergenic
1187517305 X:19983909-19983931 AAATATAAAAAAATGTAGCTGGG + Intergenic
1187884428 X:23875966-23875988 AAAAATAAAAATATTAGGCTGGG + Intronic
1187958135 X:24540880-24540902 AAAAAAAAAAAAAGGAAGCTAGG - Intergenic
1188142246 X:26565968-26565990 GAAAATCACAAGATATAGCTTGG - Intergenic
1188356394 X:29196987-29197009 TAAAAGAAAAAGATGAAGTTGGG - Intronic
1189553818 X:42120960-42120982 CAAAATAAAAAGAAAAATCTAGG + Intergenic
1189563017 X:42210347-42210369 AAAAAAAAAAAAAAGAAGCTGGG - Intergenic
1189819621 X:44857898-44857920 GAAGATAAAAACAGGAACCTGGG + Intergenic
1189819751 X:44858725-44858747 GAAGATAAAAACAGGAACCTGGG - Intergenic
1190154836 X:47981737-47981759 AAAAATACAAAAATGTAGCTGGG + Intronic
1190281334 X:48932646-48932668 AGAAAGAAAAAGAGGAAGCTGGG + Intronic
1190392739 X:49948149-49948171 AAAAAAAAAAAGGTGAAGCCAGG - Intronic
1190396390 X:49989284-49989306 AAAAATAAAAATATGAGCCTGGG - Intronic
1190715757 X:53101836-53101858 AAAAATACAAAAATTAAGCTGGG + Intergenic
1190757511 X:53413662-53413684 GAAAAGGACAAAATGAAGCTTGG + Intronic
1190831422 X:54062482-54062504 AAAAAAAAGAAGAAGAAGCTGGG - Intergenic
1191030200 X:55961369-55961391 GATAGCAAAAAGATGAATCTGGG + Intergenic
1191140652 X:57113384-57113406 GAAAATAAAAACATGACACATGG + Intergenic
1191612639 X:63133578-63133600 GCCAATAAAAACATCAAGCTGGG - Intergenic
1191623658 X:63245348-63245370 GCCAATAAAAACATCAAGCTGGG + Intergenic
1191834639 X:65451243-65451265 AAAAACAAAAAAATGAGGCTGGG - Intronic
1192475775 X:71441173-71441195 GAAAATATACAGATGGGGCTTGG - Intronic
1192754094 X:74027843-74027865 GAGAATAAAAAAATGAAGGAAGG + Intergenic
1192899856 X:75485334-75485356 GAAAATAAAAATATTAGACTGGG - Intronic
1193170468 X:78329843-78329865 AAAGATAAAGAGATGAAGCAAGG - Intergenic
1193204580 X:78733267-78733289 ATCAATAAAAAGATGAATCTTGG - Intergenic
1193243698 X:79204011-79204033 AAAAATAAAAAAATAGAGCTGGG + Intergenic
1193252705 X:79310534-79310556 TAAAATAAAACAATGAAGCATGG + Intergenic
1193498887 X:82247983-82248005 GAAAATCAAAAGATAAAACTAGG - Intergenic
1193763341 X:85493528-85493550 AAAAATAATAGGATGAAACTCGG - Intergenic
1193886795 X:86992951-86992973 TGAAATAAAAATAGGAAGCTAGG - Intergenic
1193987236 X:88258941-88258963 GAATATAAAGAGTTGAGGCTGGG + Intergenic
1194933450 X:99917671-99917693 GAAATTAAAAAGTTGAAGTTAGG + Intergenic
1195293207 X:103449239-103449261 GAAAACAAAAAAATAAACCTAGG - Intergenic
1195307611 X:103600710-103600732 GAAAATAAAAAGATGAAGGCAGG - Intergenic
1195315947 X:103678109-103678131 AAAAAAAAAAAAATAAAGCTCGG + Intronic
1195380204 X:104263366-104263388 AAAAATAAAAAAAAAAAGCTGGG - Intergenic
1195573865 X:106427227-106427249 GAAAATAAAATGAACAAACTTGG - Intergenic
1195640739 X:107172026-107172048 AGAAATAAAAAGATGAGGCCAGG + Intronic
1195648230 X:107257302-107257324 CAAAGTAAAAACAAGAAGCTGGG + Intergenic
1195790772 X:108582684-108582706 AAAAAAAAAAAGCTGAATCTTGG - Intronic
1196388351 X:115183744-115183766 TAAAAGAAAAACATGAAGCATGG + Intronic
1196794490 X:119491214-119491236 AAAAATACAAAAATGTAGCTGGG - Intergenic
1196928452 X:120657229-120657251 AAAAATAGTAAGATGAGGCTGGG + Intergenic
1197028692 X:121787565-121787587 GAAGAAAAAAAAATGAAGCAAGG + Intergenic
1197052339 X:122074827-122074849 GAAAATAAAGGGATGAAGAAAGG - Intergenic
1197097092 X:122609887-122609909 TAAAAGAAAACGATGAACCTAGG + Intergenic
1197199820 X:123738629-123738651 AAAAAAAAAAAGAAGAAGCAGGG + Intergenic
1197816907 X:130507165-130507187 GAAAACAAAAAGAGAAAGTTTGG - Intergenic
1198065213 X:133089601-133089623 GAAAATAAATAAAGGAAGGTGGG + Intronic
1198160316 X:134001567-134001589 GAAGACAAACAGGTGAAGCTGGG - Intergenic
1198180924 X:134208331-134208353 AAAAATAGAAAAATTAAGCTGGG - Intergenic
1198253505 X:134904861-134904883 GAAAAAAAAAAAAAGAAGATTGG + Intronic
1198449822 X:136755675-136755697 GAAAAAAGAAACATGAAGGTAGG - Intronic
1198600588 X:138281068-138281090 GAAATTAACAAGAGGAAGTTTGG - Intergenic
1198670752 X:139077874-139077896 GAAAAAAAAGTGATGAGGCTAGG + Intronic
1198856954 X:141028563-141028585 GAAAATAAAAATGTTAAACTAGG - Intergenic
1198905740 X:141558804-141558826 GAAAATAAAAATGTTAAACTAGG + Intergenic
1199281768 X:146009551-146009573 GAAAACAAAAAGAAGACGTTGGG - Intergenic
1199722926 X:150555691-150555713 AAAAAAAAAAAAAAGAAGCTGGG + Intergenic
1200170102 X:154066409-154066431 GAAAATGAAAAGACAGAGCTGGG - Intronic
1201233154 Y:11885284-11885306 TAAAATAAAAGGATGAAGGAAGG + Intergenic
1201392276 Y:13511914-13511936 GGAAATAAAAATATGAAAATTGG + Intergenic
1201448353 Y:14082917-14082939 CAAAAGAAAAAAAAGAAGCTGGG + Intergenic
1201494773 Y:14581247-14581269 GAGAAAAAAAAAAGGAAGCTTGG - Intronic
1201585865 Y:15560438-15560460 GAAAAAAAAAAAAAAAAGCTGGG + Intergenic
1201767710 Y:17588061-17588083 AAAAAAAAAAAAATGAAGCTGGG + Intergenic
1201773578 Y:17641802-17641824 AAAAAAAAAAAGATGAGGCCAGG - Intergenic
1201827977 Y:18264184-18264206 AAAAAAAAAAAGATGAGGCCAGG + Intergenic
1201833843 Y:18317924-18317946 AAAAAAAAAAAAATGAAGCTGGG - Intergenic
1202060458 Y:20882127-20882149 AAAAATAAAAATAAAAAGCTAGG - Intergenic
1202374426 Y:24220653-24220675 GAAAAGAAAAAAATGAAGAATGG + Intergenic
1202496354 Y:25449467-25449489 GAAAAGAAAAAAATGAAGAATGG - Intergenic