ID: 1169241120

View in Genome Browser
Species Human (GRCh38)
Location 20:3981925-3981947
Sequence CGGGGTTTTACCTGTTGTCC AGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 1829
Summary {0: 1, 1: 2, 2: 50, 3: 359, 4: 1417}

Found 5 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1169241120_1169241128 28 Left 1169241120 20:3981925-3981947 CCTGGACAACAGGTAAAACCCCG 0: 1
1: 2
2: 50
3: 359
4: 1417
Right 1169241128 20:3981976-3981998 GGTATGGTGGTGCATGCCTATGG 0: 5
1: 146
2: 1172
3: 2813
4: 5922
1169241120_1169241125 7 Left 1169241120 20:3981925-3981947 CCTGGACAACAGGTAAAACCCCG 0: 1
1: 2
2: 50
3: 359
4: 1417
Right 1169241125 20:3981955-3981977 GAAAAATATAAAAATTAGCTGGG 0: 52
1: 4660
2: 83655
3: 165080
4: 130175
1169241120_1169241127 15 Left 1169241120 20:3981925-3981947 CCTGGACAACAGGTAAAACCCCG 0: 1
1: 2
2: 50
3: 359
4: 1417
Right 1169241127 20:3981963-3981985 TAAAAATTAGCTGGGTATGGTGG 0: 254
1: 7086
2: 77416
3: 158428
4: 219378
1169241120_1169241124 6 Left 1169241120 20:3981925-3981947 CCTGGACAACAGGTAAAACCCCG 0: 1
1: 2
2: 50
3: 359
4: 1417
Right 1169241124 20:3981954-3981976 CGAAAAATATAAAAATTAGCTGG 0: 29
1: 5491
2: 102497
3: 85545
4: 54686
1169241120_1169241126 12 Left 1169241120 20:3981925-3981947 CCTGGACAACAGGTAAAACCCCG 0: 1
1: 2
2: 50
3: 359
4: 1417
Right 1169241126 20:3981960-3981982 ATATAAAAATTAGCTGGGTATGG 0: 90
1: 4273
2: 50911
3: 99500
4: 139944

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1169241120 Original CRISPR CGGGGTTTTACCTGTTGTCC AGG (reversed) Intronic
900200709 1:1404690-1404712 CCGGGTTTCACCTGTTAGCCAGG + Intronic
900999294 1:6140207-6140229 CTGGGTTTCACATGTTGGCCAGG - Intronic
901013911 1:6216893-6216915 AGGGTCTTTCCCTGTTGTCCAGG + Intronic
901076723 1:6559797-6559819 CGGGGTTTCACACGTTGACCAGG - Intronic
901111162 1:6797250-6797272 GGGGTTTTGCCCTGTTGTCCAGG + Intronic
901292695 1:8136608-8136630 CAGGGTTTCACATGTTGCCCAGG - Intergenic
901484721 1:9550867-9550889 AGGGTTTTGACCTGTTGGCCAGG + Intronic
901548583 1:9978163-9978185 CGGGGTTTGCCATGTTGGCCAGG - Intronic
901563868 1:10095960-10095982 CAGGGTTTCAGCTGTTGGCCAGG + Intronic
901697227 1:11017390-11017412 CAGGGTTTCACCCGTTGGCCAGG + Intronic
901745736 1:11372141-11372163 GGGGGTTCAACCTGTTGCCCAGG + Intergenic
901749832 1:11399110-11399132 CAGAGTTTCCCCTGTTGTCCAGG - Intergenic
902231490 1:15030456-15030478 CGGGGTTTCACATGTTGGCCAGG + Intronic
902262954 1:15240604-15240626 CAGGGTCTCTCCTGTTGTCCAGG - Intergenic
902312946 1:15595682-15595704 CGGGGTTTCACATGTTGGTCAGG + Intergenic
902393149 1:16117910-16117932 CTGGCTTTGGCCTGTTGTCCTGG - Intergenic
903079571 1:20798650-20798672 CGGGGTTTTACCATTTGACCAGG - Intergenic
903094743 1:20960273-20960295 CAGGGTTTCGCCTGTTGGCCAGG - Intronic
903218640 1:21856606-21856628 CAGGGTTTCACCTGTTGGCCAGG + Intronic
903403182 1:23072829-23072851 TGGGGTTTCACCTGTTGGCCAGG + Intronic
903478553 1:23637081-23637103 CGGGGTTTCACCTGTTAGCTAGG + Intronic
903511465 1:23878568-23878590 AGGGGTTTTCCATGTTGGCCAGG + Intronic
903595083 1:24487855-24487877 TGGGGTTTCACATGTTGGCCAGG - Intergenic
903598103 1:24512156-24512178 CAGGGTTTCACATGTTGGCCAGG - Intronic
903819527 1:26091359-26091381 TGGGGTTTCACATGTTGGCCAGG - Intergenic
903856783 1:26342588-26342610 CGGGGTTTCACATGTTGGCCAGG + Intronic
903867171 1:26408348-26408370 CGGGGTTTACCATGTTGGCCAGG - Intergenic
904062126 1:27719899-27719921 GGGGTTTCTCCCTGTTGTCCAGG - Intergenic
904085623 1:27905480-27905502 CGGAGTTTCACCTGTTGGCCAGG + Intronic
904162680 1:28533003-28533025 CGGGGTTTCCCCTGTTGGTCAGG + Intronic
904205712 1:28853930-28853952 AGGGTTTTTCCATGTTGTCCAGG + Intronic
904722661 1:32522260-32522282 CAGGGTTTCACATGTTGGCCAGG - Intronic
904726101 1:32549466-32549488 CGGAGTTTTACTCGTTGCCCAGG - Intronic
904794252 1:33046921-33046943 CGAGGTTTCACATGTTGGCCAGG + Intronic
905058514 1:35119804-35119826 TGGGGTTTCACCAGTTGGCCTGG - Intergenic
905164108 1:36066367-36066389 CGGGTTTTGCCATGTTGTCCAGG - Exonic
905256006 1:36685122-36685144 CGGGGCTTCACCAGTTGGCCAGG + Intergenic
905464113 1:38139901-38139923 CAGGCTTTTATCTGTTGTTCTGG + Intergenic
905575891 1:39044365-39044387 CAGGGTTTCACCAGTTGGCCAGG - Intergenic
905618552 1:39419857-39419879 CGAGGTTTCGCCTGTTGCCCAGG + Intronic
905700201 1:40007084-40007106 TGGGGTTTTGCATGTTGGCCAGG + Intergenic
905829042 1:41049576-41049598 CGGGGTTTCACCTCTTCACCAGG - Intronic
905957370 1:42009953-42009975 CAGGGTCTTACCTGTTGCCCAGG + Intronic
905996786 1:42388228-42388250 TGGAGTCTTGCCTGTTGTCCAGG + Intronic
906054597 1:42905398-42905420 CAGGGTTTCACCAGTTGGCCAGG + Intergenic
906159279 1:43635727-43635749 CGGAGTTTTTGCTGTTGCCCAGG - Intergenic
906299024 1:44668247-44668269 CGGGGTTTCACCTGTTAGCCAGG - Intronic
906302203 1:44691065-44691087 CGGGGTTTCCCTTGTTGGCCAGG - Intronic
906368454 1:45231550-45231572 CGGGGTTTCACATGTTGGCCAGG - Intronic
906399150 1:45492077-45492099 CGGGGTTTACCATGTTGCCCAGG + Intergenic
906487927 1:46246151-46246173 CGGGGTTTCACGTGTTAGCCAGG + Intergenic
907003286 1:50884321-50884343 CAGGGTTTCGCCTGTTGGCCAGG - Intronic
907079090 1:51604841-51604863 CGGGGTTTCACATGTTGGTCAGG + Intronic
907084848 1:51662025-51662047 CTGGATTATTCCTGTTGTCCTGG - Intronic
907105908 1:51882378-51882400 CGGGTTTTGACATGTTGGCCAGG - Intergenic
907131985 1:52105250-52105272 TGGGGTTTCACATGTTGGCCAGG - Intergenic
907149830 1:52273635-52273657 TGGGGTTTCACCTGTTAGCCAGG - Intronic
907213800 1:52844966-52844988 CGGTGGTTTCCCTATTGTCCAGG + Intronic
907449241 1:54532539-54532561 CGGGGTTTCACGTGTTAGCCAGG - Intergenic
907481196 1:54746625-54746647 TGGGGTCTTGCCTGTTGCCCAGG + Intergenic
907484723 1:54769379-54769401 CGGGGTTTCACATGTTGTCTAGG + Intergenic
907769057 1:57441543-57441565 GGGGCTTTTCCATGTTGTCCAGG + Intronic
907862704 1:58368834-58368856 TGGGGTTTCCCATGTTGTCCAGG - Intronic
908701263 1:66903684-66903706 CGGGGTTTCACCATTTGGCCAGG + Intronic
908891535 1:68854347-68854369 CAGGGTTTCACCAGTTGCCCAGG + Intergenic
909031440 1:70545780-70545802 CGGGGTCTCACATGTTGGCCAGG + Intergenic
909310883 1:74147201-74147223 CAGAGTCTTACCTGTAGTCCAGG - Intronic
909386358 1:75061589-75061611 CAGGGTTTTGCATGTTGGCCAGG + Intergenic
909470719 1:76024834-76024856 AGGGGTTTTGCATGTTGGCCAGG - Intergenic
909787204 1:79629301-79629323 CGGGGTTTCACATGTTAGCCAGG - Intergenic
910245707 1:85136089-85136111 CAGGGTTTCACATGTTGGCCAGG + Intergenic
910248266 1:85166147-85166169 CGGGGTTTCCCATGTTGACCAGG - Intronic
910367165 1:86478232-86478254 CGGAGTTTTCCATGTTGGCCAGG - Intronic
910880378 1:91917768-91917790 CGGCGTTTCACCTGTTAGCCAGG + Intergenic
911374588 1:97036483-97036505 CGGGGTTTCACATGTTGGCCAGG - Intergenic
911404176 1:97415511-97415533 TGGGGTTTCACATGTTGGCCAGG + Intronic
911652600 1:100406730-100406752 CGGGGTTTTACCACTTGGCCAGG - Intronic
912046990 1:105471122-105471144 CGGAGTTTCACATGTTGGCCAGG + Intergenic
912351561 1:109018876-109018898 TGGGGTTTTGCATGTTGCCCAGG - Intronic
912699538 1:111866661-111866683 CGAGGTGTGACCTGTAGTCCTGG + Intronic
912782603 1:112565823-112565845 TGGGGTTTTGCCATTTGTCCAGG - Intronic
913020166 1:114781155-114781177 CGGGGTTTCACATGTTGGCCAGG + Intergenic
913069635 1:115286969-115286991 CCGGGTTACGCCTGTTGTCCCGG - Intronic
913293580 1:117297475-117297497 CGGAGTTTTGCTTGTTGCCCAGG - Intergenic
913400862 1:118431442-118431464 TGAGGTTTCACCTGTTGGCCAGG - Intergenic
914000635 1:143691738-143691760 CGGCGATTTCCCTGTGGTCCGGG - Intergenic
914260115 1:145991847-145991869 CGGGTTTTGCCATGTTGTCCAGG - Intergenic
914646924 1:149661466-149661488 AGGGTTTCTCCCTGTTGTCCAGG + Intergenic
914761906 1:150605828-150605850 CGGGGTTTCACCATTTGGCCAGG + Intronic
914856847 1:151358520-151358542 TGGGGTTTCACATGTTGACCAGG + Intergenic
915025073 1:152820461-152820483 CAGGATTTTGCCTGTTGTCCAGG + Intergenic
915144078 1:153784358-153784380 CGGGGTTTCACTTGTTAGCCAGG + Intergenic
915266837 1:154725045-154725067 CGGGGTTTCACATGTTGGCCAGG + Intronic
915377488 1:155409972-155409994 CGGGGTTTCACATATTGGCCAGG - Intronic
915460380 1:156067040-156067062 CGGGGGTTTCACTGTTGGCCAGG - Intronic
915474117 1:156142773-156142795 CGGGGTTTCGCATGTTGGCCAGG + Intergenic
915577782 1:156792090-156792112 CGGGGTCTTGCTTGTTGTCCAGG + Intronic
915831445 1:159134638-159134660 CGGGTTTCACCCTGTTGTCCAGG - Intronic
915890009 1:159764390-159764412 CGGAGTTTCACATGTTGGCCAGG + Intergenic
916038496 1:160942453-160942475 TGGGGTTTCACCAGTTGGCCAGG + Intergenic
916073304 1:161184825-161184847 CGGGGTTTTCCATGTTGCCCAGG - Exonic
918352983 1:183677093-183677115 CTAGTTTTTACCTATTGTCCTGG + Intronic
918436813 1:184522877-184522899 CAGGGTTTTGCCAGTTGTCCAGG + Intronic
918490853 1:185079736-185079758 CGGGGTTTGCCATGTTGGCCAGG - Intronic
918535344 1:185567953-185567975 CAGGGTTTCACATGTTGTCCAGG - Intergenic
918839888 1:189521095-189521117 CGGGGTTTCACGTGTTAGCCAGG - Intergenic
919104811 1:193136061-193136083 CAGGGTTTTCCGTGTTGGCCAGG + Intronic
919116090 1:193282532-193282554 CTGGGTTTCACCTGTTGGCCAGG + Intergenic
919445760 1:197703176-197703198 CAGGGTTTCACCAGTTGGCCAGG + Intronic
919534324 1:198767956-198767978 CTGTGTTTTACCTTTTGGCCAGG + Intergenic
919759082 1:201085701-201085723 CGGGGTGTTGCCTGGGGTCCAGG + Intronic
919862019 1:201746017-201746039 CGGGTTTTGCCGTGTTGTCCAGG + Intronic
920141469 1:203817938-203817960 CAGGGTTTCACGTGTTGGCCAGG + Intronic
920155093 1:203942807-203942829 CGGGGTTTCACCTGTTAGCCAGG - Intergenic
920342124 1:205281951-205281973 TGGGGTTTCACCAGTTGGCCAGG - Intergenic
920391474 1:205605857-205605879 CAGGGTTTCACCTGTTGGTCAGG + Intronic
920402400 1:205684397-205684419 TGGGGTTTCACCTGTTAGCCAGG + Intergenic
920532447 1:206713673-206713695 CGGGGTTTCACATGTTGGCCAGG - Intronic
920630463 1:207646517-207646539 GGGGTTTTGACATGTTGTCCAGG - Intronic
921002476 1:211057442-211057464 TGGGGTTTTGCATGTTGCCCAGG - Intronic
921035972 1:211378517-211378539 CGAGGTTTCACCTGTTGGCCAGG - Intergenic
921063020 1:211601892-211601914 CAGGGTTTCACATGTTGGCCAGG + Intergenic
921072837 1:211676163-211676185 CGAGGTTTGCCCTGTTGCCCAGG - Intergenic
921820005 1:219606421-219606443 CAGGGTTTCACTTGTTGGCCAGG - Intergenic
921838086 1:219798884-219798906 CAGGGTTTTGCCATTTGTCCAGG - Intronic
921841661 1:219835187-219835209 TGGGGTTTCACCTGTTGGCCGGG + Intronic
922142378 1:222901716-222901738 CGGGGTTTCACCAATTGGCCAGG + Intronic
922282700 1:224141277-224141299 CAGGGTTTCACCTGTTAGCCAGG - Intronic
922285585 1:224167961-224167983 TGGGGTTTCACATGTTGGCCAGG - Intergenic
922402348 1:225273237-225273259 CGGGGTTTCACGTGTTAGCCAGG - Intronic
922439107 1:225637396-225637418 CGGGGTTTCACCAGTTAGCCAGG + Intronic
922484755 1:225964980-225965002 CGGGGTTTGCCATGTTGACCAGG - Intergenic
922508208 1:226139634-226139656 CAGGGTTTCACATGTTGGCCAGG - Intergenic
922543994 1:226441554-226441576 TGGGGTTTCACATGTTGGCCAGG + Intergenic
922863229 1:228837389-228837411 CGGGATTTCACATGTTGCCCAGG - Intergenic
922918961 1:229284288-229284310 CGGGGGTTTCGCTGTTGGCCGGG + Intronic
923068699 1:230543391-230543413 CAGGGTTTCACCTGTTGGCCAGG - Intergenic
923130117 1:231067739-231067761 AGGGTTTTTCCATGTTGTCCAGG + Intergenic
923215498 1:231844731-231844753 CGGGGTTTCACGTGTTAGCCAGG - Intronic
923273272 1:232376155-232376177 CGGGATTTCACCTCTTGGCCAGG - Intergenic
923450504 1:234112766-234112788 CAGGGTTTCACCTGTTAGCCAGG + Intronic
923452714 1:234134910-234134932 CGGGGTTTAGCTTGTTGGCCAGG + Intronic
923551461 1:234967702-234967724 CGAGGTTTCACATGTTGGCCAGG - Intergenic
923587190 1:235284167-235284189 TGGGGTTTCACATGTTGGCCAGG - Intronic
923645450 1:235815937-235815959 TGGGGTTTCACCAGTTGGCCGGG - Intronic
923675651 1:236078724-236078746 CCGGGTTTGGCCTGTTGGCCAGG - Intergenic
923694400 1:236233116-236233138 CAGGGTTTCACATGTTGGCCAGG - Intronic
923701792 1:236306817-236306839 CGAGGTTTGACATGTTGGCCAGG + Intergenic
923774691 1:236967916-236967938 TGGGGTTTCACCAGTTGGCCAGG + Intergenic
924094319 1:240535606-240535628 CAGGGTTTCACCAGTTGGCCAGG - Intronic
924096014 1:240551537-240551559 CGGGGTTTCACATGTTGGCCAGG + Intronic
924418960 1:243889328-243889350 CAGGGTTTCACCTGTTGGCCAGG - Intergenic
924518538 1:244786184-244786206 GGGGGTTTTTCATGTTGCCCAGG - Intergenic
924532582 1:244905774-244905796 TGGGGTTTTGCATGTTGCCCAGG - Intergenic
924725328 1:246664378-246664400 CTGGTTTACACCTGTTGTCCCGG + Intronic
1063423448 10:5932905-5932927 CGGGGTTTTGTCTGTTTCCCAGG + Intronic
1063467975 10:6260218-6260240 CGGGGTTTCACGTGTTAGCCAGG - Intergenic
1064044868 10:12003897-12003919 CGGAGTTTTTGCTCTTGTCCAGG - Intronic
1064052917 10:12073535-12073557 CAGGGTTTCACATGTTGGCCAGG + Intronic
1064255802 10:13742045-13742067 TGGGGTTTTGCATGTTGGCCAGG + Intronic
1064640274 10:17408471-17408493 CGGGGTTTCACATGTTGGCCAGG - Intronic
1064662719 10:17622585-17622607 CGGGGTTTCCCATGTTGGCCAGG - Intergenic
1064689004 10:17894588-17894610 TGGGGTTTTCCATGTTGCCCAGG + Intronic
1064707206 10:18085501-18085523 CAGGGTTTCACATGTTGCCCAGG + Intergenic
1064758535 10:18594640-18594662 TGGGGTTTCACATGTTGGCCTGG + Intronic
1065027264 10:21550721-21550743 GGGGGTTTCACATGTTGCCCAGG + Intronic
1065170941 10:23028116-23028138 CAGGGTTTCACTTGTTGCCCAGG - Intronic
1065200297 10:23306330-23306352 CAGGGTTTCACATGTTGGCCAGG - Intronic
1065387883 10:25151469-25151491 TGGGGTTTTCCATGTTGGCCAGG + Intergenic
1065389161 10:25164518-25164540 CGGGGTTTCACGTGTTAGCCAGG + Intergenic
1065432628 10:25674713-25674735 TGGGGTTTCACATGTTGGCCAGG - Intergenic
1065552531 10:26883547-26883569 CATGGTCTTACCTGTTGCCCAGG - Intergenic
1065614936 10:27511395-27511417 CGGGGTTTACCATGTTGGCCAGG + Intronic
1065686608 10:28291412-28291434 CGGCGTTTGCCATGTTGTCCAGG - Intronic
1065719550 10:28613174-28613196 CCGGGTTTTGCCTGTTGGCCAGG - Intronic
1065740109 10:28789950-28789972 CTGGGTTGTGCCTGTTATCCTGG - Intergenic
1065807508 10:29408636-29408658 CGGGGTTTCACATGTTAGCCAGG + Intergenic
1065922787 10:30407823-30407845 TGGGGTTTCACCAGTTGGCCAGG - Intergenic
1065995767 10:31057824-31057846 TGGGGTTTCACATGTTGGCCAGG + Intergenic
1066143291 10:32529211-32529233 TGGGGTTTCACATGTTGGCCAGG + Intronic
1066201224 10:33144091-33144113 CGGGGTTTACCATGTTGGCCAGG - Intergenic
1066269174 10:33805383-33805405 CGGGGTTTGTCATGTTGGCCAGG + Intergenic
1066303565 10:34117718-34117740 AGGGGTTTGCCATGTTGTCCAGG - Intronic
1066324547 10:34344471-34344493 CAGGGTTTCACATGTTGGCCAGG + Intronic
1066348998 10:34619239-34619261 CGGGGTTTCACGTGTTGGCCAGG + Intronic
1066396521 10:35029246-35029268 CGGGTTTTCACATGTTGGCCAGG + Intronic
1066418519 10:35243028-35243050 CGGGGTTTCATCTGTTGGCCAGG - Intergenic
1066576561 10:36832268-36832290 CGGGGTTTCACATGTTGGCCAGG - Intergenic
1066581035 10:36882496-36882518 CAGGGTCTTACATGTTGCCCAGG - Intergenic
1066687022 10:37991190-37991212 CGGGGTTTAGCATGTTGGCCAGG + Intergenic
1066708688 10:38208987-38209009 CAGGGTCTCACCTGTTGCCCAGG - Intergenic
1067099463 10:43323983-43324005 CGGGGTTTCACATGTTAGCCAGG + Intergenic
1067100126 10:43328990-43329012 CAGGGTTTCCCCTGTTGACCGGG + Intergenic
1067857120 10:49804091-49804113 CAAGGTTTTATGTGTTGTCCAGG + Intergenic
1068200752 10:53781395-53781417 CGGGGTTTCACCTGTTAGCCAGG + Intergenic
1068430030 10:56919682-56919704 CAGGGTTTCACATGTTGGCCAGG - Intergenic
1068535473 10:58236711-58236733 GAGGGTTTCACCAGTTGTCCAGG - Intronic
1068653991 10:59555712-59555734 CGGGGTTTCACGTGTTAGCCAGG - Intergenic
1068755454 10:60648036-60648058 TGGGGTTTCACATGTTGGCCAGG + Intronic
1068894040 10:62179925-62179947 CGGGGTTTTCCATGTTGGCTAGG + Intergenic
1069003401 10:63291421-63291443 CGGGGTTTTACATGTTGGCCAGG - Intronic
1069105437 10:64378164-64378186 TGGGGTTTCACATGTTGGCCAGG + Intergenic
1069169103 10:65202772-65202794 CGGGGTTTCATGTGTTGGCCAGG + Intergenic
1069313913 10:67074221-67074243 CGGGGTTTCACCATTTGGCCAGG + Intronic
1069671527 10:70208983-70209005 AGGGTTTTTCCATGTTGTCCAGG + Intronic
1069761994 10:70817208-70817230 CGGGGTTCTCCATGTTGGCCAGG + Intronic
1069767572 10:70874531-70874553 CGGGGTTCTCCCTGTTGGTCAGG - Intronic
1069889064 10:71641885-71641907 CGGGTTTTCGCCTGTTGGCCAGG - Intronic
1069946441 10:71989249-71989271 AGGGTCTTTCCCTGTTGTCCAGG - Intronic
1070021633 10:72592198-72592220 CGGGGTTTCACATGTTGGTCAGG + Intronic
1070024959 10:72623648-72623670 TGGGGTTTTACATGTTGGCCAGG - Intronic
1070100808 10:73384590-73384612 TGGGGTTTCACATGTTGGCCAGG + Intronic
1070180602 10:74009798-74009820 CGGGGTTTCACCTATTGGCCAGG + Intronic
1070223815 10:74479187-74479209 CGTGGTTTCACCAGTTGCCCAGG + Intronic
1070245504 10:74727922-74727944 CGGGGTTTGCCATGTTGCCCAGG - Intergenic
1070262426 10:74870766-74870788 CGGGGTTTTCCATGTTGGTCAGG + Intronic
1070319873 10:75346631-75346653 GGGGTTTTGACCTGTTGCCCAGG + Intergenic
1070903302 10:80049709-80049731 CAGGGTTTCACCAGTTGGCCAGG - Intergenic
1071028324 10:81141556-81141578 CGGGGTTTCGCCTGTTGACCAGG + Intergenic
1071310941 10:84343062-84343084 CGGGGTTTACCATGTTGGCCAGG + Intronic
1071541621 10:86490021-86490043 TGGGGTTTCACCTGTTTGCCAGG - Intronic
1071547991 10:86543102-86543124 CAGGGTTTCACCAGTTGGCCAGG - Intergenic
1071629695 10:87208380-87208402 TGGGGTTTCACATGTTGGCCAGG + Intergenic
1071687954 10:87781834-87781856 TGGGGTCTTACATGTTGTCCAGG + Intronic
1071770435 10:88723074-88723096 CAGGGTTTTCCGTGTTGCCCAGG + Intergenic
1072109498 10:92305213-92305235 CGGGGTTTCACTTGTTAGCCAGG - Intronic
1072210010 10:93237938-93237960 TGGGGTTTCACCTGCTGGCCAGG - Intergenic
1072222618 10:93339658-93339680 CAGGGTTTTGCATGTTGGCCAGG + Intronic
1072412581 10:95217154-95217176 CAGGGTTTCACATGTTGGCCAGG - Intronic
1072655802 10:97329618-97329640 CGGGTTTTGCCATGTTGTCCAGG - Intergenic
1072764553 10:98084878-98084900 CGGGGTTTCACCTCTTAGCCAGG + Intergenic
1072920537 10:99573230-99573252 CGGGGTTTCACCATTTGGCCAGG - Intergenic
1072938918 10:99741588-99741610 CAGGGTCTCACCTGTTGTCCAGG + Intronic
1072977235 10:100069288-100069310 CGGGGTTTCACCGTTTGACCAGG - Intronic
1073066672 10:100764333-100764355 CAGGGTTTCACCTGTTAGCCAGG + Intronic
1073342498 10:102756217-102756239 CGAGGTTTCACATGTTGGCCAGG - Intronic
1073372693 10:103005104-103005126 GGGGTTTTTCCCTGTTGGCCAGG + Intronic
1073390079 10:103167820-103167842 CGGGGTTTGCCATGTTGCCCAGG + Intronic
1073481763 10:103790345-103790367 CGGGGTTTCACGTGTTAGCCAGG + Intronic
1073521651 10:104136559-104136581 CGGGGTTTCACATCTTGGCCAGG + Intronic
1073636871 10:105208148-105208170 CGGGGTTTTGCCGTTTGGCCAGG - Intronic
1073742580 10:106425444-106425466 CCTGTTTTTACCTTTTGTCCCGG - Intergenic
1074368764 10:112881817-112881839 CGGGGTTTCACATATTGGCCAGG + Intergenic
1074638412 10:115348162-115348184 TGGGGTTTCACATGTTGGCCAGG + Intronic
1074896693 10:117783528-117783550 CGGGGTTTCACTAGTTGGCCAGG + Intergenic
1075148642 10:119906082-119906104 GGGGTTTTTCCATGTTGTCCAGG - Intronic
1075370281 10:121929158-121929180 CGGGGTTTCACGTGTTAGCCAGG - Intergenic
1075720758 10:124585973-124585995 CGGGGTTTTCCATGTTGGCCAGG + Intronic
1077001161 11:323158-323180 CGGGGTTTCACGTGTTAGCCAGG + Intronic
1077564005 11:3284707-3284729 CGGGGTTTCACATGTTGGCAAGG - Intergenic
1077569895 11:3330524-3330546 CGGGGTTTCACATGTTGGCAAGG - Intergenic
1078162421 11:8853170-8853192 CGGGGTTTACCATGTTGGCCAGG - Intronic
1078217407 11:9323199-9323221 CGGGGTTTCACCAGTTGGCCAGG + Intergenic
1078768252 11:14320987-14321009 CGGGGTTTACCATGTTGGCCAGG - Intronic
1078793124 11:14564968-14564990 TGGGGTCTTACTTTTTGTCCAGG + Intronic
1079006599 11:16795596-16795618 TGGGGTTTCACATGTTGGCCAGG - Intronic
1079033894 11:17006177-17006199 CGGGGTTTCACATGTTGGTCAGG - Intronic
1080086653 11:28291235-28291257 CGGAGTTTCACATGTTGTCCAGG + Intronic
1080629420 11:34060002-34060024 CGGGGTTTCACAGGTTGGCCAGG - Intronic
1080831629 11:35898682-35898704 TGGGGTTTCACATGTTGCCCAGG + Intergenic
1081230240 11:40577426-40577448 CTGGTTTATACCTGTTATCCTGG - Intronic
1081315860 11:41629020-41629042 TGGGGTTTCACCTGTTGGCCAGG - Intergenic
1081535346 11:43992242-43992264 CCGGGTTTTGCATGTTGCCCAGG + Intergenic
1081815655 11:45939023-45939045 CGGGGTTTCACGTGTTAGCCAGG + Intronic
1081903345 11:46648583-46648605 CGGGGTTTCACATGTTAGCCAGG - Intronic
1081928226 11:46848423-46848445 CGGGGTTTCACCTGTTGGCCAGG + Intergenic
1082032346 11:47614490-47614512 CGGAGTTTTGCTTGTTGCCCAGG + Intergenic
1082761711 11:57133074-57133096 TGGGGTTTCACATGTTGGCCAGG - Intergenic
1082851831 11:57772121-57772143 AGGGTTTTTCCCTGTTGCCCAGG + Intronic
1083028764 11:59572974-59572996 TGGCGTTTCACCTGTTGGCCAGG - Intergenic
1083162077 11:60860635-60860657 TGGGGTTTTGCCTGTTGGCCAGG - Intergenic
1083376843 11:62230386-62230408 TGGGGTTTGCCATGTTGTCCAGG - Intergenic
1083387244 11:62320704-62320726 TGGGGTTTTTCATGTTGGCCAGG - Intergenic
1083390790 11:62348510-62348532 CGGGGTTTCGCATGTTGGCCAGG - Intronic
1083391614 11:62355415-62355437 CGGGGTTTCACATGTTAGCCAGG + Intronic
1083444557 11:62699094-62699116 CGGGGTTTCACCAGTTGGCCAGG + Intronic
1083473030 11:62897048-62897070 CGGGGTTTCACCTGTTGGTCAGG + Intergenic
1083837028 11:65276979-65277001 CGAGGTTTCGCCTGTTGGCCAGG + Intronic
1083857012 11:65398188-65398210 CGGGGTTTTGCCTGTTGGCCAGG + Intronic
1083858735 11:65407695-65407717 CAGGGTTTCACCTGTTAGCCAGG - Intronic
1083957012 11:65989663-65989685 CAGGGTTTCACCAGTTGGCCGGG + Intergenic
1083973228 11:66096122-66096144 CGGGGTTTTGCCAATTGCCCAGG + Intronic
1083987960 11:66229182-66229204 CGGGTTTTTCCATGTTGCCCGGG - Intronic
1084144921 11:67260037-67260059 CGGGTTTTGACATGTTGACCAGG - Intergenic
1084185737 11:67469871-67469893 CGGGGTTTCGCCTTTTGGCCAGG - Intergenic
1084222592 11:67693152-67693174 CGGGGTTTCACGTGTTAGCCAGG - Intergenic
1084292440 11:68182925-68182947 CGGGGTTTTCCATGTTGGTCAGG + Intronic
1084623499 11:70290390-70290412 CCGGTTTTTGCCTGTTATCCTGG + Intronic
1084626790 11:70313832-70313854 GGGGGTTTGTCATGTTGTCCAGG - Intronic
1084727432 11:70950858-70950880 TGGGGTTTTGCATGTTGGCCAGG + Intronic
1084848580 11:71920149-71920171 CGGGGTTTCACGTGTTAGCCAGG + Intronic
1084917153 11:72437339-72437361 CGGGGTTTTACATGTTGGTCAGG + Intergenic
1085171814 11:74456122-74456144 CAGGGTTTCACATGTTGCCCAGG - Exonic
1085183653 11:74557287-74557309 CGGGGTTTCACGTGTTTGCCAGG - Intronic
1085203446 11:74715785-74715807 CGGGTTTTACCATGTTGTCCAGG - Intronic
1085246266 11:75104045-75104067 TGGGGTTTTGCATGTTGCCCAGG - Intronic
1085301339 11:75460635-75460657 GGGGTTTTTTCATGTTGTCCAGG + Intronic
1085316203 11:75546567-75546589 CAGGGTTTCACCAGTTGCCCAGG - Intergenic
1085398834 11:76222977-76222999 CGGGGTTTGCCATGTTGGCCAGG + Intergenic
1085584951 11:77693496-77693518 CGGGGTCTTACATGTTGGCAAGG + Exonic
1085822740 11:79810458-79810480 CGGGGTTTCACCTGTTGGCCAGG - Intergenic
1086100189 11:83091353-83091375 CGGGGTTTGTCGTGTTGGCCAGG - Intergenic
1086108214 11:83169570-83169592 CTGGGTTGAACCTGCTGTCCAGG - Exonic
1086341412 11:85852565-85852587 CGGGGTTTCACGTGTTGGCTGGG + Intergenic
1086579286 11:88378770-88378792 CGGGGTTTCACCTTTTGCTCAGG - Intergenic
1087068371 11:94048927-94048949 TGGGGTTTCGCCTGTTGGCCAGG - Intronic
1087286910 11:96274273-96274295 CGGGGTTTCACGTGTTAGCCAGG + Intronic
1087295135 11:96363145-96363167 CGGGGTTTCACGTGTTAGCCAGG + Intronic
1087651257 11:100871352-100871374 GGGGGTTTCACCAGTTGGCCAGG - Intronic
1087877258 11:103373124-103373146 AGGGTTTTTCCATGTTGTCCAGG + Intronic
1088261923 11:107952388-107952410 CGGAGTTTCACATGTTGGCCAGG - Intronic
1088283775 11:108164818-108164840 CGGGGTTCTCCGTGTTGGCCAGG - Intronic
1088646618 11:111922021-111922043 CGGGGTTTCACCTGTTGGCCAGG + Intronic
1088684267 11:112271893-112271915 AGGGTTTTTTCCTGTTGCCCAGG + Intergenic
1088873196 11:113910629-113910651 CGGGGTTTCACCTGTTGGACAGG + Intronic
1089011322 11:115134328-115134350 CGGGGTTTTGCTTGTTGCCCAGG - Intergenic
1089037939 11:115415643-115415665 CTGGGTTTTGCATGTTGGCCAGG - Intronic
1089075145 11:115732616-115732638 TGGGGTTTTGCATGTTGCCCAGG + Intergenic
1089541624 11:119192835-119192857 CGGGGTTTTGCCATTTGGCCAGG + Intronic
1089825518 11:121272526-121272548 TGGGGTTTCAAATGTTGTCCAGG - Intergenic
1089963433 11:122636020-122636042 TGGGGTTTCACCAGTTGGCCAGG - Intergenic
1089975259 11:122726538-122726560 CGGGGTTTCACATGTTGGCCAGG + Intronic
1089980263 11:122766351-122766373 CGGGGTTTCACCTGTTAGCCAGG - Intronic
1090323734 11:125867128-125867150 TGGGGTTTCACCTATTGGCCAGG - Intergenic
1090433474 11:126666278-126666300 TTGGGTTTTACCTCCTGTCCAGG + Intronic
1091015389 11:132046596-132046618 CAGGCTTTCACCTGTTCTCCTGG + Intronic
1091091566 11:132776118-132776140 CAGGGTTTCACATGTTGGCCAGG + Intronic
1091495124 12:965875-965897 CAGGGTTTCGCCTGTTGGCCAGG + Intronic
1091535237 12:1401125-1401147 CGGGGTTTCACGTGTTAGCCAGG + Intronic
1091573039 12:1707498-1707520 CAGGGTCTTGTCTGTTGTCCAGG + Intronic
1091599786 12:1911212-1911234 CAGGGTTTCACGTGTTGGCCAGG + Intronic
1091961943 12:4703134-4703156 TGGGGTTTTATCTGTAGTCCCGG - Intronic
1092130127 12:6105417-6105439 TGGGGTTTCACATGTTGGCCAGG + Intronic
1092486323 12:8905349-8905371 CGGGGTTTCACCAGTTGGCTAGG + Intergenic
1092797719 12:12129741-12129763 CGGGGTTTCACATGTTGGCCAGG + Intronic
1093051525 12:14510198-14510220 CGGGGTTTCACCAGTTGGCCAGG - Intronic
1093073583 12:14733563-14733585 TGGGGTTTCACATGTTGGCCAGG + Intergenic
1093308892 12:17553731-17553753 CGAGGTTTTTCATGTTGGCCAGG - Intergenic
1093515730 12:19984626-19984648 GGGGTTTTTCCCTGTTGCCCAGG - Intergenic
1093612869 12:21183385-21183407 CAGGGTTTTCCATGTTGCCCAGG + Intronic
1093650160 12:21634130-21634152 TGGGGTTTCACATGTTGGCCAGG + Intergenic
1094466555 12:30759710-30759732 CGGGGTTTCACCTGTTGGCCAGG - Intergenic
1094534736 12:31311058-31311080 TGGGGTTTCACCAGTTGGCCAGG + Intronic
1094607711 12:31963170-31963192 TGGGGTTTCACCTGTTAGCCAGG - Intronic
1094672613 12:32585641-32585663 TGGGGTTTTGCCCGTTGCCCAGG - Intronic
1095046977 12:37517715-37517737 CGGGGTTTTACATGTTGGTCAGG - Intergenic
1095158787 12:38891120-38891142 GGGGTTTTACCCTGTTGTCCAGG + Intronic
1095349542 12:41191972-41191994 CAGGGTTTCACATGTTGGCCAGG + Intronic
1095396038 12:41763479-41763501 CGGGGTCTTACATATTGTCCAGG + Intergenic
1095678192 12:44944256-44944278 TGGGGTTTTACCATTTGGCCAGG - Intergenic
1095816768 12:46431286-46431308 TGGGGTTTTCCATGTTGGCCAGG + Intergenic
1096128816 12:49140714-49140736 CGGGGTTTCACATGTTGGTCAGG - Intergenic
1096158952 12:49360595-49360617 CGGGGTTTCACATGTTGGCCAGG - Intergenic
1096221765 12:49834097-49834119 CGGGGTTTCACATGTAGGCCAGG - Intergenic
1096315628 12:50562541-50562563 AGGGGTTTTGCATGTTGCCCAGG - Intronic
1096332690 12:50728187-50728209 CGGGGTTTTCCATGTTGTTCAGG - Intronic
1096407363 12:51353773-51353795 CAGAGTCTTACCTGTTGCCCAGG + Exonic
1096528431 12:52228201-52228223 TGGGGTTTTCCATGTTGCCCAGG + Intergenic
1096596129 12:52696647-52696669 CTGGGTTTTCCATGTTGGCCCGG - Intronic
1096668647 12:53184377-53184399 CAAGGTTTCACCTATTGTCCAGG + Intronic
1096746366 12:53730215-53730237 TGGGGTTTCACCAGTTGGCCAGG - Intergenic
1097097399 12:56560443-56560465 CAGGGTTTCACCTGTTGCCCAGG + Intronic
1097099250 12:56575235-56575257 TGGGGTTTCACATGTTGCCCAGG - Intronic
1097209877 12:57359106-57359128 CGAGGTTTCACATGTTGGCCAGG + Intronic
1097507213 12:60489635-60489657 AGGGTTTATAACTGTTGTCCTGG + Intergenic
1097764617 12:63511483-63511505 TGGGGTTTCACCTGTTGGCCAGG + Intergenic
1097880293 12:64680564-64680586 TGGGGTTTTACCTGCTTTTCTGG + Intronic
1097895657 12:64822699-64822721 GGGGGTTTGCCATGTTGTCCAGG + Intronic
1098030184 12:66245721-66245743 CGGGGTTTCACATGTTGGCCAGG + Intronic
1098321103 12:69244413-69244435 CGAGGTTTCACATGTTGGCCAGG + Intronic
1098349798 12:69546582-69546604 GGGGTTTTACCCTGTTGTCCAGG + Intronic
1098367332 12:69718689-69718711 CTGGTTTACACCTGTTGTCCTGG + Intergenic
1098417723 12:70254787-70254809 CAGGGTTTTCCATGTTGGCCAGG - Intronic
1098443519 12:70542692-70542714 CAGGGTTTCACGTGTTGGCCAGG - Intronic
1098483572 12:70995018-70995040 CGGGTTTTTCCATGTTGTCCAGG - Intergenic
1099468281 12:83014528-83014550 CAGGGTTTCACATGTTGCCCAGG + Intronic
1099476031 12:83108436-83108458 GGGGGTTTGACATGTTGGCCAGG - Intronic
1099702453 12:86104229-86104251 CGGAGTTTTGCATGTTGCCCAGG - Intronic
1099895560 12:88642421-88642443 CGGGGTTTCACGTGTTAGCCAGG - Intergenic
1100034316 12:90232751-90232773 CGGGGTTTCACGTGTTAGCCAGG + Intergenic
1100040537 12:90312287-90312309 CAGAGTCTTGCCTGTTGTCCAGG + Intergenic
1100555698 12:95691584-95691606 CGGGGTTTTGCCAGTTGGTCAGG + Intronic
1100640959 12:96481957-96481979 TGGGGTTTCACATGTTGGCCAGG + Intergenic
1100829947 12:98508665-98508687 CGGAGTTTTGCTCGTTGTCCAGG + Intergenic
1100968463 12:100040488-100040510 TGGGGTTTCACATGTTGGCCAGG - Intronic
1100986441 12:100206285-100206307 CGGGGTTTCACCAGTTGGCCAGG - Intronic
1101108620 12:101463804-101463826 CGGGGTTTTACCTGTTGGCCAGG + Intergenic
1101116910 12:101541028-101541050 TGGGGTTTTGCCTGTTGTCCAGG + Intergenic
1101172309 12:102110649-102110671 CAGGGATTTGCCTGTTGCCCAGG - Intronic
1101373783 12:104153386-104153408 TGGGGTTTCACATGTTGGCCAGG - Intergenic
1101777035 12:107805309-107805331 CAGGGTTTTACCAATTGGCCAGG - Intergenic
1102020711 12:109680296-109680318 TGGGGTTTGCCATGTTGTCCAGG - Intergenic
1102044219 12:109819751-109819773 CGGGGTTTCACATGTTGGCCAGG + Intronic
1102075164 12:110053890-110053912 AGGGTTTTGTCCTGTTGTCCAGG - Intronic
1102086432 12:110144699-110144721 CGGGGTTTTGCCATTTGTCCAGG + Intronic
1102087865 12:110158779-110158801 CAGGGTTTCACCTGTTAGCCAGG + Intronic
1102110693 12:110363789-110363811 TGGGGTTTAACATGTTGCCCAGG - Intergenic
1102229829 12:111255026-111255048 CGGGGTTTCACATGTTGGCCAGG + Intronic
1102242315 12:111332322-111332344 CGGGGTTTCACCATTTGGCCAGG + Intronic
1102266190 12:111487648-111487670 CAGGGTTTCACATGTTGGCCAGG + Intronic
1102276900 12:111589439-111589461 AGAGATTTTACCTGTTGCCCAGG - Intronic
1102313594 12:111867121-111867143 TGGGGTTTTGCATGTTGCCCAGG + Intronic
1102351783 12:112198024-112198046 TGGGGTTTCACCTGTTGGCCAGG + Intronic
1102719090 12:115001177-115001199 CGGGGTTTACCATGTTGGCCGGG + Intergenic
1102953964 12:117047613-117047635 CAGGGTTTCACCAGTTGGCCAGG + Intronic
1103417656 12:120754417-120754439 CGGGGTTTCACGTGTTAGCCAGG + Intergenic
1103429796 12:120873679-120873701 CGGGGTTTCACATGTTGGTCAGG - Intronic
1103485778 12:121281754-121281776 CGGGGTTTCACCATTTGGCCAGG - Intronic
1103638749 12:122331202-122331224 CGGGGTTTTCCATGTTGGTCAGG + Intronic
1103781709 12:123403094-123403116 CAGGGTTTTACCTATTTGCCAGG + Intronic
1103998555 12:124845499-124845521 CGGGGTTTCACATGTTGGCCAGG - Intronic
1104033856 12:125084771-125084793 CGAGGTTTTACCAGTTGTCCAGG + Intronic
1104324432 12:127783031-127783053 CGGGGTTCTCCATGTTGGCCAGG + Intergenic
1104597160 12:130127799-130127821 CGGGGTTTTACATTTTTTCCGGG - Intergenic
1104861148 12:131924461-131924483 CGGGGTTTCACATGTTGGCCAGG + Intergenic
1105046668 12:133009399-133009421 TGGGGTTTCACTTGTTGGCCAGG - Intronic
1105408819 13:20152573-20152595 CAGGGTTTTGGCTGTTGACCAGG + Intronic
1105479626 13:20762378-20762400 TGGGGTTTCACATGTTGGCCAGG + Intronic
1105505690 13:21007948-21007970 CAGGGTTTGCCATGTTGTCCAGG + Intronic
1105618909 13:22048038-22048060 CACGGTTTTTCGTGTTGTCCAGG - Intergenic
1105684573 13:22766688-22766710 CGGGGTTTCTCCTGTTGGTCAGG + Intergenic
1105865727 13:24457578-24457600 CGGGGTTTCCCATGTTGGCCAGG - Intronic
1106241130 13:27914631-27914653 CAGGGTTTTTCCTGTTGGCCAGG - Intergenic
1107055578 13:36100149-36100171 AGGGTTTTGCCCTGTTGTCCAGG - Intronic
1107177044 13:37411087-37411109 CGGGGTTTCACATGATGACCAGG - Intergenic
1107446888 13:40477696-40477718 CGGGTTTTCACATGTTGCCCAGG + Intergenic
1107515672 13:41126334-41126356 CAGGGTTTTGCATGTTGGCCAGG + Intergenic
1107650897 13:42543590-42543612 GGGGGATTTAGCTGTTGTCCTGG + Intergenic
1108060182 13:46525191-46525213 CAGGGTTTTCCATGTTGCCCAGG + Intergenic
1108399129 13:50021503-50021525 CGAGGTCTCACATGTTGTCCAGG + Intergenic
1108903540 13:55442998-55443020 CGGGGTTTCACCTGTTTTGGGGG - Intergenic
1109594897 13:64538443-64538465 TGGGGTCTTACTTATTGTCCAGG - Intergenic
1109925107 13:69126926-69126948 CGGGGTTTCACATGTTGGCCAGG + Intergenic
1109946970 13:69447306-69447328 CAGGGTTTTACATGTTGGCCAGG + Intergenic
1110156901 13:72327716-72327738 CAGATTTATACCTGTTGTCCAGG - Intergenic
1110204979 13:72901495-72901517 CAGGGTTTCACATGTTGGCCAGG - Intronic
1110243746 13:73298001-73298023 CTGTTTTATACCTGTTGTCCTGG - Intergenic
1110629429 13:77690551-77690573 CGGGGTTTCACGTGTTAGCCAGG + Intergenic
1110691334 13:78432598-78432620 CGGGGTTTCACCTGTTAGCCAGG + Intergenic
1111162505 13:84414278-84414300 CGGGGTTTCACCCGTTTCCCAGG + Intergenic
1111267053 13:85830354-85830376 TGGGGTTTCACATGTTGGCCAGG - Intergenic
1111670569 13:91324476-91324498 CGGGGTTTCACCATTTGGCCAGG + Intergenic
1111772487 13:92615859-92615881 CGGGGTTTCACCTGTTAGCCAGG - Intronic
1112210710 13:97374582-97374604 CGGGGTTTACCATGTTGGCCAGG + Intronic
1112470222 13:99681775-99681797 CGGGGTTTCACCAGTTGGCCAGG + Intronic
1112472474 13:99701502-99701524 CGGGGTTTCACATGTTAGCCAGG + Intronic
1112788559 13:102978828-102978850 TGGGGTTTCACCTGCTGGCCAGG + Intergenic
1113307820 13:109097136-109097158 CAGGGTTTCACATGTTGGCCAGG - Intronic
1113569738 13:111345364-111345386 CGGGGTTTGCCATGTTGGCCAGG - Intergenic
1113831033 13:113296349-113296371 CGGGGTTTCACCAGTTGGCCAGG - Intergenic
1113874854 13:113587880-113587902 CGGAGTTTTGCTTGTTGCCCAGG + Intronic
1113903753 13:113809754-113809776 CTGGGGTTTATCTGTGGTCCTGG + Intronic
1114028608 14:18554788-18554810 CGGGGTTTTACCATGTGCCCAGG + Intergenic
1114211729 14:20621661-20621683 GGGGTTTTGACATGTTGTCCAGG + Intergenic
1114312879 14:21483996-21484018 TGGGGTTTTCCATGTTGGCCAGG + Intronic
1114662728 14:24358266-24358288 CAGGTTTTCACCTCTTGTCCAGG - Intergenic
1114861673 14:26530109-26530131 CGGGGTTTCACATGTTAGCCAGG + Intronic
1114880007 14:26772906-26772928 CAGGGTTTCACCTGTTGGCCAGG + Intergenic
1115199476 14:30837399-30837421 CAGGGTTTCACCTGTTGGCCAGG + Intergenic
1115222488 14:31071609-31071631 CAGGGTTTCACCTTTTGGCCAGG + Intronic
1115233551 14:31186830-31186852 CGGGGTTTCGCATGTTGGCCAGG - Intronic
1115550537 14:34500924-34500946 CGGAGTCTTTCCTGTTGCCCAGG - Intergenic
1115594664 14:34897755-34897777 CAGGGTTTCACCTGTCGCCCAGG - Intergenic
1115599420 14:34941147-34941169 TGGGGTTTTACCATTTGGCCAGG - Intergenic
1115621247 14:35142648-35142670 CGGGTTTTGCCATGTTGTCCAGG - Intronic
1116004848 14:39281640-39281662 CGGAGTTTCCCCTGTTGCCCAGG + Intronic
1116473462 14:45312075-45312097 GGGGGTTTCACCATTTGTCCAGG + Intergenic
1116826967 14:49682193-49682215 CAGGGTTTGCCATGTTGTCCAGG + Intronic
1116906403 14:50407941-50407963 CGGGGTTTCACGTGTTGGCCAGG + Intronic
1117356082 14:54925017-54925039 CGGGGTTTCACCTGTTAGCCAGG - Intergenic
1117793566 14:59366955-59366977 TGGGGTCTTACATGTTGCCCAGG - Intronic
1118156879 14:63251007-63251029 CGGAGTTTCACTTGTTGCCCAGG - Intronic
1118225868 14:63898594-63898616 CGGGGTTTTGCTAGTTGCCCAGG + Intronic
1118281084 14:64429134-64429156 CGGGGTTTGCCATGTTGGCCTGG - Intronic
1118373071 14:65154102-65154124 CGGGTTTCTACATGTTGGCCAGG + Intergenic
1118550704 14:66946594-66946616 CGGGGTTTCATATGTTGGCCAGG + Intronic
1118570485 14:67190104-67190126 CAGGGTTTCACATGTTGGCCAGG + Intronic
1119026763 14:71158845-71158867 CAGGGTTTCACATGTTGGCCAGG + Intergenic
1119231993 14:72987373-72987395 AGGGTTTTTGCCTGTTGCCCAGG - Intronic
1119450724 14:74707600-74707622 CGGGGTTTCACATGTTAGCCAGG - Intronic
1119461160 14:74805210-74805232 CAGGGTTTTACCAATTGGCCAGG + Intronic
1119482675 14:74968392-74968414 CAGGGTTTTACCTGTTGGTCAGG - Intergenic
1119501065 14:75127558-75127580 CGGGGTTTCACCAGTTGGTCAGG - Intergenic
1119630047 14:76222413-76222435 CGGGGTTTTACATGTTGGCCAGG - Intronic
1119730123 14:76946157-76946179 CGGGGTCTTCCTTGTTGCCCAGG + Intergenic
1119755205 14:77112901-77112923 CGGGGTTTCACACGTTGGCCAGG + Intronic
1119763151 14:77168097-77168119 CGGGGTTTCACATGTTGGCCAGG - Intronic
1119797796 14:77414983-77415005 CGAGGTCTTACATGTTGCCCAGG - Intronic
1119845156 14:77823761-77823783 CAGGGTTTAGCATGTTGTCCAGG + Intronic
1120193171 14:81457603-81457625 CGGGGTTTCACATGTTGATCAGG - Intergenic
1120903192 14:89593445-89593467 CGGGGTTTTGCCTGTTGGCCAGG - Intronic
1121134800 14:91487053-91487075 CGGGGCTTTACCTGTTGGCCAGG - Intronic
1121189996 14:92018763-92018785 CGGGGTTTCACCTGTTGGCCAGG - Intronic
1121191446 14:92034230-92034252 CGAGGTTTTACCTGTTGGCCAGG - Intronic
1121193732 14:92051916-92051938 CGGGGTTTCACATGTTGGTCAGG + Exonic
1121334981 14:93072100-93072122 TGGGGTTTCACCAGTTGACCAGG - Intronic
1121623484 14:95367428-95367450 CGGGCTTTTCCATGTTGACCAGG - Intergenic
1121792128 14:96706504-96706526 CGGGGTTTCACCAATTGGCCAGG - Intergenic
1121793464 14:96716744-96716766 CAGGGTTTCACATGTTGGCCAGG - Intergenic
1122014971 14:98787566-98787588 GGGGTTTCTCCCTGTTGTCCAGG + Intergenic
1122041838 14:98993319-98993341 CAGGGTTTAACTTGTTGGCCAGG - Intergenic
1122161881 14:99791050-99791072 CGGGGTTTCCCATGTTGCCCAGG + Intronic
1122484186 14:102066913-102066935 CGGGGTTTCACCATTTGCCCAGG + Intergenic
1122522757 14:102357187-102357209 CGGAGTTTCACATGTTGCCCAGG - Intronic
1122586329 14:102809319-102809341 CGGGGTTTCACCAGTTGGCCAGG + Intronic
1122697724 14:103564770-103564792 CAGGGTTTCACCTGTTGGCCAGG + Intronic
1122705848 14:103620832-103620854 AGGGTTTTGACATGTTGTCCAGG + Intronic
1122911218 14:104828607-104828629 CGGGGTTTCACGTGTTAGCCAGG - Intergenic
1122912085 14:104835503-104835525 CGGGGTTTCACGTGTTAGCCAGG + Intergenic
1124336733 15:28862811-28862833 TGGGGTTTCACCTGTTAGCCAGG + Intergenic
1124831909 15:33157072-33157094 CGGGGTTTACCATGTTGGCCAGG - Intronic
1125141559 15:36413875-36413897 TGGGGTTTCACTTGTTGCCCAGG + Intergenic
1125223560 15:37368547-37368569 CGGGGTTTCACGTGTTAGCCAGG + Intergenic
1125561897 15:40640285-40640307 CAGGGTTTCACCTATTGGCCAGG + Intronic
1125568797 15:40698377-40698399 CGGGGTTTCGCATGTTGGCCGGG + Intronic
1125650965 15:41317571-41317593 CGGGGTTTCCCATGTTGGCCAGG + Intronic
1125654837 15:41347620-41347642 CGGGGTTTCGCCTGTTAGCCAGG - Intronic
1125836243 15:42754270-42754292 TGGGGTGTCACCTGTTGCCCAGG + Intronic
1125854419 15:42935378-42935400 CAGGGTTTTACCAGTTGCCCAGG - Intergenic
1125862562 15:43013094-43013116 CGGGGTTTTGCCTGTTGGCCAGG + Intronic
1125957768 15:43802371-43802393 CGGGGTTTCACATGTTGGCCAGG - Intronic
1126128426 15:45316901-45316923 CGGGGTTTTGCATGTTGCCTAGG + Intergenic
1126140990 15:45438537-45438559 CAGGGTTTCACATGTTGCCCAGG - Intronic
1126623903 15:50667513-50667535 TGGGGTTTTACATGTCGGCCAGG - Intronic
1126723406 15:51606384-51606406 CAGGGTTTCACCAGTTGACCAGG + Intronic
1126938878 15:53743781-53743803 CGGGGTTTCACCTGTTAGCCAGG - Intronic
1127436559 15:58963980-58964002 CGGGGTTTCCCATGTTGGCCAGG + Intronic
1127609411 15:60622419-60622441 CGGGGTTTCACATGTTCCCCAGG - Intronic
1127957428 15:63865117-63865139 CGGGGTTTCACATGTTAGCCAGG - Intergenic
1128166102 15:65466327-65466349 CGGGGTTTTACTAATTGGCCAGG + Intronic
1128302711 15:66576895-66576917 TGGGGTTTCACATGTTGGCCAGG + Intergenic
1128468831 15:67935012-67935034 CGGGTTTTGCCATGTTGTCCAGG - Intergenic
1128928777 15:71683781-71683803 TGGGGTTTCACCTGTTGGCCAGG - Intronic
1129128372 15:73466042-73466064 CGGGGTTTCACCAGTTGGTCAGG + Intronic
1129163192 15:73759069-73759091 TGGGGTTTACCCTGTTGGCCAGG - Intergenic
1129286255 15:74527412-74527434 TGGGGTTTCACCTATTGGCCAGG + Intergenic
1129862987 15:78877309-78877331 CAGGGTTTCGCCTGTTGGCCAGG + Intronic
1129997434 15:80018653-80018675 GGGGTTTTTACATGTTGACCAGG + Intergenic
1130013024 15:80166826-80166848 CAGGGTTTCACCTGTTAGCCAGG + Intronic
1130028865 15:80294215-80294237 CGGGGTTTCACATGTTGGCCAGG + Intergenic
1130238580 15:82163348-82163370 CGGGGTTTCGCCAGTTGGCCAGG - Intronic
1130260864 15:82353244-82353266 TGGGGTTTCACCTGTAGCCCAGG + Intergenic
1130280369 15:82515762-82515784 TGGGGTTTCACCTGTAGCCCAGG - Intergenic
1130377822 15:83345667-83345689 CAGGGTTTCACCTGTTAGCCAGG - Intergenic
1130381450 15:83375773-83375795 CAGGGATTTTCCTGTTGTCTTGG + Intergenic
1130471742 15:84231946-84231968 TGGGGTTTCACCTGTAGCCCAGG - Intergenic
1130479236 15:84346516-84346538 TGGGGTTTCACCTGTAGCCCAGG - Intergenic
1130492534 15:84441613-84441635 TGGGGTTTCACCTGTAGCCCAGG + Intergenic
1130594039 15:85236583-85236605 TGGGGTTTCACCTGTAGCCCAGG - Intergenic
1130978372 15:88794717-88794739 TGGGGTTTGCCCTGTTGCCCAGG + Intergenic
1131036165 15:89223366-89223388 CAGGGTTTCACATGTTGGCCAGG + Intergenic
1131183221 15:90254644-90254666 TGGGGTTTTGCCTGTTGCCCAGG - Intronic
1131184055 15:90260304-90260326 CAGGGTTTTGCCTGTTGCCCAGG - Intronic
1131199298 15:90383354-90383376 CGGGGTTTTTCATTTTGCCCAGG + Intergenic
1131210166 15:90488027-90488049 CGGGGTTTCACGTGTTAGCCAGG - Intronic
1131253846 15:90848435-90848457 CGGGGTTTCACCAGTTGGCCAGG + Intergenic
1131347223 15:91661503-91661525 TGGGGTTTCACCTGTTAGCCAGG - Intergenic
1131358233 15:91765234-91765256 CAGGGTTTCACCAGTTGGCCAGG - Intergenic
1131437242 15:92432938-92432960 TGGGGTTTCGCCCGTTGTCCAGG - Intronic
1131519919 15:93106638-93106660 TGGGGTTTCACCTGTTAGCCAGG - Intergenic
1132077817 15:98837430-98837452 CGGGGTTTCACATGTTGGCCAGG + Intronic
1132521352 16:391206-391228 CGGGGTTTCACTGGTTGGCCGGG + Intergenic
1132895237 16:2225900-2225922 CAGGGTTTCACCTGTTAGCCAGG - Intronic
1132938005 16:2491744-2491766 CGGGGTTTTACCTGCTGGCCAGG + Intronic
1132949325 16:2551855-2551877 CGGGGTTTCAACTATTGGCCAGG + Intronic
1132949910 16:2555640-2555662 TGGGGTTTTGCTTGTTGTCCCGG - Intronic
1132964438 16:2644527-2644549 TGGGGTTTTGCTTGTTGTCCCGG + Intergenic
1133083055 16:3338727-3338749 CGGGGTTTCACGTGTTAGCCAGG + Intergenic
1133144171 16:3771258-3771280 CGGGTTTTGCCATGTTGTCCAGG + Intronic
1133487898 16:6237898-6237920 CAGGGTTTCACATGTTGACCAGG - Intronic
1133788546 16:8991487-8991509 CGGGGTTTCACCTGTTAGCCAGG + Intergenic
1133789767 16:9000545-9000567 CGGGGTTTTACCATGTGGCCAGG + Intergenic
1133795813 16:9045314-9045336 CGGGGTTTCACCTGTTGGCCAGG - Intergenic
1133813633 16:9179951-9179973 TAGGGTTTTGCCTGTTGGCCAGG + Intergenic
1134000778 16:10781135-10781157 GGGGGTTCTTCATGTTGTCCAGG - Intronic
1134010166 16:10846120-10846142 CGGGGTTTTACCATGTGGCCAGG + Intergenic
1134113720 16:11532488-11532510 CAGGGTTTCACATGTTGGCCAGG - Intergenic
1134210417 16:12271812-12271834 CAGGGTTTCACCTGTTGGGCAGG + Intronic
1134393517 16:13841458-13841480 CAGGGTTTCACCCGTTGGCCAGG + Intergenic
1134642726 16:15842193-15842215 TGGGGTTTCACATGTTGGCCAGG - Intronic
1135000009 16:18769110-18769132 CGGGGTTTCCCATGTTGACCAGG + Intergenic
1135160297 16:20088567-20088589 TGAGGTTTCACCAGTTGTCCAGG - Intergenic
1135492326 16:22920279-22920301 CCAGTTTATACCTGTTGTCCTGG + Intergenic
1135516702 16:23141566-23141588 CAGGGTTTCGCCTGTTGCCCAGG + Intronic
1135904888 16:26502476-26502498 AGGGGTTTTGCCAGTTGGCCAGG + Intergenic
1135940118 16:26815103-26815125 CAGGGTTTTGCCAGTTGCCCAGG - Intergenic
1136130253 16:28215860-28215882 TGGGGTTTCACCAGTTGGCCAGG - Intergenic
1136160963 16:28418348-28418370 TGGGGTTTTACATGTTGGCCAGG + Intergenic
1136202002 16:28696653-28696675 TGGGGTTTTACATGTTGGCCAGG - Intronic
1136218344 16:28810832-28810854 TGGGGTTTTACATGTTGGCCAGG - Intergenic
1136422767 16:30146668-30146690 CAGGGTTTCACATGTTGGCCAGG + Intergenic
1136454974 16:30375272-30375294 CGGGGTTTCGCCTGTTGGCCAGG - Intronic
1136485414 16:30568919-30568941 CGGGGTTTCACATGTTAGCCAGG - Intergenic
1136488577 16:30589539-30589561 CGGGGTCTCACATGTTGCCCAGG + Intergenic
1136520934 16:30795245-30795267 CGGGGTTTCACATGTTAGCCAGG - Intergenic
1136561997 16:31044745-31044767 CGGAGTTTCACTTTTTGTCCAGG - Intergenic
1136688806 16:32012931-32012953 CAGGGTTTCACATGTTGGCCAGG - Intergenic
1136789400 16:32956446-32956468 CAGGGTTTCACATGTTGGCCAGG - Intergenic
1136880412 16:33897490-33897512 CAGGGTTTCACATGTTGGCCAGG + Intergenic
1137305617 16:47196763-47196785 TGGGGTTTCACCAGTTGGCCAGG - Intronic
1137611216 16:49819058-49819080 CGGGGTTTCACCATTTGGCCAGG - Intronic
1137948690 16:52761201-52761223 TGGGGTTTCACATGTTGGCCAGG + Intergenic
1137975341 16:53026482-53026504 CGGGTTTTTCTATGTTGTCCAGG + Intergenic
1137982490 16:53081611-53081633 GGGGGTTTGCCCTGTTGCCCAGG + Intronic
1138127978 16:54454497-54454519 CGGGGTTTCACCTGTTGCCCAGG - Intergenic
1138169745 16:54837581-54837603 CGTGGTTTAATCCGTTGTCCAGG + Intergenic
1138373318 16:56544558-56544580 TGGGGTTTCACCTGTTGCCCAGG - Intergenic
1138475077 16:57265834-57265856 TGGGGTTTTCCATATTGTCCAGG - Intronic
1138610818 16:58122387-58122409 TGGGGTTTCACATGTTGCCCAGG - Intronic
1138662123 16:58527328-58527350 CGGGGTTTCACTAGTTGGCCAGG - Intronic
1138671437 16:58618388-58618410 CGGGGTTTACCATGTTGGCCAGG - Intronic
1138820665 16:60255101-60255123 CAGGGTTTCACATGTTGGCCAGG + Intergenic
1139133628 16:64176224-64176246 TGGGGTTTTACATATTGGCCAGG + Intergenic
1139202893 16:64997105-64997127 CGGGGTTTCACATGTTGTTCAGG - Intronic
1139399897 16:66673114-66673136 CGGAGTTTCACATGTTGGCCAGG + Intronic
1139405016 16:66711291-66711313 CGGGGTTTCACATGTTGGCCAGG + Intergenic
1139421941 16:66854426-66854448 CGGGGTTTCAGCAGTTGGCCAGG - Intronic
1139539562 16:67604102-67604124 CGGGGTTTCCTCTGTTGCCCAGG - Intronic
1139617393 16:68106481-68106503 GGGGTTTCTCCCTGTTGTCCAGG + Intronic
1139644535 16:68318722-68318744 CTTGGTTTCACCTGTTGGCCAGG + Intronic
1139780409 16:69346729-69346751 CGGAGTTTTGCTCGTTGTCCAGG - Intronic
1139801975 16:69530220-69530242 CGGGGTTTCACGTGTTAGCCAGG - Intergenic
1139838222 16:69857284-69857306 TGGGGTTTCACCTGTTGGCCAGG + Intronic
1139948489 16:70657582-70657604 CGGGGTTTCACCATTTGGCCAGG - Intronic
1140111350 16:72008169-72008191 CGGGGTTTTGGGTGTTGACCAGG + Intergenic
1140172626 16:72622662-72622684 TGGGGTTTCACATGTTGGCCAGG + Intergenic
1140228321 16:73096594-73096616 CGGGGTTTCACCTTTTGGCCAGG + Intergenic
1140283964 16:73582666-73582688 CAGGGTTTCACATGTTGGCCAGG + Intergenic
1140334653 16:74093850-74093872 TGGGGTTTCACCTGTTAGCCAGG - Intergenic
1140416981 16:74781986-74782008 TGGGGTCTTGCCTGTTGCCCAGG - Intergenic
1140423477 16:74840791-74840813 AGGGGTTTTGCCTGTTGCCCAGG - Intergenic
1140434899 16:74938727-74938749 TGGGGTTTTGCATGTTGTCCAGG + Intronic
1140435220 16:74941500-74941522 TGGGGTTTCACATGTTGGCCAGG - Intronic
1140487028 16:75301576-75301598 CGGGTCTTTCTCTGTTGTCCAGG + Intronic
1140534429 16:75696358-75696380 CGGGGTTTCACCAGTTGGCCAGG - Intronic
1140956722 16:79873266-79873288 CGGGGTTTCACGTGTTAGCCAGG - Intergenic
1141194770 16:81852225-81852247 GGAGGTTTTACCAGTAGTCCTGG + Intronic
1141316679 16:82968926-82968948 GGGGTTTTTCCATGTTGTCCAGG - Intronic
1141681785 16:85548978-85549000 CGGGGTTTCACCATTTGGCCAGG + Intergenic
1141899458 16:86981392-86981414 CGGGGTTTTGCATGTTGACCAGG + Intergenic
1142059216 16:88018991-88019013 CGGGGCCTTCCCTGCTGTCCTGG + Intronic
1142409616 16:89909180-89909202 CGGGGTTTGCCATGTTGGCCAGG - Intronic
1142413646 16:89929152-89929174 AGGGTTTTGCCCTGTTGTCCAGG + Intronic
1203091599 16_KI270728v1_random:1217934-1217956 CAGGGTTTCACATGTTGGCCAGG - Intergenic
1142547608 17:715382-715404 CGGAGTCTTACTTGTTGCCCAGG + Intronic
1142726363 17:1817523-1817545 CGGGGTCTCACTTGTTGCCCAGG + Intronic
1142834555 17:2575376-2575398 TGGGGTTTTGCCTGTTGGCCAGG - Intergenic
1142913894 17:3117863-3117885 CGGGGTTTCACATGTTGGCCAGG + Intergenic
1142921895 17:3195804-3195826 CGGGGTTTCACGTGTTAGCCAGG - Intergenic
1143084653 17:4406611-4406633 AGGGTTTTTCCCTGTTGTCCAGG + Intergenic
1143122334 17:4616486-4616508 CAGGGTTTCACCTGTTAGCCAGG + Intergenic
1143134041 17:4700731-4700753 GGGGGCTTTATATGTTGTCCAGG - Intronic
1143226301 17:5307125-5307147 CGGGGTTTCACATGTTGGTCAGG - Intronic
1143281913 17:5761131-5761153 CAGAGTTTCACCTGTTGGCCAGG + Intergenic
1143547729 17:7608590-7608612 CAGAGTTTGCCCTGTTGTCCAGG - Intronic
1143549850 17:7623649-7623671 CGGGTTTTGCCCTGTTGCCCAGG + Intronic
1143552441 17:7639119-7639141 CAGGGTTTTACCATTTGGCCAGG + Intergenic
1143553247 17:7644447-7644469 CAGGGTTTCACATGTTGGCCAGG + Intergenic
1143643322 17:8212681-8212703 CGGGGTTTCACAGGTTGCCCAGG - Intergenic
1143790990 17:9295549-9295571 CGGGATTTCACCTGTTGGCCAGG - Intronic
1143792828 17:9312037-9312059 CGGGGTTTCACCTGTTGGCCAGG + Intronic
1143804949 17:9418633-9418655 CGGGGTTTCACGTGTTAGCCAGG - Intronic
1143902572 17:10185114-10185136 CGGGGTTTTGTATGTTGGCCAGG + Intronic
1144001166 17:11056526-11056548 CGGGGTTTCACGTGTTAGCCAGG - Intergenic
1144118063 17:12120267-12120289 TGGGGTTTCACATGTTGGCCAGG - Intronic
1144180482 17:12746917-12746939 CAGGGTTTCACCAGTTGGCCAGG + Intronic
1144259467 17:13504119-13504141 CGGGGTTTCACCAGTTGGTCAGG - Intronic
1144687968 17:17238544-17238566 GGGGGTTTCACCTGTTGGCCAGG - Intergenic
1144692248 17:17275276-17275298 CAGGGTTTCACCAGTTGGCCAGG + Intronic
1144725646 17:17500881-17500903 TGGGGTTTCACATGTTGACCAGG + Intergenic
1144959653 17:19038047-19038069 CGGGGCTTTTCCTGTTGTTTCGG + Intronic
1144975507 17:19136477-19136499 CGGGGCTTTTCCTGTTGTTTCGG - Intronic
1145030815 17:19503848-19503870 CAGGGTTTCACATGTTGGCCAGG + Intronic
1145172582 17:20672597-20672619 CGGAGTTTTGCTTGTTGCCCTGG + Intergenic
1145221332 17:21091943-21091965 CGGGGTTTCACATGTTGGCCAGG - Intergenic
1145371284 17:22308345-22308367 AGGGGTTTGGCATGTTGTCCAGG - Intergenic
1145374019 17:22330934-22330956 CGAGGTTTTGCCTTTTGGCCAGG - Intergenic
1145766729 17:27463316-27463338 CGGGGTTTACCATGTTGCCCAGG - Intronic
1146026751 17:29328101-29328123 TGGGGTTTTCCATGTTGGCCAGG - Intergenic
1146041159 17:29456154-29456176 GGGGTTTTGACATGTTGTCCAGG - Intronic
1146129689 17:30260686-30260708 CGGTGTTTCACCTGTTGGCCAGG - Intronic
1146140759 17:30366046-30366068 CAGGGTTTCTCCTGTTGGCCAGG + Intergenic
1146179910 17:30691314-30691336 TGGGGTTTGTCATGTTGTCCAGG - Intergenic
1146189056 17:30748970-30748992 CAGGGTTTCACCTATTGGCCAGG + Intergenic
1146231770 17:31117477-31117499 CAGGGTTTCACCTGTTAGCCAGG - Intronic
1146333945 17:31953300-31953322 CAGGGTTTCACCTATTGGCCAGG + Intronic
1146385528 17:32368977-32368999 CGGGGTTTCACTCATTGTCCAGG - Intronic
1146916958 17:36684047-36684069 CAGGGATTCACCTGTTGGCCAGG - Intergenic
1147112769 17:38275935-38275957 CGGGGTTTCACATGTTGGCCAGG + Intergenic
1147151658 17:38519102-38519124 CAGGGTTTCACATGTTGGCCAGG - Intergenic
1147183345 17:38700732-38700754 CGGGGTTTCACCGGTTAGCCAGG - Intergenic
1147482880 17:40783741-40783763 TGGGGTTTGCCATGTTGTCCAGG + Intergenic
1147629546 17:41920868-41920890 CAGGGTTTCACCTGTTGGCCAGG - Intronic
1147670474 17:42174146-42174168 AGGGGTTTCACCTGTTGCCCAGG + Intronic
1147776979 17:42908897-42908919 TGGGGTTTCACCTGTTGATCAGG + Intronic
1147852692 17:43454241-43454263 GGGGGTTTTCCATGTTGCCCAGG - Intergenic
1147853431 17:43459927-43459949 CGGGGTTTCACCTGTTGGCCAGG + Intergenic
1147982867 17:44285577-44285599 CGCGGTTTCACTTGTTGGCCAGG - Intergenic
1147990503 17:44329761-44329783 CCGGGTTTTCCATGTTGGCCAGG + Intergenic
1148009387 17:44463571-44463593 TGGGGTTTCACCAGTTGGCCAGG + Intronic
1148037603 17:44679698-44679720 CGGGGTTTCACCTGTTAGCCAGG - Intronic
1148039196 17:44692830-44692852 TGGGGTTTCACCAGTTGGCCAGG - Intergenic
1148039221 17:44692965-44692987 CGGGGTTTCACCTATTATCCAGG - Intergenic
1148253314 17:46105675-46105697 TGGGGTTTCACCTGTTGCCCAGG - Intronic
1148369810 17:47089893-47089915 CGGGGTTTCACCTGTTGCCTAGG - Intergenic
1148665743 17:49373382-49373404 CGGGGTTTCACATGTTGGCCAGG + Intronic
1148882935 17:50745182-50745204 GGGGTTTTTTCCTGTTGGCCAGG + Intronic
1148898460 17:50855286-50855308 CGGGGTTTCACCTATTGGTCAGG + Intergenic
1148970479 17:51476501-51476523 AGGGGTTTCACTTGTTGGCCAGG - Intergenic
1149295747 17:55260796-55260818 CGGGGTTCTCCATGTTGGCCAGG - Intergenic
1149463989 17:56859609-56859631 CGGGGTTTCACGTGTTAGCCAGG + Intronic
1149466040 17:56879924-56879946 CGGGGTTTCACCATTTGGCCAGG + Intergenic
1149493438 17:57101366-57101388 CAGGGTTTCACATGTTGCCCAGG + Intronic
1149706798 17:58702184-58702206 TGGGGTTTTCCATGTTGCCCAGG + Intronic
1149707044 17:58704471-58704493 CAGGGTTTTGCATGTTGGCCAGG + Intronic
1149742764 17:59063368-59063390 CGGGGTTTACCATGTTGGCCAGG + Intronic
1149804059 17:59597741-59597763 CGGGGTTTCACATGTTAGCCAGG - Intronic
1149819243 17:59758901-59758923 TGGGGTTTTGCCTGTTGCCCAGG - Intronic
1149842437 17:59977737-59977759 CGGGGTTTCACATGTTAGCCAGG + Intergenic
1149923570 17:60680836-60680858 CGGGGTTTTGCCATTTGGCCAGG + Intronic
1149962822 17:61130863-61130885 CGGGGTTTTGCATGTTGGCCAGG - Intronic
1150075788 17:62190978-62191000 TGGGGTTTCACCAGTTGGCCAGG - Intergenic
1150344317 17:64392352-64392374 CGGGTTTCTCCCTGTTGGCCAGG - Intronic
1150449740 17:65256952-65256974 TGGGGTTTTGCATGTTGACCAGG + Intergenic
1150683777 17:67304021-67304043 CAGGGTTTCTCCTGTTGGCCAGG - Intergenic
1150752795 17:67881692-67881714 TGGGGTTTCACATGTTGGCCAGG + Intronic
1150913087 17:69409660-69409682 CGGGGTTTCACATGCTGGCCAGG - Intergenic
1150968604 17:70000720-70000742 TGGGGTTTTTCATGTTGCCCAGG - Intergenic
1150988780 17:70230676-70230698 CGGGGTTTCACATGTTGGTCAGG + Intergenic
1151170066 17:72238322-72238344 CTGGGATTCAGCTGTTGTCCTGG - Intergenic
1151610446 17:75170353-75170375 ATGGGTTTGACCTGTTGACCTGG - Intergenic
1151613022 17:75189082-75189104 CAGGGTTTTGCCTGTTGGCCAGG - Intergenic
1151733408 17:75924019-75924041 TGGGGTTTCACATGTTGGCCAGG - Intronic
1151813190 17:76457231-76457253 CGGGGTTTACCATGTTGGCCAGG + Intronic
1151871317 17:76838793-76838815 CGGGGTTTCGCATGTTGGCCAGG + Intergenic
1151872019 17:76842835-76842857 CGGAGTTTCAACTGTTGGCCAGG - Intergenic
1151912738 17:77094655-77094677 CAGGGTTTCACATGTTGGCCAGG + Intronic
1151937380 17:77270916-77270938 TGGGGTTTCACCAGTTGGCCAGG + Intergenic
1152220881 17:79064881-79064903 CGGGGTTTTGCCATTTGGCCAGG - Intergenic
1152343121 17:79736228-79736250 CAGGGTTTTGCATGTTGGCCAGG + Intronic
1152457115 17:80422890-80422912 CGGGGTTTCACGTGTTAGCCAGG + Intronic
1152651028 17:81493033-81493055 CGGGGCTTCCCCTGCTGTCCTGG - Intergenic
1152820098 17:82433439-82433461 TGGGGTTTCACCAGTTGTCCAGG + Intronic
1153034461 18:747276-747298 CGGGGTTTCGCCTATTGGCCAGG - Intronic
1153043408 18:834798-834820 CGAGGTTTCACCTGTTGGCCAGG - Intergenic
1153243488 18:3051946-3051968 TGGGGTTTCGCCTGTTGGCCAGG - Intergenic
1153307467 18:3645281-3645303 CAGGGTTTCACATGTGGTCCAGG + Intronic
1153325841 18:3819116-3819138 CGGGGTTTTATATGTTGGCCAGG - Intronic
1153435127 18:5060897-5060919 TGGGGTTTCACCTGTTGGCTGGG - Intergenic
1153598596 18:6755681-6755703 CCAGGTTATACCTGCTGTCCAGG - Intronic
1153621874 18:6986948-6986970 TTGGGTTTCACCTGTTGGCCAGG + Intronic
1153683449 18:7522638-7522660 CGGGGTTTCACGTGTTAGCCAGG - Intergenic
1153705070 18:7736993-7737015 TGGGGTTTTACATGTTTGCCAGG + Intronic
1153769684 18:8405377-8405399 CTGGCTTCTGCCTGTTGTCCTGG - Intronic
1153793457 18:8600912-8600934 TGGGGTCTTACCTGTTATCCAGG + Intergenic
1153831190 18:8924409-8924431 GGGGTTTTTTCATGTTGTCCAGG + Intergenic
1154076572 18:11208665-11208687 CGGGGTTTCACGTGTTAGCCAGG - Intergenic
1154292510 18:13122095-13122117 CAGGGTTTCACATGTTGGCCAGG - Intronic
1154943042 18:21133055-21133077 CGGGGTTTCACGTGTTAGCCAGG + Intergenic
1154987896 18:21570783-21570805 CGGGGTTTCACCCGTTGGCCAGG - Intronic
1155042873 18:22079636-22079658 TGGGGTTTTGACTGTTGGCCAGG + Intergenic
1155063870 18:22252439-22252461 GGGGGTTTTCCATGTTGCCCAGG + Intergenic
1155247511 18:23924341-23924363 CGGGGTTCCCCATGTTGTCCAGG + Intronic
1155487488 18:26361552-26361574 CGGGGTTTCACATGTTGGCTAGG - Intronic
1155901646 18:31397833-31397855 GGGGGTTTTGCCTGTTGGCCAGG - Intronic
1156113770 18:33760959-33760981 CAGGGTTTCACATGTTGGCCAGG + Intergenic
1156147936 18:34208663-34208685 CGGGGTTTGACCTTTTAGCCAGG - Intronic
1156349415 18:36290530-36290552 CGGGGTTTCACCAGTTGGCCAGG - Intergenic
1156389757 18:36639346-36639368 CGGGGTTTCACCTGTTAGCCAGG - Intronic
1156424095 18:36989884-36989906 CGAGGTTTCACCTGTTAGCCAGG + Intronic
1156739795 18:40310396-40310418 CAGGGTTTCACCTGTTGGCCAGG - Intergenic
1156937571 18:42729301-42729323 AGGGTTTTGCCCTGTTGTCCAGG + Intergenic
1157107568 18:44788992-44789014 AGGGTTTTAACATGTTGTCCAGG + Intronic
1157167591 18:45372284-45372306 CAGGGTCTCACTTGTTGTCCAGG - Intronic
1157206738 18:45707143-45707165 CGGGGTTTACCCTGTTGGCCAGG - Intergenic
1157255099 18:46131720-46131742 CGGGGTTTCGCATGTTGGCCAGG - Intergenic
1157446825 18:47752646-47752668 CGGGGTTTCACATGTTAGCCAGG + Intergenic
1157853404 18:51080730-51080752 CGGGGTTTTGCCTGTTGGCCAGG + Exonic
1158063614 18:53378150-53378172 CAGGGTTTTGCCTGTTGGTCGGG + Intronic
1158362285 18:56688523-56688545 CGGGGTTTCACATGTTGGCCAGG - Intronic
1158603749 18:58876870-58876892 CGGGGTTTACCATGTTGCCCAGG - Intronic
1158605584 18:58893167-58893189 CGGGGTTTCATGTGTTGGCCAGG + Intronic
1158612155 18:58951151-58951173 CAGGGTTTCACTAGTTGTCCAGG + Intronic
1158880575 18:61775696-61775718 TGGGATTTCACCTATTGTCCAGG - Intergenic
1158894499 18:61900443-61900465 TGGGGTTTCACCAGTTGACCAGG + Intergenic
1159012649 18:63072635-63072657 TGGGGTTTCACCAGTTGGCCAGG - Intergenic
1159030216 18:63223206-63223228 CGGGGTTTCACCTGTTAGCCAGG - Intronic
1159299371 18:66543218-66543240 CGGGGTTTCACATGTTAGCCAGG + Intronic
1159783578 18:72688181-72688203 CGGGGTTTCACATGTTGGCCAGG - Intergenic
1160333180 18:78014093-78014115 CGGGGTTTCACCTATTAGCCAGG - Intergenic
1160883749 19:1335027-1335049 CGGGGTTTCACCTGTTGGCCAGG + Intergenic
1161017851 19:1992056-1992078 CGGGGTTTCTCTTGTTGCCCAGG - Intronic
1161164184 19:2777069-2777091 CTGGGTTTCACCTGTTGGTCAGG - Intronic
1161234676 19:3191995-3192017 CGGGGTTTTGCCTGTTGGCCAGG - Intronic
1161270262 19:3385761-3385783 CGGGGTTTTGCATGTTGGCCAGG + Intronic
1161406056 19:4091838-4091860 CGGGTTTTTCCATGTTGCCCAGG + Intronic
1161421427 19:4177914-4177936 CGGGGTTTTACCATGTGGCCGGG + Intronic
1161460436 19:4393597-4393619 CGGGGTTTCACATGTTGGTCAGG - Intronic
1161497481 19:4595216-4595238 CGGGTTTTGACATGTTGGCCAGG + Intergenic
1161593680 19:5140542-5140564 CGGGGTTTCATATGTTGGCCAGG - Intronic
1161636170 19:5390659-5390681 CGGGGTTTCACATGTTGGCCAGG + Intergenic
1161636386 19:5391920-5391942 TGAGGTTTCACCTGTTGGCCAGG - Intergenic
1161727575 19:5938991-5939013 CAGGGTTTCACCTGTTGGCCAGG - Intronic
1161809147 19:6461602-6461624 GGGGGTTTCACCTGTGGACCAGG + Intronic
1161828395 19:6585173-6585195 CGGAGTTTTACATGTTGGCCAGG + Intronic
1162227569 19:9236317-9236339 CAGGGTTTCACCTGTTGGCCAGG - Intergenic
1162238592 19:9328377-9328399 CGGAGTTTTTGCTCTTGTCCAGG + Intronic
1162295908 19:9813360-9813382 CGGAGTTTTGCTTGTTGCCCAGG + Intronic
1162342495 19:10100055-10100077 CGGGATTTCACCTGTTGATCAGG - Intronic
1162355007 19:10177737-10177759 GGGGGTTTGCCATGTTGTCCAGG - Intronic
1162356754 19:10190569-10190591 CGGGGTTTACCGTGTTGGCCAGG - Intronic
1162441313 19:10693964-10693986 CGGGGTTTCACGTGTTAGCCAGG + Intergenic
1162513259 19:11132522-11132544 CGGGGTTTCACGTGTTAGCCAGG - Intronic
1162942985 19:14024997-14025019 TGGGGTTTCACCTGTTGCCCAGG + Intergenic
1162946214 19:14045407-14045429 CGGGGTTTCACATGTTAGCCAGG - Intronic
1162978699 19:14224239-14224261 TGGGGTTTGTCATGTTGTCCAGG + Intergenic
1162999741 19:14359295-14359317 CGGGGTTTCACATGTTAGCCAGG + Intergenic
1163013061 19:14437321-14437343 CGGGGTTTCACATGTTGGCCAGG - Intronic
1163030652 19:14541972-14541994 CCGGGTTTCACATGTTGGCCAGG + Intronic
1163036578 19:14572648-14572670 CGGGGTTTCGCCAGTTGGCCAGG + Intergenic
1163182444 19:15614217-15614239 CAGGGTTTCACATGTTGGCCAGG - Intergenic
1163214343 19:15864652-15864674 CGGGTTTTCGCCTGTTGGCCAGG + Intergenic
1163454454 19:17398188-17398210 TGGGGTTTCACCCGTTGGCCAGG - Intergenic
1163483199 19:17570754-17570776 TGGGGTTTTGCCTGTTGGCCAGG + Intronic
1163669628 19:18619950-18619972 TGGGGTCTTCTCTGTTGTCCAGG - Intronic
1163739302 19:19000894-19000916 CAGGGTTTTGCCTATTGCCCAGG + Intronic
1163823555 19:19510302-19510324 TGGGGTTTCACGTGTTGGCCAGG + Intergenic
1163964431 19:20731449-20731471 CGGGGTTTCACATGTTAGCCAGG + Intronic
1163995202 19:21039138-21039160 CGGGGCTTCACATGTTGGCCAGG + Intronic
1164212966 19:23116610-23116632 CGGGGTTTCACTTGTTGGCCAGG + Intronic
1164612225 19:29640324-29640346 CGGGGTTTCACCTTTTGACTTGG + Intergenic
1164673425 19:30086361-30086383 CTGGTTTCTGCCTGTTGTCCTGG + Intergenic
1165045528 19:33102001-33102023 CAGAGTTTTACGTGTTGTCCAGG - Intronic
1165170093 19:33886193-33886215 CGGGGTTTCCCATGTTGGCCAGG + Intergenic
1165189897 19:34054025-34054047 TGGGGTTTCACATGTTGGCCAGG - Intergenic
1165297187 19:34936868-34936890 AGGGGTTTTCTCTGTTGCCCAGG - Intronic
1165301460 19:34972263-34972285 AGGGTTTTTCCATGTTGTCCAGG + Intergenic
1165314747 19:35047804-35047826 CGGGGTTTGCCATGTTGACCAGG - Intronic
1165391373 19:35540935-35540957 CGGGGTTTGCTCTGTTGGCCAGG - Intronic
1165463050 19:35955407-35955429 CGGGGTTTCACATGTTGGCCAGG - Intergenic
1165561153 19:36681155-36681177 CAGGGTCTTGCTTGTTGTCCAGG + Intergenic
1165598436 19:37031701-37031723 CAGGGTTTTGCATGTTGGCCAGG + Intronic
1165751424 19:38262777-38262799 CAGAGTTTCACCTGTTGCCCAGG - Intronic
1165809703 19:38605059-38605081 CGGAGTTTTGCTTGTTGCCCAGG - Intronic
1165869443 19:38960697-38960719 CAGGGTTTCACATGTTGGCCAGG + Intronic
1166083672 19:40461072-40461094 TGGGGTTTTGCATGTTGGCCAGG + Intronic
1166353259 19:42211186-42211208 CGGGTTTTTCCATGTTGCCCGGG - Intronic
1166372096 19:42307624-42307646 CGAGGTTTCACATGTTGCCCAGG + Intronic
1166575799 19:43836530-43836552 TGGGGTTTCACATGTTGGCCAGG + Intronic
1166947767 19:46407546-46407568 CAGGGTTTTGCTTGTTGCCCAGG + Intergenic
1167067561 19:47198301-47198323 TGGGGTTTTCCATGTTGGCCAGG + Intronic
1167130965 19:47585484-47585506 CGGGGTTTTATACGTTGGCCAGG - Intergenic
1167248530 19:48389077-48389099 CAGGGTTTCACATGTTGACCAGG - Intronic
1167316173 19:48764249-48764271 CGGGGTTTTGCTTATTGACCAGG + Intergenic
1167335168 19:48880784-48880806 CGGGGTTTCACATGTTGGCCAGG + Intergenic
1167341668 19:48920098-48920120 CAGGGTTTTGCATGTTGGCCAGG + Intronic
1167671647 19:50856969-50856991 TGGGGTTTCACCAGTTGGCCAGG - Intronic
1168011183 19:53534476-53534498 TGGGGTTTCACCAGTTGGCCAGG + Intronic
1168023116 19:53624278-53624300 CGGGGTTTTGCCTGTTGCCCAGG + Intergenic
1168046689 19:53799201-53799223 CGGGGTTTCACCAGTTGGCCAGG + Intronic
1168255612 19:55163199-55163221 CGGGGTTTCACGTGTTAGCCAGG + Intronic
1168427145 19:56247881-56247903 CGTGGTTTCACCTGTTAGCCAGG + Intronic
1168444598 19:56401088-56401110 CGGGGTTTACCATGTTGGCCAGG - Intronic
1168444744 19:56402361-56402383 CGGGGTTTCACCTGTTAGCCAGG - Intronic
1168674577 19:58267787-58267809 CGGGGTTTCACCTGTTAGCCAGG - Intronic
925421956 2:3719632-3719654 CGGGGCTTTGCCTGATGTCTTGG + Intronic
926022388 2:9507901-9507923 TGGAGTTTCACATGTTGTCCAGG + Intronic
926113831 2:10198595-10198617 TGGGGTTTTGCATGTTGGCCAGG + Intronic
926158676 2:10472928-10472950 CAGGGTTTCACATGTTGGCCAGG + Intergenic
926176045 2:10593328-10593350 CGGGGTTTCACCAGTTGGTCAGG + Intronic
926253037 2:11166697-11166719 CAGGGTTTCGCCTGTTGGCCAGG - Intronic
926650278 2:15336538-15336560 CGGGGTTTCACCAGTTGAGCAGG - Intronic
926744941 2:16148961-16148983 CGGGTTTTGCCATGTTGTCCAGG + Intergenic
926759814 2:16268492-16268514 GGGGGTCTTACCTCTTGCCCTGG + Intergenic
926893696 2:17660932-17660954 CAGGGTTTCACATGTTGGCCAGG + Intergenic
927344111 2:22016993-22017015 CGGGGTTTCACCATCTGTCCAGG + Intergenic
927372456 2:22372392-22372414 CGGGGTTTCCCATGTTGGCCAGG - Intergenic
927778293 2:25919009-25919031 CGGGGTTTGCCATGTTGGCCAGG - Intergenic
927799766 2:26087591-26087613 CGGGGTTTCACCAGTTGACCAGG + Intronic
927830922 2:26349495-26349517 CAGGGTTTCACATGTTGGCCAGG + Intronic
927912456 2:26910644-26910666 CAGGGTTTCACCAGTTGGCCAGG + Intronic
928152962 2:28848850-28848872 CGGGGTTTGTCATGTTGCCCAGG - Intronic
928197536 2:29226285-29226307 CAGGGTTTCACCTTTTGGCCAGG - Intronic
928496518 2:31838504-31838526 CAGAGTCTTACCTGTCGTCCAGG - Intergenic
928621914 2:33098628-33098650 CGGTGTTTCACCTGTTGGCCAGG + Intronic
928957617 2:36887235-36887257 TGGGGTTTCACCTGTTGGTCAGG - Intronic
928965931 2:36975376-36975398 CAGGGTTTCACGTGTTGCCCAGG - Intronic
929006312 2:37396743-37396765 TGGGGTTTACCATGTTGTCCAGG - Intergenic
929237305 2:39619412-39619434 CGGGGTTTCACCTGCTGGCCAGG + Intergenic
929303368 2:40331782-40331804 CAGGGTTTTGCCAGTTGGCCAGG + Intronic
929541781 2:42828489-42828511 GGGGGTTTGTCCTGTTGCCCAGG - Intergenic
929586123 2:43115780-43115802 GGGGGTTTCACCTGTTGCCCAGG - Intergenic
929680362 2:43988047-43988069 TGGGGTTTCACATGTTGGCCGGG - Intronic
929974607 2:46620255-46620277 CAGGGTTTCACATGTTGCCCAGG - Intronic
930013356 2:46954760-46954782 CGGGTTTTACCATGTTGTCCAGG + Intronic
930051050 2:47216544-47216566 CGGGGTTTCACATGTTGGCCAGG + Intergenic
930188380 2:48432857-48432879 CGGGGTTTCACCTGTTGGTCAGG - Intergenic
930355010 2:50307173-50307195 CGGAGTTTTACATTTTGGCCAGG + Intronic
930665140 2:54094418-54094440 CGGGGTTTCACATGTTTGCCAGG + Intronic
931716519 2:65033070-65033092 CGGGGTTTGCCATGTTGGCCAGG - Intergenic
931757979 2:65390891-65390913 CGGGGTTTTACATGTTGCCTAGG - Intronic
932088486 2:68783652-68783674 CAGGGTTTCACATGTTGGCCGGG + Intronic
932235537 2:70118215-70118237 CGGGGTTTCACATGTTGGCCAGG - Intergenic
932723595 2:74158586-74158608 CGGGGTTTCCCATGTTGGCCAGG - Intronic
933291734 2:80445371-80445393 GGGGTTTTTCCGTGTTGTCCAGG + Intronic
933361143 2:81286488-81286510 TGGGGTCTTGCCTGTTGGCCAGG - Intergenic
933646689 2:84818880-84818902 CGGGGTTTCACCAGTTGGCTAGG - Intronic
933665527 2:84961446-84961468 CAGGGTTTCACATGTTGGCCAGG + Intergenic
934064010 2:88322863-88322885 CGGGGTTTCACGTGTTAGCCAGG - Intergenic
934071747 2:88390533-88390555 CGGGGTTTTGCATGTTGCCCAGG - Intergenic
934245759 2:90304531-90304553 CGGGGTTTTACCACTTGGTCAGG - Intergenic
934501024 2:94860454-94860476 CGGGGTTTCACATATTGGCCAGG + Intergenic
934582791 2:95458990-95459012 CGGGGTTTCACCAGTTGGCCAGG + Intergenic
934596659 2:95617724-95617746 CGGGGTTTCACCAGTTGGCCAGG - Intergenic
934711004 2:96513954-96513976 AGGGTTTTGCCCTGTTGTCCAGG - Intergenic
934782624 2:96981556-96981578 TGGGGTTTCACGTGTTGGCCAGG - Intronic
934786113 2:97007839-97007861 CGGGGTTTCACCAGTTGGCCAGG + Intronic
935291468 2:101614136-101614158 CGGAGTCTCACCTGTTGCCCAGG - Intergenic
935446011 2:103157839-103157861 CAGGGTTTTCCATGTTGGCCAGG - Intergenic
935568356 2:104633433-104633455 CGGGTTTTGACATGTTGCCCAGG + Intergenic
935683213 2:105656709-105656731 CAGGGTTTTTCATGTTGGCCAGG + Intergenic
936011094 2:108925805-108925827 TGGGGTTTCACCTGTTGGCCAGG + Intronic
936418832 2:112345348-112345370 CAGGGTTTTGCCAGTTGCCCAGG + Intergenic
937086266 2:119173939-119173961 CTGGGTTTCACCTGTTGGCCAGG - Intergenic
937372575 2:121310950-121310972 CGGGGTTTCACTATTTGTCCAGG - Intergenic
937420344 2:121749100-121749122 CGGGGTTTCACATGTTGCTCAGG - Intronic
937441885 2:121922530-121922552 AGGGGTTTCACCAGTTGGCCAGG + Intergenic
937676983 2:124602149-124602171 TGAGGTTTCACCTGTTGGCCAGG - Intronic
938102731 2:128508261-128508283 TGGGGTTTCACATGTTGGCCAGG - Intergenic
938155261 2:128932316-128932338 CAGGGTTTCACGTGTTGGCCAGG + Intergenic
938277209 2:130037451-130037473 TGGGGTTTCACCTGTTAGCCAGG + Intergenic
938328176 2:130428257-130428279 CGGGGTTTCACCTGTTAGCCAGG + Intergenic
938361772 2:130693236-130693258 CGGGGTTTCACCTGTTAGCCAGG - Intergenic
938438176 2:131299923-131299945 CGGGGTTTCACCTGTTAGCCAGG - Intronic
938769535 2:134489384-134489406 GGGGTTTTTCCCTGTTGGCCGGG - Intronic
938838818 2:135138016-135138038 GGGGTTTTGCCCTGTTGTCCAGG + Intronic
938889717 2:135692101-135692123 CGGGGTTCACCATGTTGTCCAGG + Intronic
939021183 2:136960328-136960350 GGGGTTTTGCCCTGTTGTCCAGG + Intronic
939321439 2:140628335-140628357 CGGGGTTTCACGTGTTAGCCAGG - Intronic
939535700 2:143424978-143425000 CTGGTTTATACCAGTTGTCCTGG + Intronic
939638814 2:144614625-144614647 CAGGGTTTTACCTGTTGCCCAGG + Intergenic
939941633 2:148358585-148358607 GGGGGTTTCACCTGTTGCCCAGG - Intronic
939989353 2:148862777-148862799 CGGGGTTTCACATGTTGGCCAGG + Intergenic
940175305 2:150871641-150871663 CAGGGTTTTGCATGTTGGCCAGG + Intergenic
940300333 2:152170286-152170308 CGGGGTTTCACATGTTGGCCAGG - Intronic
940632872 2:156260707-156260729 CGGGGTTTCGCCTGTTGGCTAGG - Intergenic
940782863 2:157951892-157951914 CGGGGTTTCATATGTTGGCCAGG - Intronic
940968697 2:159870257-159870279 CGGGTTTTTCCATGTTGCCCAGG - Intronic
941812866 2:169771331-169771353 AGGGTTTTCCCCTGTTGTCCAGG - Intronic
941841888 2:170094648-170094670 CAGGGTTTCACCTGTTGGCCAGG - Intergenic
942246972 2:174016904-174016926 CAGGGTTTCACATGTTGGCCAGG - Intergenic
942294312 2:174502937-174502959 CGGGATTTCACATGTTGGCCGGG + Intergenic
942387305 2:175455996-175456018 CGGGGTTTCACATGTTAGCCAGG + Intergenic
942398449 2:175576536-175576558 CAGGGTTTCACCTGTTGCCCAGG + Intergenic
942589176 2:177522643-177522665 CAGGGTTTCACCAGTTGGCCAGG + Intronic
942670015 2:178364983-178365005 TGGGGTTTCGCCTGTTGGCCAGG - Intronic
942938099 2:181582733-181582755 CAGGGTTTCACATGTTGGCCAGG + Intronic
943022908 2:182596960-182596982 CGGGGTTTGCCATGTTGCCCAGG - Intergenic
943205766 2:184892672-184892694 CAGGGTTTCGCCTGTTGGCCAGG + Intronic
943735679 2:191351693-191351715 GGGGGTTTCACATGTTGGCCAGG - Intronic
943793285 2:191960062-191960084 GGGGGTTTTCCATGTTGGCCAGG + Intronic
944179301 2:196870485-196870507 TGGGGTTTCACCAGTTGGCCAGG + Intronic
944281890 2:197907427-197907449 CGGGGTTTCACATATTGGCCAGG + Intronic
944509535 2:200451125-200451147 AGGGTTTTTCCATGTTGTCCAGG - Intronic
944548445 2:200821877-200821899 CTGGGTTTCCCATGTTGTCCAGG - Intronic
944585413 2:201168048-201168070 CGGGGTTTTACATGTTAGCCAGG - Exonic
944705051 2:202280521-202280543 CGGGGTTTTGCCTGTTGGCCAGG + Intronic
944766402 2:202869164-202869186 CGGGGTTTCACCTGTTAGCCAGG - Intronic
944776188 2:202968208-202968230 TGGGGTTTCACCAGTTGGCCAGG - Intronic
944823911 2:203460921-203460943 TGGGGTTTCACCTGTTGGCCAGG - Intronic
944900857 2:204214429-204214451 TGGGGTTTCACCAGTTGGCCAGG + Intergenic
945074191 2:206021636-206021658 CGGAGTTTTGCTTGTTGCCCAGG + Intronic
945567116 2:211414304-211414326 CAGGGTTTCACCTGTTGGCCAGG - Intronic
945699380 2:213151613-213151635 CGGGGTTTGACCAGCTGTCCCGG - Intronic
945707551 2:213254599-213254621 CAGGGTTTCACCATTTGTCCAGG + Intergenic
945788215 2:214271607-214271629 CAGGGTTTTCCATGTTGGCCAGG - Intronic
945879109 2:215308564-215308586 CGGGGTTTCACCTGTTGGCCAGG + Intergenic
946229916 2:218284897-218284919 CGGGGTTTCACCATTTGGCCAGG - Intronic
946266597 2:218548532-218548554 CAGGGTTTCACATGTTGCCCAGG + Intronic
946612648 2:221476026-221476048 TGGGGTTTTCCATGTTGCCCAGG - Intronic
946723580 2:222637954-222637976 AGGGTTTTTCTCTGTTGTCCAGG - Intronic
946915437 2:224515882-224515904 CGGGGTTTCATCAGTTGGCCTGG + Intronic
947138868 2:227002142-227002164 CAGGGTCTTGCCTGTTGCCCAGG - Intergenic
947229014 2:227866767-227866789 GGGGTTTTTCCCTGTTGCCCAGG + Intergenic
947434699 2:230063094-230063116 CGGGGTTTACCATGTTGGCCAGG - Intronic
947437673 2:230086727-230086749 CGGGGTTTTACCTGTTGCCCAGG + Intergenic
947607551 2:231498359-231498381 CGGAGTTTCACTTGTTGCCCAGG + Intergenic
947792241 2:232875146-232875168 CGGGGTTTGCCATGTTGGCCAGG - Intronic
947857322 2:233332985-233333007 CAGGGTTTCACCTGTTGGCCAGG + Intronic
948062755 2:235053684-235053706 TGGGGTTTTTCATCTTGTCCAGG - Exonic
948792656 2:240387043-240387065 CAGGGTTTTGCCTGTTGGCCAGG - Intergenic
948969879 2:241417107-241417129 CGGGGTTTGCCATGTTGGCCGGG - Intronic
1169086942 20:2832513-2832535 CGGGGTTTCACGTGTTAGCCAGG + Intergenic
1169170869 20:3463958-3463980 CGGGGTTTCACATGTTGGCCAGG - Intergenic
1169241120 20:3981925-3981947 CGGGGTTTTACCTGTTGTCCAGG - Intronic
1169433583 20:5563170-5563192 CGGGGTTTCACATGTTAGCCAGG + Intronic
1169472373 20:5897935-5897957 CAGGGTTTTGCTTCTTGTCCAGG - Intergenic
1169485022 20:6022527-6022549 TGGAGTTTTGCCTGTTGCCCAGG + Intronic
1169583097 20:7047706-7047728 CGGGGTTTCACGTGTTAGCCAGG + Intergenic
1169741548 20:8900385-8900407 CTGGGTAATACCTGATGTCCTGG - Intronic
1169815713 20:9654162-9654184 TGGGGTTTTCCATGTTGGCCAGG + Intronic
1170232630 20:14067312-14067334 TGGGGTTTCACATGTTGGCCAGG + Intronic
1170366444 20:15603305-15603327 TGGGGTTTCACCAGTTGGCCAGG - Intronic
1170497459 20:16940027-16940049 CGGGGTTTGACCTTTTGACTTGG - Intergenic
1170635804 20:18103361-18103383 TGGGGTTTTGCCTGTTGGCCAGG + Intergenic
1170664782 20:18377441-18377463 GGGGTTTTGACATGTTGTCCAGG + Intergenic
1170850976 20:20004278-20004300 TGGGGTTTCACATGTTGGCCAGG - Intergenic
1170854427 20:20037893-20037915 CAGGGTTTCACCTGTTGGCCAGG - Intronic
1170856321 20:20059135-20059157 TGGGGTTTCACCTGTTGGCCAGG - Intronic
1171479476 20:25442795-25442817 CGGAGTTTCACCAGTTGGCCAGG + Intronic
1171541547 20:25961364-25961386 CGGGGTTTTACATGTTGGTCAGG - Intergenic
1171799523 20:29599001-29599023 CGGGGTTTTACATGTTGGTCAGG + Intergenic
1171844530 20:30257510-30257532 CGGGGTTTCACATGTTGGTCAGG - Intergenic
1171965793 20:31529434-31529456 TGGGGTTTTGCATGTTGCCCAGG + Intronic
1171995231 20:31725642-31725664 CGGGGTTTCACCAGTTGGTCAGG + Intergenic
1172138027 20:32701027-32701049 TGGAGTTTTGCCTGTTGCCCAGG + Intergenic
1172206058 20:33163629-33163651 CGGGGTTTTACCTTTTGGCCAGG - Intronic
1172255241 20:33511984-33512006 CAGGGTTTCACATGTTGGCCTGG - Intronic
1172354213 20:34268529-34268551 CGGGGTCTCACTTATTGTCCAGG - Intronic
1172503192 20:35441887-35441909 CAGGGTCTTACCTGTTGCCCAGG + Intronic
1172591198 20:36119409-36119431 TGGGGTTTCACATGTTGGCCAGG - Intronic
1172638435 20:36425628-36425650 CGGGGTTTCACCATTTGGCCAGG - Intronic
1172713702 20:36947691-36947713 CAGGGTTTTGCTTGTTGCCCAGG + Intronic
1172735374 20:37123083-37123105 CAGGGTTTCACATGTTGGCCAGG + Intronic
1172738511 20:37147372-37147394 AGGGGTTTTCCCTGTTGCCCAGG + Intronic
1172919321 20:38468150-38468172 CAGGGTTTTGCCTGTTGGCCAGG + Intergenic
1173111333 20:40193234-40193256 CGGGGTTTCACGTGTTAGCCAGG + Intergenic
1173513146 20:43646014-43646036 CGGGGTTTCACATGTTAGCCAGG - Intronic
1173646373 20:44635705-44635727 TGGGGTTTCACATGTTGGCCAGG - Intronic
1173650761 20:44662703-44662725 CGGGGTTTTGCATGTTGACCAGG - Intergenic
1173804729 20:45916964-45916986 TGGGGTTTCACATGTTGGCCAGG + Intergenic
1173896425 20:46554534-46554556 CGGGGTTTTTCCATTTGCCCAGG - Intergenic
1173995270 20:47333408-47333430 CGGGGTTTCACCTGTTGGCCAGG - Intronic
1174457206 20:50657777-50657799 CAGGGTCTTGCCTGTTGCCCAGG + Intronic
1174549444 20:51351383-51351405 GGGGTTTTTCCCTGTTGCCCAGG + Intergenic
1174904322 20:54534378-54534400 GGGGTTTTGCCCTGTTGTCCAGG + Intronic
1175011705 20:55744402-55744424 CGGGGTTTGCCATGTTGGCCAGG + Intergenic
1175212301 20:57368077-57368099 CGGGGTTTCACATGTAGGCCAGG + Intronic
1176409415 21:6439902-6439924 CAGGGTTTTACATGTTGCCTAGG - Intergenic
1176447064 21:6830165-6830187 CGGCGTTGTCCCTGGTGTCCTGG + Intergenic
1176825235 21:13695191-13695213 CGGCGTTGTCCCTGGTGTCCTGG + Intergenic
1177012422 21:15744777-15744799 TGGGGTTTTCCATGTTGTCCAGG + Intronic
1177045349 21:16161937-16161959 TGGGGTTTCACATGTTGGCCAGG + Intergenic
1177801255 21:25831037-25831059 CGGGGTTTCACCTGTTGGCTAGG - Intergenic
1177913677 21:27061507-27061529 CGGGGTTTCACGTGTTAGCCAGG - Intergenic
1178077327 21:29024095-29024117 CGGGGTTTCACCAATTGGCCAGG - Intergenic
1178097479 21:29231736-29231758 CGGGGTTTCACATGTTATCCAGG + Intronic
1178109010 21:29352243-29352265 CGGGGTTTCACGTGTTGGCCAGG + Intronic
1178190692 21:30276556-30276578 TGGGGTTTTGCATGTTGGCCAGG - Intergenic
1178292952 21:31385251-31385273 CGGGGTTTCACCATTTGACCAGG + Intronic
1178363460 21:31969066-31969088 CGGGGTTTCACCTCTTGCCCAGG + Intronic
1178424441 21:32468176-32468198 CGGGGTTTCACATGTTGGCCAGG - Intronic
1178430089 21:32511222-32511244 CGGGGTTTGCCATGTTGGCCAGG - Intronic
1178529698 21:33365457-33365479 CGGGGTTTCACCATTTGGCCAGG - Intergenic
1178534265 21:33399406-33399428 TGGTGTTTCACCTGTTGCCCTGG - Intergenic
1178543509 21:33475115-33475137 CAGGGTTTCACATGTTGGCCAGG + Intronic
1178844512 21:36163151-36163173 CGGGGTTTCACGTGTTGGTCAGG - Intronic
1178965827 21:37116616-37116638 CGGGGTTTCACATGTTGGCCAGG - Intronic
1179352771 21:40628936-40628958 TGGGGTTTGACATGTTGCCCAGG + Intronic
1179393544 21:41016071-41016093 TGGGGTTTTCCATGTTGGCCAGG - Intergenic
1179628833 21:42664448-42664470 AGGGGTTCTACCTGCTTTCCGGG + Intronic
1179654861 21:42838591-42838613 TGGGGTTTCACCTGTTGGCCAGG + Intergenic
1179684908 21:43048224-43048246 CAGGGTTTTACATGTTGCCTAGG - Intergenic
1180232072 21:46432810-46432832 CAGGGTTTTCCATGTTGGCCAGG + Intronic
1180452728 22:15481838-15481860 CGGGGTTTTACCATGTGCCCAGG + Intergenic
1180604071 22:17042605-17042627 CAGGGTTTCACCTGTTAGCCAGG + Intergenic
1180643731 22:17320326-17320348 CTGGTTTATACCTGTTGTCCTGG + Intergenic
1180685937 22:17666876-17666898 CGGGGTTTCACCAGTTGGCCAGG + Intronic
1180723834 22:17929757-17929779 CAGGGTTTCACCTGATGCCCAGG + Intronic
1180789608 22:18567817-18567839 TGGGGTTTCACCTGTTGGCCAGG - Intergenic
1181232134 22:21427495-21427517 TGGGGTTTCACCTGTTGGCCAGG + Intronic
1181246517 22:21507362-21507384 TGGGGTTTCACCTGTTGGCCAGG - Intergenic
1181299832 22:21871853-21871875 CGGGGTCTCACTTGTTGCCCAGG + Intergenic
1181384034 22:22530408-22530430 CAGGGTTTGCCATGTTGTCCAGG + Intergenic
1181393377 22:22600088-22600110 CAGGGTTTCACCAGTTGGCCAGG - Intergenic
1181757409 22:25034069-25034091 CGGAGTTTTGCTTGTTGCCCAGG + Intronic
1181802441 22:25356380-25356402 CGGGGTTTCACCATTTGGCCAGG - Intronic
1181948923 22:26540406-26540428 TGGGGTTTGCCCTGTTGCCCAGG - Intronic
1181993947 22:26860013-26860035 CAGGGTTTCACCTGTTGTCCAGG - Intergenic
1182139471 22:27940908-27940930 TGGGGTTTGACATGTTGCCCAGG + Intergenic
1182139723 22:27943135-27943157 CGGGGTTTGAAATGTTGGCCAGG + Intergenic
1182206552 22:28633601-28633623 CAGGGTCTTGCTTGTTGTCCAGG - Intronic
1182209111 22:28659457-28659479 TGGGGTTTTACCAGTTGGCCAGG + Intronic
1182224881 22:28789852-28789874 CGGAGTTTTGCTTGTTGCCCCGG + Intergenic
1182340482 22:29616549-29616571 CAGGGTTTTACATATTGGCCAGG - Intronic
1182365682 22:29777336-29777358 CGGGGTTTCACCATTTGGCCAGG - Intergenic
1182389969 22:29985306-29985328 TGGGGTTTTGCCATTTGTCCAGG - Intronic
1182398104 22:30051552-30051574 CAGGGTTTTGCATGTTGGCCAGG - Intergenic
1182471169 22:30549171-30549193 CGGGGTTTCACCGTTTGGCCAGG - Intergenic
1182575383 22:31269575-31269597 CAGGGTTTCACCAGTTGGCCAGG - Intronic
1182601527 22:31468583-31468605 TGGGGTTTCACCAGTTGGCCAGG + Intronic
1182607751 22:31519955-31519977 TGGGGTTTCACCTGTTGCCCAGG + Intronic
1182645696 22:31807621-31807643 CAGGGTTTCACATGTTGGCCAGG + Intronic
1182838695 22:33365805-33365827 TGGGGTTTCACATGTTGGCCAGG + Intronic
1183152980 22:36052674-36052696 TGGAGTTTTAACTGTTGTCTAGG - Intergenic
1183159510 22:36102624-36102646 CGGGGTTTCCCATGTTGGCCAGG + Intergenic
1183211158 22:36452198-36452220 CGGGGTTTCACCTGTTGGCCAGG - Intergenic
1183348373 22:37320186-37320208 CTGGTTTCTGCCTGTTGTCCTGG - Intergenic
1183416091 22:37682762-37682784 CGGGGTTTCACTTGTTGGCCAGG - Intronic
1183503824 22:38197481-38197503 CAGGGTTTTGCATGTTGGCCAGG + Intronic
1183525891 22:38322414-38322436 CAGGGTTTTCCATGTTGTCCAGG - Intronic
1183568630 22:38635051-38635073 CGGGGGTTTCACTGTTGGCCAGG - Intronic
1183820963 22:40345819-40345841 CAGGGTTTCACGTGTTGCCCAGG + Intergenic
1183838397 22:40476642-40476664 CAGGGTTTCGCCTGTTGCCCAGG + Intronic
1183849706 22:40574623-40574645 CGGGGTTTCACATGTTGTCCAGG + Intronic
1183938217 22:41276790-41276812 CGGGGTTTACCATGTTGGCCAGG - Intronic
1184262556 22:43327593-43327615 CAGGGTTTCACATGTTGGCCAGG - Intronic
1184359788 22:44008299-44008321 TGGGGTTTCACATGTTGGCCAGG + Intronic
1184364621 22:44042228-44042250 CAGGGTTTCACTTGTTGGCCAGG - Intronic
1184435057 22:44467816-44467838 CGGAGTTTTGCCTGTTGGCCAGG + Intergenic
1184446806 22:44552528-44552550 TGGAGTTTCACCTGTTGGCCAGG + Intergenic
1185245902 22:49772639-49772661 CTGGGCATTACCTCTTGTCCAGG - Intergenic
1185300187 22:50075516-50075538 CGGGGTTTACCATGTTGGCCAGG - Intronic
1185304834 22:50109116-50109138 CGGAGTTTTACTTGTCGCCCAGG - Intronic
1185328649 22:50240796-50240818 CGGGGTTTCACATGCTGGCCAGG - Intronic
1185357559 22:50383291-50383313 CCTGGTTTTTCCTGTGGTCCTGG + Intronic
949240050 3:1859988-1860010 ATGGGTTTTTCCTGTTTTCCAGG - Intergenic
950000457 3:9652154-9652176 AAGGGTTTCACCTGTTGGCCAGG + Intronic
950049719 3:9978307-9978329 CAGGGTCTTAACTGTTGCCCAGG - Intronic
950050744 3:9987020-9987042 CAGGGTTTCACCTGTTAGCCAGG - Exonic
950065677 3:10109695-10109717 CGGGGTTTCCCATGTTGGCCAGG + Intergenic
950075262 3:10182472-10182494 CGGGGTTTCACCTGTTAGCCAGG + Intronic
950604083 3:14062845-14062867 TGGGGTTTTCCATGTTGGCCAGG - Intronic
950985353 3:17358208-17358230 AGGAGTTTCACCTGTTGCCCAGG + Intronic
951122743 3:18947373-18947395 CGGGGTTTCACCAATTGGCCAGG + Intergenic
951544922 3:23815171-23815193 CCAGGTTTTACCTATTGGCCAGG + Intronic
951798720 3:26571319-26571341 CAGAGTTTTGCCTGTTGCCCAGG - Intergenic
952341728 3:32452776-32452798 TGGGTTTTGCCCTGTTGTCCAGG + Intronic
952354913 3:32575097-32575119 CAGGGTTTCACCTGTTGGCCAGG + Intergenic
952712783 3:36448410-36448432 CGGGGTTTCGCATGTTGGCCAGG + Intronic
952768022 3:36971985-36972007 CGGGGTTTCACGTGTTAGCCAGG - Intergenic
952913316 3:38209813-38209835 CGGGGTTTCACCCGTTAGCCAGG + Intronic
953830038 3:46288930-46288952 CGGGGTTTGCCATGTTGTCCAGG - Intergenic
953959076 3:47253345-47253367 TGGGGTTCTCCATGTTGTCCAGG + Intronic
954060264 3:48061383-48061405 CGGGGTTTCGCCTGTTGGCCGGG + Intronic
954068832 3:48128164-48128186 TGGGGTTTCACATGTTGGCCAGG - Intergenic
954097675 3:48342306-48342328 CGGGGTTTCACCAGTTGGTCAGG + Intergenic
954102846 3:48390603-48390625 TGGGGTTTTGCATGTTGGCCAGG + Intronic
954173536 3:48824753-48824775 CAGGGTTTCACATGTTGGCCAGG - Intronic
954354556 3:50074018-50074040 AGGGGTTTCACCTGTTGGTCAGG + Intronic
954556809 3:51523766-51523788 CGGGGTTTCACTTGTTAGCCAGG + Intergenic
954623459 3:52008933-52008955 CCGAGTCTTACCTGTTGCCCAGG - Intergenic
954678686 3:52329632-52329654 CGGGGTTTCATCTGTTGTTCAGG - Intronic
954739749 3:52739206-52739228 CGGGGTTTCACCATTTGGCCAGG - Intronic
954798502 3:53173669-53173691 AGGGGTTTCACTTGTTGGCCAGG + Intronic
954802257 3:53194042-53194064 TGAGGTTTTCCCTGCTGTCCTGG - Intergenic
954830326 3:53415994-53416016 TGGGGTTTCACATGTTGCCCAGG + Intergenic
955094239 3:55781678-55781700 CAGGGTTTCACCTGTTGGCCAGG - Intronic
955245972 3:57225532-57225554 CGGGGTTTCACCAGTTGGCCAGG + Intronic
955269736 3:57485590-57485612 TGGGGTTTCACATGTTGGCCAGG + Intronic
955366942 3:58318806-58318828 TGGGGTTTCACATGTTGGCCAGG - Intergenic
955689612 3:61578416-61578438 CAGGGTATTACCAGTGGTCCAGG + Intronic
955815620 3:62839379-62839401 CGGGGTTTCACCATTTGGCCAGG + Intronic
955915339 3:63902215-63902237 CGGGGTTTCAAATGTTGCCCAGG - Intronic
956427851 3:69155243-69155265 GGGGTTTTTCCATGTTGTCCAGG + Intergenic
956435103 3:69227469-69227491 CGGGGTTTCACATGTTGGTCAGG - Intronic
956790154 3:72673921-72673943 CGGGGTTTCACATGTTGGCCAGG - Intergenic
956792261 3:72689274-72689296 CGGGTTTTCACCTGTTAGCCAGG + Intergenic
956839865 3:73128601-73128623 CGGGGTTTGCCATGTTGGCCAGG + Intergenic
957116863 3:76037446-76037468 CGGGGTTTCACTTGTTGGCTGGG + Intronic
957339609 3:78878392-78878414 CGGGGTTTGCCATGTTGGCCAGG - Intronic
957352197 3:79039602-79039624 CAGGGTTTCACCTGTTGGCCAGG - Intronic
957504023 3:81096641-81096663 CACGGTTTACCCTGTTGTCCTGG + Intergenic
957610457 3:82459150-82459172 CGGGGTTTCACATGTTAGCCAGG + Intergenic
957712880 3:83886732-83886754 CAGGGTTTTGCATGTTGGCCAGG + Intergenic
958186598 3:90128640-90128662 GGGGGTTTTCCATGTTGCCCAGG - Intergenic
958614759 3:96478196-96478218 AGGGTTTTTCCATGTTGTCCAGG + Intergenic
959238536 3:103757170-103757192 CGGGGTTTCACCACTTGGCCAGG - Intergenic
959375733 3:105586835-105586857 CAGGGTTTCACATGTTGGCCAGG + Intergenic
959378125 3:105609726-105609748 CGGGGTTTCTCATGTTGGCCAGG - Intergenic
959506629 3:107163874-107163896 TGGGGTTTTGCATGTCGTCCAGG - Intergenic
959762883 3:109989125-109989147 CGGGGTTTCACGTGTTAGCCAGG + Intergenic
960848704 3:122029479-122029501 CGGAGTGTCACCTGTTGCCCAGG - Intergenic
961212713 3:125138208-125138230 TGGGGTTTCACCTTTTGGCCAGG - Intronic
961268160 3:125664692-125664714 CGGGGTTTACCATGTTGGCCAGG + Intergenic
961284195 3:125787223-125787245 TGGGGTTTCACCTTTTGGCCAGG - Intergenic
961567075 3:127771545-127771567 AGGGTTTTGACATGTTGTCCAGG + Intronic
961781396 3:129322759-129322781 CAGGGTTTCACATGTTGGCCAGG - Intergenic
962046909 3:131770216-131770238 GGGAGCTTTTCCTGTTGTCCTGG + Intronic
962089455 3:132227879-132227901 CGGGGTTTCACATGTTGGCCAGG + Intronic
962098904 3:132321137-132321159 AGGGTTTTTCCCTGTTGTCCAGG - Intronic
962744365 3:138386672-138386694 GGGGGTTTCACCAGTTGGCCAGG + Intronic
962795233 3:138844152-138844174 CGGAGTTTGCCCTGTTGCCCAGG - Intergenic
962995822 3:140627301-140627323 CAGGGTTTCACCTGTTAGCCAGG - Intergenic
963194030 3:142506494-142506516 CGGGGTTTTCCATGTTGCCTGGG - Intronic
963232415 3:142921755-142921777 CGGGGTTTCACATGTTGGCCAGG + Intergenic
963489497 3:145981758-145981780 CGGGGTTTCACATGTTGTTCAGG - Intergenic
963751935 3:149189358-149189380 CGGGGTTTCACATGTTAGCCAGG - Intronic
963804631 3:149710768-149710790 CGGGGTTTCACCTGTTGGTCAGG + Intronic
964068420 3:152603504-152603526 CAGGGTTTCACCTGTTAGCCAGG + Intergenic
964108354 3:153063027-153063049 CAGGGTTTTACATGTTGCCCAGG - Intergenic
964171431 3:153775108-153775130 CGGGGTTTCACCTGTTGGCCAGG + Intergenic
964272657 3:154974808-154974830 CGGGGTTTACCATGTTGGCCAGG + Intergenic
964345886 3:155754432-155754454 CGGGTTTTGCCATGTTGTCCAGG - Intergenic
964351802 3:155810390-155810412 TGGGGTTTCACCTGTTGGTCAGG - Intergenic
964675735 3:159277887-159277909 CGGAGTTTTGCTCGTTGTCCAGG - Intronic
964764339 3:160164273-160164295 GGGGTTTTGACATGTTGTCCAGG - Intergenic
964819209 3:160752342-160752364 CAGGGTTTCACCTGTTGTTCAGG + Intergenic
965808276 3:172565599-172565621 CGGGGTTTCGCCTGTTGGTCAGG + Intergenic
965850296 3:173014792-173014814 CTGGTTTGTACCTGTTTTCCTGG + Intronic
965895328 3:173568869-173568891 CGGGGTTTCACCTGTTAGCCAGG + Intronic
966409852 3:179636686-179636708 TGGGGTTTCACATGTTGGCCAGG + Intergenic
966683286 3:182666484-182666506 CGGGGTTTTACCGGTTAGCCAGG - Intergenic
966857806 3:184207548-184207570 CAGGGTTTCACCATTTGTCCGGG + Intronic
967019853 3:185513147-185513169 CGGGTTTTCACATGTTGGCCAGG - Intronic
967273013 3:187746117-187746139 AGGGGTTTTTGCTGTTGTTCTGG + Intergenic
967315578 3:188149598-188149620 CGAGGTTTCACATGTTGGCCAGG + Intergenic
967541961 3:190678811-190678833 TGGGGTTTCACCAGTTGGCCAGG + Intergenic
967662639 3:192131958-192131980 CGGGGTTTCACCATTTGGCCAGG - Intergenic
967974232 3:195022993-195023015 CGGGGTTTCACATGTTGGCCAGG + Intergenic
969365349 4:6690900-6690922 CAGGGTTTTGCATGTTGGCCAGG + Intergenic
969921181 4:10541021-10541043 CGGGGTTTACCATGTTGGCCAGG - Intronic
970183445 4:13423457-13423479 CGGAGTTTCACTTGTTGCCCAGG - Intronic
970514435 4:16814061-16814083 CGGGGTTTCACTTGTTAGCCAGG + Intronic
971012112 4:22449653-22449675 CGGGGTTTCACCTGTTGGCCAGG - Intronic
971304614 4:25468806-25468828 TGGGGTTTCACATGTTGGCCAGG + Intergenic
971309560 4:25513648-25513670 AGGGGTTTCACCAGTTGGCCAGG + Intergenic
971407033 4:26331276-26331298 CGGAGTTTTCCATGTTGCCCAGG + Intronic
971582822 4:28364661-28364683 CGGGGTTTCACATGTTGGCCAGG - Intronic
972074949 4:35075841-35075863 GGGGTTTCTCCCTGTTGTCCAGG - Intergenic
972229614 4:37056009-37056031 CGGGGTTTCACCATTTGGCCAGG - Intergenic
972313867 4:37907404-37907426 CGGAGTTTCATCTGTTGCCCAGG + Intronic
972409928 4:38783363-38783385 CGGGGTTTCGCCAGTTGCCCAGG + Intergenic
972488824 4:39567410-39567432 CAGGGTTTTGCATGTTGCCCAGG - Intronic
972530210 4:39954847-39954869 CGGGGTTTGTCATGTTGCCCAGG - Intronic
972585050 4:40429999-40430021 CGGGGTTTCACCTGTTAGCCAGG - Intronic
972608676 4:40637047-40637069 AGGGTTTTGACCTGTTGCCCAGG - Intergenic
972630083 4:40835082-40835104 CGGGGTTTCACGTGTTAGCCAGG - Intronic
972653006 4:41037824-41037846 TGGGGTTTCACATGTTGGCCAGG - Intronic
972657918 4:41083495-41083517 CGGGGTTTCACATGTTGGCCAGG - Intronic
972670667 4:41211671-41211693 GGGGGTTTTACCTCTTGGCCAGG + Intronic
972788657 4:42349819-42349841 CAGGGTCTTACTTGTTGCCCAGG - Intergenic
973011379 4:45078972-45078994 CGGGGTTTCACCTTTTGCCCAGG + Intergenic
973536006 4:51882572-51882594 TGGGGTTTCACCTGTTAGCCAGG - Intronic
974050776 4:56939688-56939710 TGGGGTTTTGCCTGTTGGCCAGG + Intergenic
974072241 4:57134883-57134905 TGGGATTTTACCTGTTTGCCAGG + Intergenic
974113136 4:57548624-57548646 CGGGGTTTGCCATGTTGCCCAGG - Intergenic
974406641 4:61480590-61480612 CAGGGTTTCACATATTGTCCAGG - Intronic
974567592 4:63597733-63597755 GGAGGTTTCACCTGTTGGCCAGG - Intergenic
975176312 4:71293370-71293392 CTGGGTTTCACATGTTGCCCAGG - Intronic
975382481 4:73717348-73717370 CGGGGTCTCACCTGTTGCTCAGG - Intergenic
975577075 4:75873913-75873935 CGGGATTTCACATGTTGACCAGG - Intronic
975697690 4:77030063-77030085 CGGGGTTTCACCATTTGCCCAGG - Intronic
975758619 4:77596133-77596155 TGGAATTTTTCCTGTTGTCCCGG + Intronic
975831506 4:78373747-78373769 CGGAGTTTTGCTTGTTGCCCAGG - Intronic
975990162 4:80250916-80250938 TGGGTTTTCACCTGTTGTCCAGG - Intergenic
976174917 4:82342081-82342103 CAGGGTTTTCCATGTTGGCCAGG - Intergenic
976293487 4:83446495-83446517 CAGGGTTTCACCTGTTGGCCAGG + Intronic
976413905 4:84749075-84749097 TGGGATTTCACCTGTTGCCCGGG + Intronic
976586260 4:86800459-86800481 CGAGGTTTTGCCTGTTGGTCAGG - Intronic
976668338 4:87624390-87624412 CGGAGTTTCACGTGTTGCCCAGG + Intergenic
976719522 4:88156181-88156203 CGGGGTTTTCCATGTTGGCCAGG - Intronic
977529901 4:98188601-98188623 CAGGGTTTCACATGTTGGCCAGG + Intergenic
977818909 4:101449107-101449129 CAGGGTTTCACCTGTTAGCCAGG - Intronic
977894438 4:102347543-102347565 AGGGTTTTTACATGTTGGCCAGG - Intronic
977964278 4:103125669-103125691 CGGGGTTTCACCTGTTGGCCAGG - Intronic
978501085 4:109410627-109410649 CGGGGTTTCACATGTTGGCCAGG + Intergenic
978589295 4:110307313-110307335 CAAGGTTTCACCTGTTGCCCAGG + Intergenic
978718300 4:111873391-111873413 TGGGGTTTCACATGTTGGCCAGG - Intergenic
979051199 4:115935219-115935241 CAGAGTTTCACCTGTTGGCCAGG + Intergenic
979091043 4:116483004-116483026 GGGGGTTTCACGTGTTATCCAGG - Intergenic
979227007 4:118297944-118297966 GGGGGTTTCACGTGTTGTCTAGG - Intronic
979289491 4:118964256-118964278 CAGGGTTTTGCCTGTTGCCCAGG - Intronic
979731162 4:124024169-124024191 TGGGGTTTCACATGTTGGCCAGG - Intergenic
980059324 4:128111879-128111901 CGGGGTTTCACCAGTTGGCCAGG + Intronic
980120686 4:128724989-128725011 CGGGGTTTCACCAGTTGGCCAGG - Intergenic
980124371 4:128759769-128759791 CGGGGTTTCACCTGTTGGTCAGG - Intergenic
980240588 4:130169083-130169105 CTGACTTTTTCCTGTTGTCCAGG + Intergenic
980303622 4:131026863-131026885 TGGGGTTTCACATGTTGCCCAGG + Intergenic
980541761 4:134204368-134204390 CAGGGTCTTGCCTGTTGACCAGG + Intergenic
980809604 4:137858774-137858796 CGGGGTTTCACCATTTGGCCAGG - Intergenic
980905750 4:138947198-138947220 CTGGTTTATGCCTGTTGTCCTGG - Intergenic
980970801 4:139565315-139565337 TGGGGTTTCACGTGTTGGCCAGG + Intronic
981058605 4:140394984-140395006 CGGGGTTTCACATGTTGGTCAGG - Intronic
981159213 4:141476848-141476870 CAGGGTTTCACCTGTTGGCCAGG + Intergenic
981371706 4:143966277-143966299 CGGGGTTTCTCCTGTTGGTCAGG + Intergenic
982008431 4:151084666-151084688 CAGGGTTTCACCAGTTGGCCAGG + Intergenic
982253720 4:153432657-153432679 AGGGGTTTTACATGTTGGCCAGG + Intergenic
982700319 4:158654205-158654227 CAGGGTTTCACATGTTGGCCAGG + Intergenic
982716622 4:158815555-158815577 CGGGGTTTCACGTGTTAGCCAGG + Intronic
982747946 4:159124346-159124368 CGGGGTTTCACATGTTGGCCAGG - Intronic
982970653 4:161980949-161980971 CGGGGTTTCACATATTGGCCAGG + Intronic
983176432 4:164593851-164593873 TGGGGTTTCACCTGTTGCCCAGG + Intergenic
983308330 4:166022354-166022376 CGGGGTTTCACCTGTTGGCCAGG + Intronic
983463386 4:168055337-168055359 GGGGGTTTCACCAGTTGGCCAGG - Intergenic
983546096 4:168966318-168966340 TGGGGTTTCACCTGTTAGCCAGG - Intronic
983552828 4:169034653-169034675 CGGGGTTTACCATGTTGGCCAGG + Intergenic
983568228 4:169176730-169176752 CAGGGTTTTACATGTTGGCTAGG + Intronic
983594190 4:169448018-169448040 AAGGGTTTTGCCTGTTGCCCAGG - Intronic
983640933 4:169943339-169943361 TGGGGTTTCACTTGTTGGCCAGG + Intergenic
983652854 4:170050984-170051006 TGGGGTTTCACATGTTGGCCAGG + Intergenic
983829890 4:172313314-172313336 CGGGATTTCACCTGTTAGCCAGG + Intronic
983995314 4:174175240-174175262 TGGGGTTTCACCTGTTGGCCAGG - Intergenic
984385075 4:179045875-179045897 CGGGGTTTCACGTGTTAGCCAGG + Intergenic
984708407 4:182864381-182864403 CGGTGTCTCACCTGTTGGCCAGG - Intergenic
984716150 4:182927137-182927159 CAGGGTTTCACATGTTGCCCAGG + Intergenic
984826964 4:183934110-183934132 CGGAGTTTTGCATGTTGGCCAGG - Intronic
985003142 4:185505428-185505450 CGGGGTTTTACCTCTTGGCCAGG - Intronic
985004810 4:185523807-185523829 CGGGGTTTCACCAGTTGGCCAGG + Intronic
985146553 4:186899758-186899780 CAGGGTCTCACCTGTTGCCCAGG - Intergenic
985617854 5:934966-934988 CAGGGTTTCACGTGTTGTCCAGG - Intergenic
986115827 5:4773407-4773429 CTGGATTGTGCCTGTTGTCCTGG - Intergenic
986476296 5:8137205-8137227 CGGGGTTTCACGTGTTAGCCAGG - Intergenic
986699632 5:10393264-10393286 ATGGGTTCTCCCTGTTGTCCTGG + Intronic
986709688 5:10479769-10479791 CGGAGTTTCTCTTGTTGTCCAGG + Intergenic
987102300 5:14602625-14602647 CAGGGTTTTCCGTGTTGCCCAGG + Intronic
987349829 5:17011938-17011960 TGGGGTTTTGCATGTTGCCCAGG - Intergenic
987556718 5:19461452-19461474 CGGGGTTTCACCTGTTGGCCAGG - Intergenic
987614254 5:20252158-20252180 GGGGGTTTTACATGTTGGCCAGG - Intronic
987806662 5:22777994-22778016 TGCGGTTTCACCTGTTGGCCAGG + Intronic
988225746 5:28409687-28409709 TGGGGTTTATCATGTTGTCCAGG + Intergenic
988371023 5:30367221-30367243 CGGGGTTTCACATGTTATCCAGG + Intergenic
988372748 5:30392713-30392735 CGGGGTTTCACCTGTTAGCCAGG + Intergenic
988527072 5:31996513-31996535 TGGGGTTTCACCTGTTGGCCAGG - Intronic
988529282 5:32013615-32013637 CACCGTTGTACCTGTTGTCCTGG + Intronic
988581938 5:32475964-32475986 CGGGGTCTCACCTGTTGCCCAGG - Intergenic
988847597 5:35144652-35144674 CAGGGTTTAGCCTGTTGGCCAGG + Intronic
988856857 5:35235640-35235662 CAGGGTTTCACATGTTGGCCTGG + Intergenic
988892062 5:35628781-35628803 GGGGTTTTTCCCTGTTGCCCAGG + Intronic
988963887 5:36396244-36396266 CAGAGTTTCACCTGTTGGCCAGG + Intergenic
989042136 5:37240158-37240180 CGGGATTTCACCTGTTGGCTAGG - Intronic
989064014 5:37441624-37441646 AGGGGTTTCACTTGTTGACCAGG - Intronic
989124355 5:38036908-38036930 CAGGGTTTCACCTGTTGCCCAGG - Intergenic
989238466 5:39176339-39176361 CAGGGTTTCACCAGTTGGCCAGG + Intronic
989388686 5:40878398-40878420 CGGGGTTTCACATGTTAGCCAGG + Intergenic
989578245 5:43008545-43008567 CGGGGTTTCACCCGCTGGCCAGG + Intergenic
989590579 5:43109260-43109282 CGGGGTTTCACCTGTTGGCCAGG - Intronic
989638539 5:43560796-43560818 CGGGGTTTCACATGTTGTCCAGG - Intergenic
989748047 5:44855904-44855926 GGGGGTCTTACTTGTTGCCCAGG + Intergenic
989908949 5:49599526-49599548 AGGGGTTATAACTGTTGTCTAGG - Intergenic
990305416 5:54489889-54489911 CGGGGTTTCACATGTTGCCCAGG - Intergenic
990403184 5:55460991-55461013 CAGGGTTTCACCTGTTGCACAGG - Intronic
990482025 5:56220621-56220643 CAGGGTTTCACCTTTTGGCCAGG - Intronic
990591875 5:57274179-57274201 CAGGGTCTTGCCTGTTGCCCAGG + Intergenic
991353238 5:65741061-65741083 CAGGGTTTCACCAGTTGGCCAGG + Intronic
991368893 5:65897415-65897437 CGGGGTTTTACATGTTGGCCAGG - Intergenic
991673179 5:69067809-69067831 CGGGGTTTCGCATGTTGGCCAGG + Intergenic
991673708 5:69072554-69072576 CGAGGTTTCACCAGTTGGCCAGG - Intergenic
991691554 5:69230515-69230537 CGGGGTTTCACCTGCCGGCCAGG - Intergenic
991708910 5:69387664-69387686 TGGGGTTTCACCTGTTGGCCAGG - Intronic
991782735 5:70157054-70157076 CGGGGTTTCACCTGTTAGCTAGG - Intergenic
991988268 5:72311939-72311961 CAGGGTTTTGCCTATTGGCCAGG - Intronic
992134534 5:73730557-73730579 CAGGGTTTCATCTGTTGCCCAGG + Intronic
992248477 5:74853505-74853527 AGGGGTTTAACCTGGTGGCCAGG + Intronic
992323488 5:75637053-75637075 CGGAGTTTCACATGTTGGCCAGG - Intronic
992434161 5:76739350-76739372 CAGGGTTTCACATGTTGGCCAGG - Intergenic
992535488 5:77697936-77697958 TGGGGTCTTGCCTGTTGCCCAGG - Intronic
992579615 5:78158264-78158286 TGGGGTTTTCCATGTTGCCCAGG - Intronic
992706697 5:79402358-79402380 CGGGGTTTCCCATGTTGGCCAGG + Intronic
992721500 5:79565837-79565859 CAGGGATTCACCTGTTATCCAGG + Intergenic
992786949 5:80179106-80179128 CAGGGTTTCACATGTTGGCCAGG - Intronic
993508680 5:88744360-88744382 TGGGGTTTCACCCGTTGTCCAGG - Intronic
993525591 5:88961746-88961768 GGGGGTTTCACCTGTTGGCCAGG - Intergenic
993906995 5:93634207-93634229 CGGGGTTTCAGGTGTTGGCCAGG - Intronic
994411469 5:99411595-99411617 CGGGGTTTTCCCTTGTTTCCTGG + Intergenic
994417825 5:99497453-99497475 AGGGGTTTCACTTGTTGACCAGG - Intergenic
994462139 5:100077703-100077725 AGGGGTTTCACTTGTTGACCAGG + Intergenic
994482359 5:100353652-100353674 CGGGGTTTTCCCTTGTTTCCTGG - Intergenic
994650556 5:102521324-102521346 CAGGGTTTCACATGTTGGCCAGG + Intergenic
994768070 5:103946286-103946308 CGGGGTTTCACCGGTTAGCCAGG + Intergenic
994836245 5:104857181-104857203 CGGGGTTTGCCATGTTGGCCAGG - Intergenic
994935940 5:106254216-106254238 CAGGGTTTTACAGGCTGTCCAGG - Intergenic
995077377 5:108002213-108002235 CGGGGTTTCACCTGTTGGTCAGG + Intronic
995240647 5:109882401-109882423 CTGGGATATACCTGCTGTCCTGG - Intergenic
995306474 5:110656644-110656666 CGGGGTTTCACTTGTTAGCCAGG - Intronic
995496364 5:112748668-112748690 TGGGGTTTTACCTGTTGGCCAGG - Intronic
995917740 5:117269848-117269870 CGGGGTTTCACGTGTTGGCCAGG - Intergenic
996441620 5:123497794-123497816 CGGGGTTTCACCAGTTGGCTAGG + Intergenic
996572965 5:124952231-124952253 TGGGGTTTCTCCTGTTGTCCAGG + Intergenic
996729662 5:126704961-126704983 CAGGATCTTACCTGTTGCCCAGG + Intergenic
996894897 5:128469336-128469358 CAGGGTTTCACCTGTTAGCCAGG - Intronic
997179094 5:131809613-131809635 CAGGGTTTCATCTGTTGTCCAGG - Intronic
998056928 5:139086546-139086568 TGGGGTTTCACCAGTTGGCCAGG + Intronic
998416343 5:141949020-141949042 CAGGGATTCACCTGTTGCCCAGG - Intronic
998436326 5:142112192-142112214 TGGGGTTTCACATGTTGGCCAGG - Intronic
998442211 5:142172147-142172169 CGGGGTTTTCCATGTTGGTCAGG - Intergenic
998472288 5:142392475-142392497 CGGGGTTTGCCGTGTTGCCCAGG + Intergenic
998824955 5:146091774-146091796 CAGGGTCTTACTTGTTGCCCAGG - Intronic
999385294 5:151149925-151149947 CGGGGTTTCGCATGTTGGCCAGG - Intronic
999387401 5:151164243-151164265 CAGGGTTTCACCTGTTGGCCAGG + Intergenic
999393296 5:151210350-151210372 CGGGGTTTCACAGGTTGGCCAGG - Intronic
999489241 5:152033047-152033069 CAGGGTTTCACTTGTTGGCCAGG + Intergenic
999748122 5:154607587-154607609 CGGGGTCTTACATGTTGGCCAGG - Intergenic
999751309 5:154629969-154629991 TGGGGTTTCACATGTTGGCCAGG - Intergenic
999991371 5:157053200-157053222 TGGGGTTTCACCTGTTGCCCAGG - Intronic
1000202951 5:159029761-159029783 AGGGGTTTCACATGTTGGCCAGG - Intronic
1000240814 5:159406451-159406473 TGGGGTTTTGCATGTTGGCCAGG + Intergenic
1000321174 5:160135693-160135715 CAGGGTCTTGCTTGTTGTCCAGG - Intergenic
1000333760 5:160226367-160226389 CGGGGTTTTCCATGTTGGCGAGG - Intronic
1000343506 5:160295295-160295317 CAGGGTTTCACCTGTTGGACAGG - Intronic
1000345223 5:160308565-160308587 CGGGGTTTCACCTGTTGGTCAGG - Intronic
1000864218 5:166492802-166492824 CGGGGTTTCACCTGTTGGCCAGG - Intergenic
1001683254 5:173574160-173574182 CGGCGTTTCACCAGTTGGCCAGG - Intergenic
1001973517 5:175977537-175977559 CGGGTTTTACCCTGTTGCCCAGG - Intronic
1002127501 5:177057543-177057565 CAGGGTTTTGCATGTTGACCAGG - Intronic
1002146772 5:177190146-177190168 CTGGGTCTGACATGTTGTCCAGG + Intronic
1002150688 5:177227629-177227651 CAGGGTTTCGCCTGTTGGCCAGG + Intronic
1002153264 5:177254136-177254158 CGGGGTTTCTCCTGTTGGTCAGG + Intronic
1002243916 5:177866243-177866265 CGGGTTTTACCCTGTTGCCCAGG + Intergenic
1002272933 5:178084650-178084672 CGGGGTTTCACCATTTGGCCAGG + Intergenic
1002274898 5:178097768-178097790 TGGGGTTTTACTAGTTGCCCAGG - Intergenic
1002918376 6:1547362-1547384 CGGGGTTTCACATGTTGGTCAGG + Intergenic
1003421381 6:5961283-5961305 CGGAGTTTTACTCGTTGCCCAGG + Intergenic
1003499597 6:6693753-6693775 CTGGGTTTTATCTCTGGTCCTGG + Intergenic
1003606351 6:7564951-7564973 CGGGGTTTCACCAGTTGGCCAGG - Intronic
1003672559 6:8172954-8172976 TGGGGTTTCACCTGTTGGTCAGG - Intergenic
1003951201 6:11117366-11117388 CGGGGTTTCACCAGGTGGCCAGG + Intronic
1003953918 6:11144791-11144813 CTGGTTTGTATCTGTTGTCCTGG - Intergenic
1004165096 6:13249771-13249793 CGGAGTTTTCTCTGTTGCCCAGG - Intronic
1004433414 6:15566880-15566902 CGGGGTTTCGCCAGTTGGCCAGG + Intronic
1004460648 6:15832512-15832534 CGGGGTTTCACATGTTGGTCAGG - Intergenic
1004622012 6:17339093-17339115 CGGGGTTTCACCGTTTGACCAGG - Intergenic
1004657802 6:17681391-17681413 CGGGGTTTCACCTGTTAGCCAGG - Intronic
1004832140 6:19488434-19488456 CGGGGTTTCACATGTTGGCCAGG + Intergenic
1004951448 6:20677259-20677281 TGGGCTTTCACCTGTTGTCCCGG + Intronic
1005002757 6:21259432-21259454 CGGGGTTTCCCATGTTGGCCAGG - Intergenic
1005079161 6:21939485-21939507 CGAGGTTTTACTTATTGGCCAGG + Intergenic
1005329408 6:24734660-24734682 CGGAGTTTCACATGTTGGCCAGG - Intergenic
1005470993 6:26162565-26162587 CAGAGTTTTATCTGTTGCCCAGG + Intronic
1005703892 6:28431354-28431376 CTGGTTTATACCTGTTGTCTTGG + Intergenic
1005829295 6:29657700-29657722 CGGGGTTTCACATGTTGGCCAGG + Intronic
1006026361 6:31149632-31149654 CGGGATTTCACATGTTGCCCAGG + Intronic
1006090326 6:31624989-31625011 TGGGGTTTCACATGTTGGCCAGG + Intronic
1006099289 6:31676159-31676181 CGGGGTTTCACCAGTTGGCCAGG - Intergenic
1006298827 6:33182518-33182540 CGGGGTTTCACATGTTGGCCAGG - Intronic
1006325951 6:33354171-33354193 CAGGGTTTTACTTGTTAGCCAGG + Intergenic
1006332574 6:33402959-33402981 CAGAGTTTCACTTGTTGTCCAGG - Intronic
1006484143 6:34324161-34324183 CGGGGTTTCCCGTGTTGGCCAGG - Intronic
1006562147 6:34922882-34922904 CGGGGTTTCACCTGTTGGCCAGG + Intronic
1006646379 6:35517405-35517427 GGGGTTTTTCCATGTTGTCCAGG + Intergenic
1006648181 6:35529611-35529633 CAGGGTTTCACCTGTTGCCAAGG - Intergenic
1006686584 6:35839868-35839890 CAGGGTTTCACATGTTGGCCAGG + Intronic
1006707233 6:36031203-36031225 CGGGGTTCTCCATGTTGGCCAGG + Intronic
1006821595 6:36900690-36900712 GGGGTTTTTCCGTGTTGTCCAGG + Intronic
1006953348 6:37844113-37844135 CAGGGTTTTGCCAGTTGCCCAGG + Intronic
1007002739 6:38329761-38329783 GGGAGTTTTGCCTGTTGGCCAGG - Intronic
1007159869 6:39780408-39780430 CAGGGTTTTCCATGTTGCCCAGG - Intergenic
1007469025 6:42076257-42076279 CGGGGTTTTACCAGTTGGCCAGG - Intronic
1007624432 6:43235597-43235619 CGGGGTCTTGCTTGTTGCCCAGG - Intergenic
1007643105 6:43358745-43358767 TGGGGTTTCACATGTTGGCCAGG + Intronic
1007669929 6:43543695-43543717 CGGAGTCTTCCCTGTTGCCCAGG + Intronic
1007689764 6:43692774-43692796 TGGGGTTTCACCTGTTGCCCAGG - Intergenic
1008049938 6:46890524-46890546 CGGGGTTTCCCATGTTGGCCAGG - Intronic
1008162683 6:48098104-48098126 CTGGGCTTTTCCTGATGTCCAGG - Intergenic
1008510876 6:52274486-52274508 CAGGGTTTTGCATGTTGCCCAGG - Intronic
1008919992 6:56832928-56832950 TGGGGTTTCACATGTTGGCCAGG + Intronic
1009565634 6:65308166-65308188 CAGGGTTTCACTTGTTGGCCAGG + Intronic
1009855024 6:69251080-69251102 CTGGTTTGTACCTGTTGCCCTGG + Intronic
1009904182 6:69848157-69848179 TGGAGTTTTACTTGTTGCCCAGG - Intergenic
1010241499 6:73620112-73620134 TGGGGTTTCACATGTTGGCCAGG + Intronic
1010243580 6:73641268-73641290 TGGGGTTTCACCTGTTGGCCAGG + Intronic
1010412178 6:75573068-75573090 CGGGGTTTCACATGTTGGCCAGG - Intergenic
1010554482 6:77262143-77262165 AGGGGTTTCACCAGTTGGCCAGG + Intergenic
1010702853 6:79072676-79072698 TGGGGTTTTCCATTTTGTCCAGG + Intronic
1011070225 6:83373423-83373445 TGGGGTTTCACCTGCTGGCCAGG + Intronic
1011270246 6:85571159-85571181 CGGGGTTTCACATGTTAGCCAGG - Intronic
1011430425 6:87280714-87280736 CGGGGTTTGCCATGTTGGCCAGG - Intergenic
1011431583 6:87293220-87293242 CAGGGTTTCACCTGTTGACCAGG + Intronic
1011583859 6:88902885-88902907 CGGGGTTTCACATGTTAGCCAGG + Intronic
1011752552 6:90468063-90468085 TGGGGTCTTACTTGTTGTCCAGG + Intergenic
1011875080 6:91949341-91949363 CGGGGTTTCACCGGTTAGCCAGG + Intergenic
1012186488 6:96223416-96223438 CGGGGTTTGTCATGTTGCCCAGG - Intergenic
1012265499 6:97137134-97137156 CGGGGTTTTCCCTTTTCTCATGG + Intronic
1012496262 6:99836568-99836590 AGGGGTTTTGCCTGTTGCCCAGG + Intergenic
1013040228 6:106425827-106425849 CAGGGTTTCACCAGTTGGCCAGG + Intergenic
1013238929 6:108225087-108225109 CGAGGTTTCACCTGTTAGCCAGG - Intronic
1013336178 6:109164886-109164908 CAGGGTTTCACATGTTGGCCAGG - Intergenic
1014087706 6:117366703-117366725 CAGGGTTTCACATGTTGGCCAGG + Intronic
1014203236 6:118627006-118627028 TGGGGTTTCACCTTTTGGCCAGG - Intronic
1014207483 6:118672060-118672082 CAGGGTTTCATCTGTTGCCCAGG + Intronic
1014254853 6:119150726-119150748 CGGGGTTTCACCATTTGGCCAGG + Intergenic
1014471035 6:121814948-121814970 CAGGGTTTTTTCTGTTGCCCAGG - Intergenic
1015155500 6:130090776-130090798 TGGGGTTTGCCATGTTGTCCAGG + Intronic
1015763794 6:136693796-136693818 CGGGTTTTGCCCTGTTGGCCAGG - Intronic
1015822655 6:137280568-137280590 AGGGTTTTTCTCTGTTGTCCAGG + Intergenic
1016088435 6:139944806-139944828 TGGGATTTCACCTGTTGGCCAGG + Intergenic
1016197949 6:141368772-141368794 TGGGGTTTCACCAGTTGGCCAGG + Intergenic
1016450233 6:144174940-144174962 TGGGGTTTTGCCTGTTGCCCAGG - Intronic
1016664133 6:146615097-146615119 CGGGGTTTCACGTGTTAGCCAGG + Intronic
1016724486 6:147346545-147346567 CGGGGTTTACCATGTTGGCCAGG - Intronic
1017409742 6:154155603-154155625 CGGGGTTTACCATGTTGCCCAGG - Intronic
1017467536 6:154708352-154708374 CGGGGTTTCACATGTTGGCCAGG - Intergenic
1017502576 6:155039150-155039172 CGGGGTTTGCCATGTTGTCAAGG + Intronic
1017517137 6:155166512-155166534 CAGGGTTTCACCTGTTGGCCAGG + Intronic
1017523784 6:155225145-155225167 GGGGTTTTGACATGTTGTCCAGG + Intronic
1017666964 6:156729238-156729260 CAGGGTCTTGCCTGTTGCCCAGG - Intergenic
1017809192 6:157972621-157972643 CGAGGTTTCACCTGTTGGCCAGG + Intergenic
1017830375 6:158122588-158122610 TGGGGTTTCACATGTTGGCCAGG - Intronic
1017900179 6:158712951-158712973 CGGGGTTTCACGTGTTAGCCAGG + Intronic
1018300605 6:162398579-162398601 CTGGGTTTCACCAGTTGGCCAGG + Intronic
1018310174 6:162500361-162500383 CGGTGTTTTACATGTTGGCCAGG + Intronic
1018874387 6:167807127-167807149 TGGGGTTTCACTTGTTGGCCAGG - Intergenic
1019677160 7:2320827-2320849 CAGGGTTTCACATGTTGGCCAGG - Intronic
1019730967 7:2629453-2629475 CGGGGTTTCACCATTTGCCCAGG + Intergenic
1019821831 7:3249599-3249621 CTGGCTTTTACCGGTTGTCCTGG - Intergenic
1019907505 7:4075842-4075864 CGGGGTTTCACATGTTGGCCAGG + Intronic
1019908414 7:4082342-4082364 TGGGGTTTCACATGTTGGCCAGG - Intronic
1019997880 7:4736603-4736625 GGGGGTTTTGCCTTTTGGCCAGG + Intronic
1020048317 7:5061480-5061502 CAGGGTTTTGCATGTTGCCCAGG + Intronic
1020133361 7:5572041-5572063 CGGGGTTTCACCTGCTAGCCAGG + Intergenic
1020236174 7:6357303-6357325 CGGGGTTTCACCATTTGGCCAGG + Intergenic
1020250632 7:6465374-6465396 CGGGGTTTCACGTGTTAGCCAGG + Intronic
1020387329 7:7621562-7621584 CGGGGTTTCACATATTGGCCAGG - Intergenic
1020913255 7:14159861-14159883 TGGGGTTTCACATGTTGGCCAGG + Intronic
1021083140 7:16386827-16386849 CAGGGTTTCCCCTGTTGGCCAGG - Intronic
1021880704 7:25092906-25092928 CGGGGTTTCACATGTTGGTCAGG - Intergenic
1021890968 7:25186033-25186055 CGGGGTTTGCCATGTTGGCCAGG + Intergenic
1022011846 7:26314805-26314827 CAGGGTTTCACCTGTTGGCCAGG - Intronic
1022396997 7:29997943-29997965 CAGGGTTTGCCATGTTGTCCAGG + Intergenic
1022440402 7:30428250-30428272 CGGGGTTTCGCATGTTGCCCAGG + Intronic
1023309282 7:38867352-38867374 CAGGGTTTCACCTATTGGCCAGG - Intronic
1023681274 7:42690473-42690495 CTGGGTTTTACCTGTTTTTAGGG + Intergenic
1023832512 7:44048104-44048126 CGGGGTTTCCCATGTTGGCCAGG + Intronic
1023884426 7:44342650-44342672 TGGGGTTTCACCTGTTGGTCAGG - Intergenic
1023945599 7:44800588-44800610 CGGGATTTACCATGTTGTCCAGG + Intronic
1023986224 7:45098399-45098421 CAGGGTTTTGCCTGTTGCCCAGG + Intergenic
1024177121 7:46851911-46851933 CAGGGTTTCACCTATTGACCAGG + Intergenic
1024220125 7:47280720-47280742 CGGGGTTTCACATGTTGGTCAGG - Intronic
1024393276 7:48839112-48839134 CGGGGTTTTGCATGTTGGCCAGG + Intergenic
1024710034 7:52005337-52005359 CAGGGTTTTCTCTGTTGCCCAGG + Intergenic
1024711054 7:52014858-52014880 CGGGGTTTCACATGTTACCCAGG - Intergenic
1024845274 7:53635144-53635166 TGGGGTTTCACCTGTTGGCCAGG - Intergenic
1025076876 7:55951436-55951458 CAGGGTTTCACATGTTGGCCAGG - Intergenic
1025171416 7:56760613-56760635 AGGGGTTTCACCTGTTGGCCAGG + Intergenic
1025215177 7:57050463-57050485 TGGGGTTTCACCTGTTAGCCAGG + Intergenic
1025292975 7:57747566-57747588 CGGGGTTTTAAATGTTGGTCAGG - Intergenic
1025528680 7:61848166-61848188 CGGGGTTTCACCTTTTAGCCGGG + Intergenic
1025656770 7:63526366-63526388 TGGGGTTTCACCTGTTAGCCAGG - Intergenic
1025700452 7:63814886-63814908 AGGGGTTTCACCTGTTGGCCAGG - Intergenic
1026003166 7:66579120-66579142 CGGGGTTTGCCATGTTGGCCAGG - Intergenic
1026046721 7:66910798-66910820 CAGGGTATCACCTGTTGCCCAGG - Intergenic
1026053022 7:66962670-66962692 CGGGGTTTTGCATGTTGGCCAGG - Intergenic
1026120740 7:67534803-67534825 CGGGGTTTCACCTGTTGGCCAGG + Intergenic
1026263592 7:68777108-68777130 TGGGGTTTCACATGTTGTTCAGG + Intergenic
1026264122 7:68781777-68781799 TGGGGTTTCACATGTTGGCCAGG - Intergenic
1026416505 7:70186758-70186780 TGAGGTTTCACCTGTTGGCCAGG + Intronic
1026468694 7:70676247-70676269 TGGGGTTTTCCATGTTGCCCAGG - Intronic
1026485011 7:70810555-70810577 TGGGGTTTTGCCTGTTGCCCAGG + Intergenic
1026574970 7:71564475-71564497 TGGGGTTTCACATGTTGGCCAGG + Intronic
1026682808 7:72481141-72481163 CGGGTTTTGCCATGTTGTCCAGG + Intergenic
1026684843 7:72500469-72500491 CAGGGTTTCACCTGTTGGCCAGG + Intergenic
1027140988 7:75657337-75657359 CAGGGTTTCACATGTTGGCCAGG - Intronic
1027194801 7:76022466-76022488 CGGGGATCTTGCTGTTGTCCAGG - Intronic
1027381318 7:77612960-77612982 TGGGGTTTTGCATGTTGGCCAGG + Intronic
1027404852 7:77849331-77849353 CGGGGTTTCATCAGTTGGCCAGG + Intronic
1028472582 7:91221078-91221100 CTGGGTTTTGCCGGTTGCCCAGG + Intergenic
1028558322 7:92146424-92146446 TGGGGTTTTGCATGTTGGCCAGG - Intronic
1028661236 7:93278395-93278417 CAGGGTTTTGCATGTTGTCCAGG - Intronic
1028738133 7:94241016-94241038 CTGGTTTTTACCAGTTTTCCAGG - Intergenic
1028915619 7:96255659-96255681 AGGGTTTTGCCCTGTTGTCCAGG - Intronic
1029265354 7:99335035-99335057 CAGGGTTTCACCTGTTAGCCAGG + Intronic
1029352661 7:100025892-100025914 CGGGTTTTAACATGTTGGCCAGG - Intronic
1029397355 7:100317412-100317434 CGGGGTTTGCCATGTTGGCCAGG - Intronic
1029602489 7:101576690-101576712 TGGGGTTTTGCGTGTTGGCCAGG + Intergenic
1029625230 7:101716571-101716593 TGGGGTTTCACATGTTGGCCAGG - Intergenic
1029689042 7:102168454-102168476 TGGGGTTTCACATGTTGGCCAGG - Intronic
1029729690 7:102431316-102431338 TGGGGTTTTACCAGTTGACCTGG + Intergenic
1029845669 7:103409898-103409920 CGGGGTTTCACTTGTTAGCCAGG + Intronic
1029852986 7:103484069-103484091 GGGGTTTTGACATGTTGTCCAGG + Intronic
1030023713 7:105301248-105301270 CGGGGTTTCACGTGTTAGCCAGG - Intronic
1030205227 7:106945875-106945897 AGGGTTTTATCCTGTTGTCCAGG + Intergenic
1030382520 7:108828570-108828592 CGGGGTTTTACATGTTGCCCAGG + Intergenic
1030632177 7:111907917-111907939 CAGGGTTTTGCCATTTGTCCAGG + Intronic
1031261039 7:119520712-119520734 CAGGGTTTCACATGTTGGCCAGG + Intergenic
1031329752 7:120450217-120450239 CGGGGTTTCACCATTTGGCCAGG - Intronic
1031799569 7:126224745-126224767 TGGGGTTTCACATGTTGGCCAGG + Intergenic
1032000454 7:128261770-128261792 CGGGGTTTTGCCATTTGGCCAGG - Intergenic
1032003056 7:128278100-128278122 CAGGGTTTCACGTGTTGGCCAGG - Intergenic
1032009732 7:128336937-128336959 TGGGGTTTTGCATGTTGGCCAGG + Intronic
1032054115 7:128671228-128671250 CGGGGTTTCACCCGTTGACCAGG + Intergenic
1032102026 7:128988165-128988187 CGAGGTTTCGCCTGTTGGCCAGG + Intronic
1032165876 7:129544272-129544294 TGGGGTTTCACATGTTGGCCAGG - Intergenic
1032181764 7:129685524-129685546 CAGGGTCTTACATGTTGCCCAGG - Intronic
1032337693 7:131041700-131041722 CGGGGTTTCACATGTTGACCAGG - Intergenic
1032421332 7:131782301-131782323 CGGGGTTTCACATATTGGCCAGG - Intergenic
1032567963 7:132967801-132967823 CAGGGTCTTACTTGTTGCCCAGG - Intronic
1033119708 7:138656849-138656871 GGGGTTTTTCCATGTTGTCCAGG - Intronic
1033159547 7:138983314-138983336 CGGGGTTTGCCATGTTGGCCAGG - Intergenic
1033290379 7:140078103-140078125 CAGGGTTTCACCTGTTAGCCAGG + Intergenic
1033677873 7:143561635-143561657 CAGGGTTTCACATGTTGCCCAGG - Intergenic
1033693964 7:143767802-143767824 CAGGGTTTCACATGTTGCCCAGG + Intergenic
1033919348 7:146370228-146370250 TGGGGTTTCACCTATTGGCCAGG - Intronic
1034126853 7:148680147-148680169 TGGGGTTTCGCCTGTTGGCCAGG - Intergenic
1034154680 7:148946698-148946720 AGGGGTTTCACATATTGTCCAGG - Intergenic
1034216648 7:149412612-149412634 CGGGGTTTCACGTGTTAGCCAGG - Intergenic
1034271971 7:149807649-149807671 CGGGGTTTCACCATTTGGCCAGG + Intergenic
1034320907 7:150180701-150180723 CGGGGTTTCACGTGTTAGCCAGG + Intergenic
1034633140 7:152546369-152546391 CGGGGTTTCACCTGTTGGCTAGG + Intergenic
1034634033 7:152553394-152553416 CTGGGTTTCACCTGTTGGTCAGG + Intergenic
1034771837 7:153786544-153786566 CGGGGTTTCACGTGTTAGCCAGG - Intergenic
1034912518 7:155009061-155009083 TGGGGTTTTACCATTTGGCCAGG - Intergenic
1035191614 7:157174169-157174191 CGGGGTTTGCCATGTTGGCCAGG - Intronic
1035245338 7:157559348-157559370 CAGGGGTCTCCCTGTTGTCCTGG - Intronic
1035257331 7:157639225-157639247 TGGGGTTTCGCCTGTTGGCCAGG + Intronic
1035337140 7:158137223-158137245 CGGGGTTTCGCCTGTTGGCCAGG - Intronic
1035688519 8:1544092-1544114 CAGGGTTTGCCATGTTGTCCAGG + Intronic
1035876103 8:3191262-3191284 GGGGGTTTCACCTGTTGGCCAGG - Intronic
1035929503 8:3764934-3764956 CAGGGTTTCACATGTTGACCAGG + Intronic
1036200572 8:6767934-6767956 CGGGGTCTCACCTGTTGCACAGG - Intergenic
1036798752 8:11774182-11774204 TGGGGTTTAACATGTTGGCCAGG - Intronic
1036926743 8:12914309-12914331 TGGGGTTTCACATGTTGGCCAGG - Intergenic
1036937094 8:13013757-13013779 TGGGGTTTCACATGTTGGCCAGG - Intronic
1036959892 8:13232522-13232544 CGGGGTTTCACATGTTGGCCAGG + Intronic
1037018386 8:13937081-13937103 CGGGGTTTCCCATGTTGGCCAGG - Intergenic
1037221108 8:16522948-16522970 CGGGGTTTCACATGTTGGCCAGG - Intronic
1037770952 8:21799408-21799430 CGGGGTTTCACATGTTAGCCAGG + Intronic
1037881621 8:22576242-22576264 TGGGGTTTCACATGTTGGCCAGG + Intergenic
1037952947 8:23030500-23030522 CGGGGTTTCTCATGTTGCCCAGG + Intronic
1037981781 8:23259549-23259571 TGGGGTTTCACCTGTTGGTCAGG + Intronic
1038400124 8:27278245-27278267 CGGGGTCTCACTTGTTGCCCAGG + Intergenic
1038531953 8:28325460-28325482 CGGGGCTTCACATGTTGGCCAGG - Intronic
1038557051 8:28529108-28529130 TGGGGTTTCACTTGTTGCCCAGG + Intronic
1038636693 8:29293059-29293081 TGGGGTTTGCCATGTTGTCCAGG - Intergenic
1038658992 8:29480461-29480483 CAGGGTTTCACATGTTGGCCAGG - Intergenic
1038733164 8:30145664-30145686 CAGGGTTTCACATGTTGGCCAGG - Intronic
1038940944 8:32304829-32304851 CGGGGTTTCTCCTGTTGGCCAGG - Intronic
1039463417 8:37764510-37764532 TGGGGTTTCACCTTTTGGCCAGG + Intronic
1039487611 8:37923740-37923762 TGGGGTTTCACATGTTGGCCAGG + Intergenic
1039503872 8:38037504-38037526 CGGGGTTTACCATGTTGGCCAGG + Intronic
1039512276 8:38101801-38101823 CGGGGTTTACCGTGTTGGCCAGG - Intergenic
1039519619 8:38159206-38159228 CGGGGTTTACCATGTTGGCCAGG + Intergenic
1039546850 8:38416644-38416666 TGGGGTTTCACCTGTTGGCCAGG + Intronic
1039722715 8:40181956-40181978 AAGGGCTTTCCCTGTTGTCCAGG + Intergenic
1039788285 8:40853361-40853383 TGGGGTTTCACATGTTGGCCAGG - Intronic
1039807371 8:41012152-41012174 GGGGTTTTTCCATGTTGTCCAGG + Intergenic
1039859574 8:41445376-41445398 CGGAGTTTCACATGTTGGCCAGG - Intergenic
1039931272 8:41992008-41992030 TGGGGTTTTGCTTGTTGCCCAGG - Intronic
1039984430 8:42435923-42435945 CGGGGTTTCCCATGTTGGCCAGG - Intronic
1040003947 8:42602189-42602211 CGAGGTTTCACCTGTTGGTCAGG + Intergenic
1040462776 8:47664714-47664736 TGGGGTTTTCCATGTTGCCCAGG - Intronic
1040645658 8:49393305-49393327 CAGGGTTTCACCTGTTAGCCAGG - Intergenic
1040777083 8:51057990-51058012 CGGGGTCTCACCTGTTGCCCAGG + Intergenic
1040921657 8:52627154-52627176 CGGGTTTTTACCTGTTGGCTAGG - Intronic
1040950507 8:52934611-52934633 CAAGGTTTCACCTGTTGGCCAGG + Intergenic
1040952289 8:52949757-52949779 GGGGTTTTTCCGTGTTGTCCAGG + Intergenic
1041061146 8:54035809-54035831 CAGGGTTTCACATGTTGGCCAGG + Intergenic
1041662777 8:60415185-60415207 CGGGGTTTCACATGTTGGCCAGG - Intergenic
1042065832 8:64874952-64874974 CGGGGTTTCACGTGTTAGCCAGG - Intergenic
1042120732 8:65485354-65485376 CGGGGTTTCACATGTTGCCCAGG + Intergenic
1042266459 8:66913771-66913793 TGGGGTTTCACCATTTGTCCAGG - Intronic
1042288155 8:67137170-67137192 TGGGGTTTTGCATGTTGGCCAGG + Intronic
1042435166 8:68755866-68755888 CGGGGTTTCACCTGTTAGCCAGG - Intronic
1042563490 8:70091166-70091188 CGGGGTTTGTCATGTTGCCCAGG + Intergenic
1042866150 8:73358184-73358206 TGGGGTTTCACCTATTGGCCAGG + Intergenic
1042965261 8:74344523-74344545 CGGGGTTTACCATGTTGGCCAGG - Intronic
1043445764 8:80317918-80317940 CGGGGTTTCACCAGTTGGCCAGG + Intergenic
1044019739 8:87090947-87090969 CAGGGTTTCACATGTTGGCCAGG - Intronic
1044057998 8:87596516-87596538 CGGGGTTTCGCATGTTGGCCAGG + Intronic
1044523449 8:93225441-93225463 CGGGGTTTCACGTGTTAGCCAGG - Intergenic
1044556778 8:93571081-93571103 CGGGGTTTTGCCATTTGGCCAGG - Intergenic
1044569429 8:93700662-93700684 CGGGCTGTTACCGGTTTTCCAGG - Exonic
1044580090 8:93817338-93817360 TGGGGTTTTCCATGTTGGCCAGG - Exonic
1044651644 8:94501764-94501786 CGGGGTTTCAGCTGGTGCCCAGG - Intronic
1044885032 8:96767833-96767855 CAGGGTTTCACATGTTGGCCAGG + Intronic
1044978383 8:97690018-97690040 CAGAGTTTTGCTTGTTGTCCAGG + Intronic
1044982758 8:97732705-97732727 CAGGGTTTTGCATGTTGCCCAGG - Intergenic
1045149235 8:99384868-99384890 CAGGGTTTCACCTGTTGGCCAGG + Intronic
1045156125 8:99474376-99474398 CAGGGTTTCACCTGTTGACCAGG + Intronic
1045361301 8:101436195-101436217 TGGGGTTTCACATGTTGGCCAGG + Intergenic
1045484482 8:102620383-102620405 TGGGGTTTCACCTGTTGGGCAGG - Intergenic
1046501067 8:115077591-115077613 CGGGTTTTACCATGTTGTCCAGG - Intergenic
1046645411 8:116780754-116780776 CGGGGTTTTGGATGTTGCCCAGG + Intronic
1046749586 8:117913030-117913052 AGGGTTTTAACATGTTGTCCAGG - Intronic
1046898990 8:119503331-119503353 CGGGGTTTCACCTATTGGCCAGG - Intergenic
1046951076 8:120020270-120020292 CGGGGTTTCACCAGTTGGCCAGG + Intronic
1047210819 8:122838766-122838788 CGGGGTTTCACCTGTTGGCCAGG + Intronic
1047361428 8:124172726-124172748 AGGGGTTTTCCATGTTGGCCAGG - Intergenic
1047637290 8:126778192-126778214 TGGGGTTTTACTATTTGTCCAGG - Intergenic
1048260346 8:132939865-132939887 CGGGGTTTCACCATTTGGCCCGG + Intronic
1048652790 8:136497993-136498015 TAGGGTTTCACCTGTTGGCCAGG - Intergenic
1049610147 8:143551298-143551320 CAGGGTTTCACCAGTTGGCCAGG + Intergenic
1049715682 8:144089908-144089930 TGGGGTTTCACATGTTGGCCAGG + Intergenic
1049852880 8:144843394-144843416 TGGGGTTTCACCTGTTACCCAGG - Intronic
1050223624 9:3425036-3425058 CAGGGTTTTGCCTGTTGCCCAGG - Intronic
1050254490 9:3779977-3779999 AGGGGTTTGACATGTTGGCCAGG - Intergenic
1050344333 9:4671512-4671534 CAGGGTTTCACTTGTTGTCCAGG - Intergenic
1050363718 9:4854861-4854883 CGGGGTTTCACATGTTGGCCAGG - Intronic
1050465425 9:5917825-5917847 CGGGGTCTTCTCTGTTGTCCAGG - Intronic
1050877253 9:10654232-10654254 CGGGGTTTCACCTGTTAGCCAGG - Intergenic
1050980424 9:12004887-12004909 CGGAGTCTTGCCTGTTGCCCAGG - Intergenic
1051202478 9:14643045-14643067 CGGGGTTTCGCCTGTTGGCCAGG - Intronic
1051432473 9:16994133-16994155 CGGGGTTTCCCATGTTGGCCAGG + Intergenic
1051615934 9:19006852-19006874 CGGGGTTTCACCATTTGGCCAGG - Intronic
1051894491 9:21974079-21974101 CGAGGTTTCACCTGTTGGCCAGG + Intronic
1052967619 9:34352722-34352744 CGGGGTTTCACCTGTTGGTCAGG - Intergenic
1053012905 9:34645301-34645323 CGGGGTTTCACATGTTGGCCAGG - Intronic
1053061254 9:35033983-35034005 CGGGGTTTTCCATGTTAGCCAGG - Intergenic
1053137008 9:35657590-35657612 CGGATTTTCACCTGTTGCCCAGG - Intergenic
1053252926 9:36590111-36590133 CGGGGTTTCACGTGTTAGCCAGG + Intronic
1054163556 9:61698328-61698350 TGGGGTTTTACATGTTGGTCAGG + Intergenic
1054774812 9:69116281-69116303 CGAGGTTTCACCAGTTGGCCAGG - Intergenic
1054914879 9:70486488-70486510 CAGGGTCTCATCTGTTGTCCAGG + Intergenic
1055037886 9:71837600-71837622 CGGAGTTTTGCTTGTTGCCCAGG - Intergenic
1055085345 9:72308180-72308202 CGGGGTTTCCCATGTTGGCCAGG - Intergenic
1055241482 9:74191632-74191654 CGGGGTTTCGCGTGTTGGCCAGG - Intergenic
1055250482 9:74297473-74297495 CAGGGTTTCACCTGTTGACTAGG + Intergenic
1055301149 9:74884295-74884317 CGGGGTTTCACCTGTTATGCAGG - Intronic
1055317904 9:75052684-75052706 TGGGGTTTCTCCTGTTGGCCAGG + Intergenic
1055558491 9:77499657-77499679 CGGGGTTTCCCATGTTGGCCAGG - Intronic
1055947419 9:81703964-81703986 CAGGGTTTTGCCTGTTGGCCAGG - Intergenic
1056060199 9:82877528-82877550 AGGGGTTTCACATGTTGGCCAGG - Intergenic
1056213568 9:84387683-84387705 CAGGGTTTTGCATGTTGTCCAGG + Intergenic
1056733074 9:89182319-89182341 TGGGGTTTCACCTGTTGGCCAGG - Intergenic
1056911746 9:90707284-90707306 TGGAGTTTCACCTGTTGTCTAGG - Intergenic
1057117274 9:92537467-92537489 CGGGGTTTCACATGTTGGCCAGG - Intronic
1057413399 9:94839279-94839301 CGGGGTTTCACATGTTAGCCAGG + Intronic
1057621099 9:96636060-96636082 CAGGGTTTTGCCTGTTGGCCAGG + Intergenic
1057621765 9:96642734-96642756 CGGGGTTTCACCAGATGGCCAGG + Intronic
1057835491 9:98441556-98441578 CAGGGTTTCACCTGTTGGCTAGG + Intronic
1058048452 9:100382382-100382404 CGGGGTTTCTCCTGTTGGTCAGG - Intergenic
1058328695 9:103730612-103730634 TGGGATTTAACTTGTTGTCCTGG - Intergenic
1058714859 9:107714432-107714454 CAGAGTTTCACCTGTTGGCCAGG - Intergenic
1058815176 9:108676350-108676372 TGGGGTTTCACATGTTGCCCAGG + Intergenic
1058853995 9:109041937-109041959 CGGGGTTTTCCCTGTTGCCCAGG - Intronic
1058868726 9:109184408-109184430 TGGGGTTTTACATGTTGGCCAGG + Intronic
1058906339 9:109485312-109485334 CGGGGTTTCACCTGTTAGCCAGG - Intronic
1058968053 9:110055384-110055406 TGAGGTTTCACATGTTGTCCAGG + Intronic
1058990613 9:110252668-110252690 CGGAGTTTCACTTGTTGCCCAGG + Intronic
1059031358 9:110700828-110700850 CTGGTTTACACCTGTTGTCCTGG + Intronic
1059114458 9:111588421-111588443 TGGGGTTTCACCTGTTAGCCAGG + Intronic
1059114528 9:111588849-111588871 CGGGGTTTACCACGTTGTCCAGG + Intronic
1059153864 9:111972853-111972875 TGGGGTTTCACCTGTTAGCCAGG - Intergenic
1059182085 9:112225853-112225875 CAGGGTTTTACCATTTGCCCAGG - Intronic
1059193095 9:112345570-112345592 TGGGGTTTTACCATTTGGCCAGG + Intergenic
1059260110 9:112967590-112967612 CGGGGTTTACTCTGTTGCCCAGG + Intergenic
1059319792 9:113460325-113460347 CGGGGTTTTACCTGTTAGCCAGG - Exonic
1059462123 9:114438642-114438664 TGGGGTTTCACCTGTTAGCCAGG + Intronic
1059616289 9:115954976-115954998 CAGGGTTTCACATGTTGTCCAGG + Intergenic
1060090497 9:120738607-120738629 CGGGGTTTCACATGTTGGCCAGG + Intergenic
1060117638 9:120956102-120956124 TGGGGTCTTACATGTTGGCCAGG - Intronic
1060641809 9:125245143-125245165 CGGGGTTTTCCATTTTGACCAGG - Intergenic
1060692560 9:125677245-125677267 TGGGGTTTCACATGTTGACCAGG - Intronic
1060802559 9:126554014-126554036 TGGGGTTTCACCAGTTGACCAGG + Intergenic
1060863207 9:126973343-126973365 GAGTGTCTTACCTGTTGTCCAGG - Intronic
1060904985 9:127296660-127296682 CAGGGTTTCACATGTTGGCCAGG + Intronic
1061093068 9:128437641-128437663 CTGGGTTTTGCATGTTGCCCAGG + Intergenic
1061098204 9:128472396-128472418 TGGGGTTTTAGCTGTTGGCCAGG + Intronic
1061145373 9:128794664-128794686 CGGGGTTTCACCAGTTGGCCAGG + Intronic
1061174132 9:128982237-128982259 TGGGGTTTTCCATGTTGACCAGG - Intronic
1061198682 9:129123278-129123300 TGGGGTTTCACATGTTGGCCAGG - Intronic
1061288217 9:129636189-129636211 CGGGGTTTCACCTGTTAGCCAGG - Intronic
1061371041 9:130197769-130197791 CAGGGTTTCACATGTTGGCCAGG - Intronic
1061508770 9:131047937-131047959 CGGGGTTTGCCATGTTGACCAGG + Intronic
1061530267 9:131206335-131206357 CGGGGTTTCACATGTTGCCCAGG + Intronic
1061688958 9:132308945-132308967 CGGGGTTTCACCTATTGGCCAGG - Intronic
1061694579 9:132362680-132362702 CAGGGTTTCACATGTTGGCCAGG - Intergenic
1061769644 9:132908637-132908659 TGGGGTTTTGCATGTTGCCCAGG + Intronic
1061804970 9:133132828-133132850 TGGGGTTTTACATGTTGGCCAGG + Intronic
1062061633 9:134499819-134499841 TGGGGTTTCACATGTTGGCCAGG + Intergenic
1062291253 9:135796038-135796060 TGGGGTTTCACATGTTGGCCAGG - Intergenic
1062422394 9:136489199-136489221 GGGGGTTTCACCAGTTGACCAGG + Intergenic
1062469254 9:136695229-136695251 CTGGGTTTCACATGTTGGCCAGG - Intergenic
1203522126 Un_GL000213v1:54366-54388 CGGCGTTGTCCCTGGTGTCCTGG - Intergenic
1185472715 X:394251-394273 GGGGTTTTGACATGTTGTCCAGG + Intergenic
1185578569 X:1193002-1193024 TGGGGTTTCACATGTTGGCCAGG + Intronic
1185731530 X:2465609-2465631 CGGGGTTTCACCTGTTGGGCAGG - Intronic
1185733082 X:2476810-2476832 CGGGTTTTTCCATGTTGGCCAGG - Intronic
1185755975 X:2653287-2653309 CGGGGTTTCACATGTTGGCCAGG + Intergenic
1185775248 X:2797838-2797860 AGGGTTTTTCCATGTTGTCCAGG - Intronic
1185934237 X:4237679-4237701 AGGGGTTTTCCCTGTTGTCCAGG + Intergenic
1186456275 X:9712526-9712548 CAGGGTTTCACATGTTGGCCAGG + Intronic
1186663589 X:11695174-11695196 TGGGGTTTCACATGTTGGCCAGG - Intergenic
1186957397 X:14698485-14698507 CAGGGTTTCACATGTTGGCCAGG - Intronic
1187423819 X:19159851-19159873 CGGGATTTCACATGTTGGCCAGG - Intergenic
1187499686 X:19829553-19829575 CAGGGTTTCACATGTTGGCCAGG - Intronic
1187662719 X:21568094-21568116 GGGGTTTTGACATGTTGTCCAGG - Intronic
1187862988 X:23699476-23699498 CAGGGTTTCACTTGTTGCCCAGG + Intergenic
1188010232 X:25047275-25047297 CTGGGTTTTGCCTGTGGTTCTGG - Intergenic
1188175491 X:26983804-26983826 CGGGGTTCAACATGTTGGCCAGG + Intergenic
1188506621 X:30890448-30890470 CAGGGTTTCTCCTGTTGACCAGG + Intronic
1188641530 X:32511328-32511350 CGGGGTTTCAACTGTTGGCCAGG - Intronic
1188726606 X:33591762-33591784 TGGGGTTTCACGTGTTATCCAGG - Intergenic
1189272834 X:39763766-39763788 CGGGGTTTCCCATGTTGTCCAGG + Intergenic
1189385795 X:40535981-40536003 CAGGGTTTCACATGTTGCCCAGG - Intergenic
1189514414 X:41697990-41698012 CGGGGTTTCATATGTTGGCCAGG + Intronic
1189802755 X:44707149-44707171 CGGAGTTTCACCAGTTGGCCAGG + Intergenic
1189951380 X:46234681-46234703 TGGGGTCTCACCTGTTGCCCAGG - Intergenic
1189957584 X:46291687-46291709 CGGGAATTTACCTGTTTTCTAGG + Intergenic
1190078837 X:47338998-47339020 CGGGGTTTCACGTGCTGCCCAGG + Intergenic
1190388950 X:49912450-49912472 TGGGGTTTCACCTTTTGGCCAGG - Intergenic
1190411312 X:50139743-50139765 CTGGGTTTTCCATGTTGCCCAGG - Intergenic
1190692331 X:52921762-52921784 CGGGGTTTCACCTGTTAGCCAGG + Intergenic
1190763233 X:53454018-53454040 CGGGGTTTCGCATGTTGCCCAGG + Intergenic
1192012865 X:67293822-67293844 CGGGGTTTCACATGTTAGCCAGG + Intergenic
1192122670 X:68471703-68471725 CGGGGTTTCTCATGTTGGCCAGG + Intergenic
1192125230 X:68495659-68495681 CAGGGTTTCACCTGTTGCCCAGG + Intergenic
1192378153 X:70586024-70586046 CGGAGTTTTGCTTGTTGCCCAGG - Intronic
1192402879 X:70854708-70854730 CAGGGTCTTGCCTGTTGCCCAGG - Intronic
1192454141 X:71263405-71263427 CGGGGTTTCACATGTTAGCCAGG - Intergenic
1192638579 X:72843445-72843467 CGGGGTTTCACATGTTGGCCAGG - Intronic
1192643135 X:72877363-72877385 CGGGGTTTCACATGTTGGCCAGG + Intronic
1192751486 X:73997047-73997069 AGGGGTTTCACCTTTTGGCCAGG + Intergenic
1192972098 X:76243631-76243653 GGGGTTTTTACATGTTGGCCAGG - Intergenic
1193138864 X:78004555-78004577 CGGGGTTTCACCTGTTGCCTGGG - Intronic
1193353950 X:80494889-80494911 GGGGTTTTTCCCTGTTGGCCAGG + Intergenic
1193487848 X:82108545-82108567 CGGGGTTCTCCATGTTGGCCAGG + Intergenic
1193525499 X:82583220-82583242 CGGGGTTTCCCATGTTGGCCAGG + Intergenic
1193718087 X:84954995-84955017 TGGGGTTTCACCAGTTGGCCAGG - Intergenic
1193995398 X:88360922-88360944 CAGGGTTTCACATGTTGGCCAGG + Intergenic
1194057910 X:89160816-89160838 CGGGGTTTCACCATTTGCCCAGG + Intergenic
1194092557 X:89597359-89597381 CGGGGTTTTCCATGTTGCCTAGG + Intergenic
1194578195 X:95639452-95639474 GGGGGTTTCACATGTTGGCCAGG + Intergenic
1194990876 X:100545024-100545046 CGGGGTTTTCCATGTTGGTCGGG + Intergenic
1195066604 X:101243233-101243255 CGGAGTTTTGCATGTTGGCCAGG - Intronic
1195472145 X:105242906-105242928 CGGAGTTTCACATGTTGGCCAGG - Intronic
1195895405 X:109741212-109741234 TGGGGTTTCGCCTGTTGGCCAGG + Intergenic
1196202008 X:112897114-112897136 CGGGGTTTCACATGTTAGCCAGG - Intergenic
1196222629 X:113129335-113129357 CGGGGTTTCACCTGTTTGCCAGG + Intergenic
1196408783 X:115394411-115394433 TGGGGTTTCACCTGTTGGCTAGG + Intergenic
1196418414 X:115498110-115498132 CGGGGTTTTCCATGTTGGCCAGG - Intergenic
1196726216 X:118898182-118898204 CAGGGTTTCACATGTTGGCCAGG + Intergenic
1196808230 X:119607242-119607264 GTGGGTTTTCTCTGTTGTCCTGG + Intergenic
1196842050 X:119868146-119868168 CGGGGGTCTCCCTGTTGCCCAGG + Intergenic
1197220857 X:123912442-123912464 CAGGGTTTTGCCTTTTGTCCAGG - Exonic
1197631211 X:128861395-128861417 CTGGTTGTTACCTATTGTCCTGG - Intergenic
1197851421 X:130864820-130864842 TGGGGTTTCACATGTTGGCCAGG - Intronic
1198053308 X:132969646-132969668 AGGGTTTTGACATGTTGTCCAGG + Intergenic
1198145721 X:133855355-133855377 TGAGGTCTTACATGTTGTCCAGG + Intronic
1198249285 X:134864214-134864236 CAGGGTTTCACATGTTGGCCAGG + Intergenic
1198364261 X:135924859-135924881 AGGGGTTTGCCATGTTGTCCAGG - Intergenic
1199154358 X:144529240-144529262 GGGGTTTTTCCCTGTTGGCCAGG - Intergenic
1200110661 X:153739161-153739183 CGGGGTTTGCCATGTTGCCCAGG - Intronic
1200427532 Y:3038006-3038028 TGGTGTTTTACATGTTGGCCAGG + Intergenic
1200445204 Y:3253466-3253488 CGGGGTTTTCCATGTTGCCTAGG + Intergenic
1200812024 Y:7495626-7495648 AGGGGTTTCACTTGTTGCCCAGG - Intergenic
1201295023 Y:12454944-12454966 CAGGGTTTCACTTGTTGCCCGGG - Intergenic
1201411020 Y:13699554-13699576 CAGGGTTTCACATGTTGGCCAGG + Intergenic
1201417530 Y:13762253-13762275 CAGGGTTTTGCCAGTTGGCCAGG - Intergenic
1201701029 Y:16882499-16882521 CGGGTTTTTCCATGTTGTCCAGG - Intergenic