ID: 1169241680

View in Genome Browser
Species Human (GRCh38)
Location 20:3986622-3986644
Sequence CTGCATGCACACTCATGCCT GGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 250
Summary {0: 1, 1: 0, 2: 1, 3: 23, 4: 225}

Found 1 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1169241680_1169241682 26 Left 1169241680 20:3986622-3986644 CCCAGGCATGAGTGTGCATGCAG 0: 1
1: 0
2: 1
3: 23
4: 225
Right 1169241682 20:3986671-3986693 AGAGTCTCACTTTGTCACCCAGG 0: 580
1: 13177
2: 52297
3: 111145
4: 170397

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1169241680 Original CRISPR CTGCATGCACACTCATGCCT GGG (reversed) Intronic
900130753 1:1086179-1086201 CTGCAGGCTCAGCCATGCCTGGG + Intronic
902169294 1:14598080-14598102 CTGGATGCACACACAGGGCTAGG + Intergenic
902651164 1:17838553-17838575 CTCCATGCACACACATCCCTGGG + Intergenic
903150306 1:21403336-21403358 AGGCATGCACAACCATGCCTGGG + Intergenic
904283554 1:29438412-29438434 CTGCATCCAGACTCCAGCCTGGG - Intergenic
905013300 1:34761185-34761207 CTACCTGCCCACTCAGGCCTTGG - Exonic
905266054 1:36755166-36755188 CTCCAGGCACCCTCATGCCCAGG - Intergenic
905281308 1:36851121-36851143 CTGCATGCCCACTCTGTCCTTGG + Intronic
905343381 1:37294578-37294600 CTGCATGCACATCCAAGTCTGGG + Intergenic
905856173 1:41316165-41316187 CTCCATGCACACTTGTGGCTGGG - Intergenic
905971089 1:42142989-42143011 CTGCACCCACTCCCATGCCTTGG + Intergenic
906228635 1:44141407-44141429 CTGCATGCACTAACATCCCTGGG - Intergenic
906294862 1:44643464-44643486 CTGCATGCACAACCAAGCCCAGG - Intronic
908111692 1:60904485-60904507 CAGCCTGCAAACTCAGGCCTGGG + Intronic
908693956 1:66815766-66815788 CTGCATTAACATTCATGACTGGG - Intronic
911233746 1:95387368-95387390 ATGCTTGCACATACATGCCTAGG + Intergenic
916312036 1:163408431-163408453 GTGCATGCACACACACGCCCAGG + Intergenic
917067543 1:171113184-171113206 CTGTATTCACATTCATCCCTGGG + Intronic
917927517 1:179801413-179801435 CTCCATGCTCACTCATCCCTGGG - Intronic
918212601 1:182364636-182364658 CTCCATGCAAACTCCTGACTTGG - Intergenic
919982205 1:202649143-202649165 CTGCATGGCCTCTGATGCCTGGG - Intronic
920241415 1:204554385-204554407 ACACATGCACACTCATGACTGGG - Exonic
921622357 1:217339862-217339884 GTGCATGCACGCACATGCCAAGG - Intergenic
923052751 1:230400154-230400176 CACCAGGCACACTCCTGCCTCGG + Intronic
1063602770 10:7497217-7497239 CTGTCTGCACTCTCAGGCCTGGG + Intergenic
1064553782 10:16528109-16528131 CTGAATGCACCCTCATTCCCGGG - Intergenic
1066307505 10:34160866-34160888 CTGCATGCTCCCTCAGACCTAGG - Intronic
1066520388 10:36211842-36211864 CTGCTGGCAAACTCATTCCTTGG + Intergenic
1067089590 10:43259818-43259840 CTGAATGCACACTCCCACCTTGG - Intronic
1067716739 10:48696153-48696175 CAGCAGGCACACTCAGCCCTTGG + Intronic
1069469985 10:68679138-68679160 CTGCACTCACACTCCGGCCTGGG + Intronic
1070673130 10:78392231-78392253 TTGCAAGCACAGTCATTCCTGGG - Intergenic
1072687791 10:97549102-97549124 CTGCCCGCACACTGAGGCCTTGG + Intronic
1072901047 10:99407203-99407225 GTGCATGCACGCACATGCCTTGG + Intronic
1074404742 10:113171254-113171276 CTCCATGCACTCTCCAGCCTGGG - Intergenic
1075286962 10:121195312-121195334 CAGCATGCACAGGCCTGCCTTGG + Intergenic
1075400610 10:122159019-122159041 CTGCCTGCATATTGATGCCTTGG - Intronic
1076920868 10:133454130-133454152 CTGCAGGGACCCTCATGCCCCGG - Intergenic
1077351006 11:2093170-2093192 CTCCAGGCACACTCTGGCCTCGG - Intergenic
1079783800 11:24644276-24644298 CTGCATGCACACTGCTGTGTTGG + Intronic
1080233068 11:30039723-30039745 AGGCATGCACCATCATGCCTGGG - Intergenic
1080852565 11:36082648-36082670 GTGCATGCACACTGATACCAGGG - Intronic
1081567558 11:44269499-44269521 GTGCACGCACACACATGCTTAGG - Intronic
1081919454 11:46759414-46759436 CAGGATGCCCACTCATGCTTCGG + Exonic
1082886241 11:58086043-58086065 AATCATGCACACTAATGCCTTGG + Intronic
1084264392 11:67997437-67997459 CTGGATGCCCACGCCTGCCTCGG + Intronic
1086061839 11:82708029-82708051 TTGTAAGCACACTCAAGCCTTGG + Intergenic
1086759531 11:90610912-90610934 CCACATGCACACACATGCCCAGG - Intergenic
1088550597 11:111009051-111009073 CCGCATGAACACTCAGGCCTTGG - Intergenic
1088723715 11:112616693-112616715 CTGCATACACACTCACGCCCTGG - Intergenic
1089125226 11:116172011-116172033 CTGCAGACAGCCTCATGCCTGGG - Intergenic
1091850479 12:3693122-3693144 CTGCCTGCACACACATGCACCGG + Intronic
1093157512 12:15704891-15704913 GTGCATGCGCACGCATGCCAAGG - Intronic
1093411044 12:18867469-18867491 CTGGCAGCACTCTCATGCCTGGG - Intergenic
1093765028 12:22952866-22952888 GTGCATGCACACACCTGGCTGGG + Intergenic
1093873088 12:24316049-24316071 CTGCAGGCACAGCCATGCCAGGG + Intergenic
1095890883 12:47234673-47234695 CTGCTAGCACTCTCATCCCTGGG + Intronic
1097369956 12:58766255-58766277 CTGCATTCACACTACTGACTAGG + Intronic
1098743695 12:74207302-74207324 CGGCATGCACCACCATGCCTGGG - Intergenic
1100724295 12:97392632-97392654 CTGCATCCATACTGATGCCATGG - Intergenic
1100961451 12:99967383-99967405 CTGCATTCAAACTCAAGACTCGG + Intronic
1101512452 12:105405486-105405508 TTAAATGCACACCCATGCCTGGG - Intergenic
1101514329 12:105420204-105420226 CCTCATGCTCACTCATGGCTGGG + Intergenic
1103869627 12:124082041-124082063 CTGCATCCACACTCACGCATAGG - Intronic
1104047685 12:125174596-125174618 CTGCATGCCCACCCCTGGCTAGG + Intergenic
1106843257 13:33708919-33708941 AATCATGCACACTAATGCCTTGG - Intergenic
1107300173 13:38957958-38957980 CTGCATGCACAGCCTTGTCTCGG + Intergenic
1108574401 13:51779081-51779103 CTGCATGCCAACCCATGCCAAGG + Intronic
1110271912 13:73600594-73600616 CTGCATTCACACTCTTGAATGGG - Intergenic
1110757656 13:79194909-79194931 CTGCATTCAGCCGCATGCCTAGG - Intergenic
1114149046 14:20014605-20014627 CTGCATGGACACCTATGTCTTGG - Exonic
1115795290 14:36928558-36928580 ATGCATGCACACTTAGGTCTGGG + Intronic
1116655801 14:47652068-47652090 CACCATGCACCCTCTTGCCTTGG - Intronic
1118071309 14:62249409-62249431 CTGCATGCATACCCAGGCCTGGG + Intergenic
1118827053 14:69393446-69393468 ATGCATGCACACACATCCCATGG + Intronic
1119825236 14:77652170-77652192 CTGCAACCACACTCCAGCCTGGG + Intergenic
1121206862 14:92176669-92176691 CTTCATGCCCAGTCATGCCCTGG + Intergenic
1123706841 15:22956729-22956751 CCGCATGCACACTGCTGTCTCGG - Intronic
1123827404 15:24096191-24096213 CAGCATGCAGATTCATGGCTTGG - Intergenic
1123851953 15:24366692-24366714 CAGCATGCAGACTCACGGCTTGG - Intergenic
1123856878 15:24421621-24421643 CAGCATGCAGACTCATGGCTTGG - Intergenic
1123861438 15:24471518-24471540 CAGCATGCAGACTCATGGCTTGG - Intergenic
1124025422 15:25961169-25961191 CTGCATGCCTACTGATGCTTTGG + Intergenic
1125415506 15:39448177-39448199 CTGCATGGAGACTCATCCATGGG - Intergenic
1126595851 15:50383715-50383737 CTGCATACATACTGTTGCCTGGG + Intergenic
1127969378 15:63946585-63946607 CAGCATGAACAGTCATCCCTGGG + Intronic
1128754514 15:70172339-70172361 CTGCAAGCTCTCTCAAGCCTTGG + Intergenic
1129152807 15:73699660-73699682 CCACATGCACACCCATGCCAGGG - Exonic
1129387254 15:75202689-75202711 CTGCGTGCACACGTATGCCCGGG + Intronic
1129714255 15:77837831-77837853 CTGCATGCGCACCCAGGCCAGGG - Intergenic
1130273594 15:82465045-82465067 CTGCATGCTCAGCCATGCCATGG - Intergenic
1130465946 15:84192416-84192438 CTGCATGCTCAGCCATGCCATGG - Intergenic
1130498319 15:84481120-84481142 CTGCATGCTCAGCCATGCCATGG + Intergenic
1130588234 15:85197012-85197034 CTGCATGCTCAGCCATGCCATGG - Intergenic
1130837054 15:87661658-87661680 CTACCTCCACACCCATGCCTAGG - Intergenic
1131225568 15:90622120-90622142 CTCCAGGCCCACTCCTGCCTTGG - Intronic
1132470838 16:102068-102090 CTGCATGCACTGTCTTTCCTAGG + Intronic
1133195615 16:4167969-4167991 CTGCATTCCCACTCCAGCCTGGG - Intergenic
1135795882 16:25442114-25442136 CGGCATGCTCACTGATGTCTGGG - Intergenic
1136449916 16:30348057-30348079 CTGAATGCAGCCTCTTGCCTTGG - Intergenic
1137030229 16:35517112-35517134 CTGCAGGCAGACTCATCCCAGGG - Intergenic
1138532892 16:57644624-57644646 ACACATGCACACTCATGCATGGG + Intronic
1138532921 16:57644992-57645014 ACACATGCACACTCATGCATGGG + Intronic
1138959532 16:62012005-62012027 CTGCATGCACATACACACCTTGG - Intronic
1141132782 16:81446574-81446596 CAGAATGCACACTCCTCCCTGGG + Intronic
1141265309 16:82491215-82491237 CTGCATCCACATTCTAGCCTTGG - Intergenic
1141304665 16:82851034-82851056 CTGCATGTACAGGCATCCCTCGG - Intronic
1142259122 16:89034269-89034291 CTACACTCACACTCATGCTTGGG + Intergenic
1144664577 17:17093261-17093283 CTGCATGAACTCTCCTGCATTGG + Intronic
1144769467 17:17751635-17751657 CTGCGGGCACACTACTGCCTTGG + Intronic
1147426868 17:40350022-40350044 ATGCATGAACACGCATGCCGTGG + Intronic
1147807757 17:43144284-43144306 CTGAATGAACATTCATGCATGGG + Intergenic
1147864140 17:43541926-43541948 GTGCATGTACACTGGTGCCTCGG - Intronic
1147908665 17:43841025-43841047 TTGCATGCAGACTTATGCCTGGG + Intergenic
1148351886 17:46947132-46947154 CTGCATCCACATTCATGTCAGGG - Intronic
1148834995 17:50461318-50461340 CTGCATGAGCACCCATGCATAGG - Exonic
1149537550 17:57444144-57444166 CTGCAGGGTCACTCAGGCCTTGG - Intronic
1150907387 17:69352175-69352197 ATGCAAGCACACTCCAGCCTGGG + Intergenic
1152370718 17:79886951-79886973 CAGCAGACACACTCCTGCCTTGG - Intergenic
1152731158 17:81971247-81971269 CTGCACTCACACTCCAGCCTGGG - Intergenic
1154052066 18:10970397-10970419 CTGCATGCACACGGGTGCCCAGG + Intronic
1155969607 18:32069864-32069886 CTGATTGCACACTCATGGCACGG + Exonic
1157496310 18:48159953-48159975 CTGCAGGAACAGACATGCCTTGG + Intronic
1161501899 19:4620837-4620859 CTGCATTCACACTTATTTCTTGG - Intergenic
1164960221 19:32421755-32421777 CTGCCTGCACACCCATCCCATGG - Intronic
1167011672 19:46812991-46813013 CACCCTGCACACTCATGCCTCGG + Intergenic
1167012295 19:46816511-46816533 CACCCTGCACACTCATGCCTGGG - Intergenic
1168528403 19:57106553-57106575 CTGCATCCTCCCTCCTGCCTGGG + Intergenic
925478661 2:4246877-4246899 GTTCATGCACACTGCTGCCTTGG + Intergenic
925658726 2:6179980-6180002 ATGCATGCACACACATGCATGGG + Intergenic
927826384 2:26312675-26312697 CTGCATGCGCACACACGCCTCGG + Intronic
929372406 2:41241986-41242008 ATTCATGCCTACTCATGCCTTGG - Intergenic
932965618 2:76471671-76471693 AGGCATGCACCATCATGCCTGGG - Intergenic
935858501 2:107301406-107301428 CTGCAAAGACAGTCATGCCTGGG + Intergenic
935976352 2:108582729-108582751 CTGCCTGGGCACTCAAGCCTGGG + Intronic
936249147 2:110854088-110854110 AGACATGCACACACATGCCTTGG - Intronic
936622575 2:114115905-114115927 AGGCATGCACCATCATGCCTGGG + Intergenic
937233831 2:120418520-120418542 CTTCATCCACACTCCTGCCTGGG - Intergenic
937909739 2:127069655-127069677 CTGCAGGCACACACATGTGTAGG + Intronic
938018851 2:127889556-127889578 CTGCAGCCACACTCCAGCCTGGG - Intergenic
938744339 2:134262761-134262783 CTACATGAACAGTTATGCCTGGG - Intronic
939860797 2:147417723-147417745 CTGCAAGCTCACTCCTGCTTTGG + Intergenic
940388352 2:153101300-153101322 ATGCAAGCAGACTCATGCCATGG - Intergenic
940421807 2:153487730-153487752 ATGCATGTTCTCTCATGCCTTGG - Intergenic
941654103 2:168124890-168124912 CTGCATGTTCACTCATGAGTGGG + Intronic
942681214 2:178480142-178480164 CTGCCCGCACACTCATCCCGCGG - Intergenic
943545170 2:189267216-189267238 CTGCATCCATACTCTTGCCTTGG + Intergenic
943670271 2:190652918-190652940 CTGCATGCAACCACAGGCCTCGG - Intronic
944538143 2:200731234-200731256 CTGCCTGCTCACTGATGACTGGG - Intergenic
945099983 2:206254921-206254943 CTGCATGTGCACTCCAGCCTGGG - Intergenic
945497216 2:210523730-210523752 CTGCATGAACATTCATTCTTTGG - Intronic
946671909 2:222114105-222114127 AGGCATGCACCATCATGCCTGGG + Intergenic
947538330 2:230955761-230955783 CTGCAGGCACACTCCAGCCTGGG - Intronic
948496477 2:238353216-238353238 ATACATGCACACTCGTGCCCAGG - Intronic
948518557 2:238521736-238521758 CAGCCTGCACCCTCAGGCCTGGG + Intergenic
1168738543 20:167399-167421 CTTCATGTTCATTCATGCCTTGG + Intergenic
1169241680 20:3986622-3986644 CTGCATGCACACTCATGCCTGGG - Intronic
1170971900 20:21124572-21124594 CTCCATTCACACTCTTGCCCTGG + Intergenic
1172380146 20:34482856-34482878 CTGCAAGCAGACTTTTGCCTGGG + Intronic
1175004376 20:55666646-55666668 CTGCAAGTACTCTCATACCTTGG + Intergenic
1175778504 20:61667670-61667692 GTGCATGCACACTCATGCCCTGG + Intronic
1179187137 21:39093710-39093732 CTGAACGCACACACAGGCCTGGG + Intergenic
1179628269 21:42660724-42660746 CTGCGGGCACAGTCATGCCATGG + Intronic
1183240036 22:36650840-36650862 CCACAGGCACACTCCTGCCTCGG + Intronic
1184590908 22:45482583-45482605 CTGTATGCACAAACTTGCCTTGG + Intergenic
1184722939 22:46325980-46326002 CTGCACGCCCACTCATACCCAGG - Intronic
949631433 3:5931865-5931887 CTACATGCAGACTCATGATTTGG - Intergenic
951676771 3:25250242-25250264 ATCCATGCACAAGCATGCCTGGG - Intronic
952570007 3:34702436-34702458 CGGCATGCACCATCATGCCTTGG + Intergenic
953902247 3:46849925-46849947 GGGCATGCCCACTCAGGCCTGGG + Intergenic
954404813 3:50339753-50339775 CTCCATGCACACACAGACCTGGG + Intronic
956609777 3:71110893-71110915 CTGCATGCGCACGCATTCCAAGG + Intronic
957143453 3:76391556-76391578 CTGCACTCACACTCCAGCCTGGG - Intronic
957322141 3:78645017-78645039 CTGGATGCACAAACATGCCCTGG + Intronic
959596294 3:108132468-108132490 GTGCATGCATAGTCATGCTTTGG - Intergenic
960262846 3:115588128-115588150 GAACATGCACACTCCTGCCTTGG + Intergenic
961175155 3:124829476-124829498 CTGCTTCCACACTCATGCGAGGG + Intronic
963231115 3:142909597-142909619 CTTCATGGAAACACATGCCTGGG + Intergenic
966559308 3:181301781-181301803 CAGGATGCAAACTCAAGCCTGGG - Intergenic
966980064 3:185124253-185124275 CTTCATGTACAGTCATTCCTTGG - Intronic
968614645 4:1571863-1571885 CTGCATGCACACTTGTTCCAGGG - Intergenic
969456419 4:7302396-7302418 CTGTGGGCACACTCCTGCCTCGG + Intronic
969606872 4:8206267-8206289 CTGCAGGCACTGGCATGCCTGGG + Intronic
969633512 4:8352249-8352271 CTCCATGTACACCCTTGCCTAGG - Intergenic
970303945 4:14711328-14711350 CTCCATGCACAGTCATCTCTGGG + Intergenic
972448944 4:39176885-39176907 CTGCATTCCCACTCCAGCCTGGG + Intergenic
972927817 4:44033633-44033655 CTTCATTCACACTCATTCTTTGG - Intergenic
979644688 4:123054074-123054096 AATCATGCACACTAATGCCTTGG - Intronic
979956923 4:126965034-126965056 CTGCATGCACATTGCTTCCTTGG - Intergenic
980917726 4:139049875-139049897 ATGCATGCACATTCATTTCTTGG - Intronic
983742331 4:171151002-171151024 TTGCATGCATACTACTGCCTGGG - Intergenic
984667336 4:182443281-182443303 CTGCAGACACACTAATTCCTAGG - Intronic
985848138 5:2369341-2369363 ATGCATGCACACACATGCATGGG + Intergenic
990461356 5:56034759-56034781 CTGCACTCACACTCCAGCCTGGG - Intergenic
991950068 5:71938927-71938949 CCACATGCACACTCATCCCGGGG - Intergenic
991962124 5:72055506-72055528 CCACTTGCACACTCATGCCAAGG + Intergenic
996535690 5:124574914-124574936 CTGAATGGACACTGCTGCCTGGG - Intergenic
996870987 5:128193068-128193090 CTGCCACCACACTCAAGCCTAGG + Intergenic
1000072929 5:157757716-157757738 CTGCCTGCCCTCTCATCCCTCGG + Exonic
1001016878 5:168149857-168149879 CCCCAAGCACTCTCATGCCTAGG + Intronic
1005424906 6:25692510-25692532 CTGCATCCACACTCACAGCTGGG - Intronic
1006411652 6:33877433-33877455 CTGCATGCACACGCATGCAGTGG + Intergenic
1013307735 6:108865124-108865146 AGGCATGCACAACCATGCCTGGG + Intronic
1014490629 6:122057453-122057475 CTGCAGGCATACTCAGGGCTTGG - Intergenic
1016928746 6:149381143-149381165 ATACATGCACACGCATACCTAGG - Intronic
1019093066 6:169556069-169556091 CTGTGTGCACAGGCATGCCTTGG - Intronic
1019601805 7:1887894-1887916 ATGCATGCACACACATGCACAGG - Intronic
1019601827 7:1888205-1888227 ATGCATGCACACACATGCACAGG - Intronic
1019601832 7:1888273-1888295 ATGCATGCACACACATGCACAGG - Intronic
1019601835 7:1888341-1888363 ATGCATGCACACACATGCACAGG - Intronic
1019601850 7:1888603-1888625 ATGCATGCTCACACATGCATAGG - Intronic
1022038133 7:26553508-26553530 CTGCAGCCACACTGCTGCCTGGG + Intergenic
1024951598 7:54866811-54866833 CTCCGTTCATACTCATGCCTAGG - Intergenic
1029210045 7:98900217-98900239 CTTCATGCACCCTCCTGACTTGG + Intronic
1031977364 7:128102564-128102586 CTGCCTCCAAACTCAGGCCTTGG - Intergenic
1032760619 7:134938036-134938058 TTGCATGCACACTAATGTTTGGG - Intronic
1033236777 7:139644388-139644410 CAGCCTGCACACTCAAGCCTGGG + Intronic
1035271130 7:157720570-157720592 CCGCGTGCACACCCATGCATCGG - Intronic
1035399085 7:158553083-158553105 CTGCGTACACACACATGCTTGGG + Intronic
1035636243 8:1146594-1146616 GTGCATGCACACACATGCGCAGG - Intergenic
1037180186 8:15995602-15995624 CTGAATGCACAAAGATGCCTAGG - Intergenic
1048136086 8:131747679-131747701 CTTCATGCACACTCAGACTTTGG + Intergenic
1048485644 8:134844907-134844929 CTGCATGGAAACTCATGCAAAGG - Intergenic
1048612009 8:136033350-136033372 CTGCATGCACACTTCTCCTTTGG - Intergenic
1049724898 8:144141266-144141288 CTGCACCCAAACGCATGCCTGGG - Intergenic
1050621079 9:7452600-7452622 CTGCATACACAGTCATCCCTTGG + Intergenic
1051169472 9:14305212-14305234 CTGCATGCACATTTACTCCTGGG - Intronic
1052784600 9:32816851-32816873 CTGCATGTACACCCCTGCCAGGG + Intergenic
1053694013 9:40618584-40618606 AGGCATGCACCCTCATGCCCTGG - Intergenic
1054270822 9:63021543-63021565 AGGCATGCACCCTCATGCCCTGG + Intergenic
1054305258 9:63417808-63417830 AGGCATGCACCCTCATGCCCTGG - Intergenic
1054404005 9:64741797-64741819 AGGCATGCACCCTCATGCCCTGG - Intergenic
1054437626 9:65227297-65227319 AGGCATGCACCCTCATGCCCTGG - Intergenic
1054492777 9:65794670-65794692 AGGCATGCACCCTCATGCCCTGG + Intergenic
1056760879 9:89414289-89414311 CTGCATGCAAACTACTGCCTGGG + Intronic
1057199587 9:93133146-93133168 CTGCATGGACACTTGTTCCTAGG - Intronic
1059158983 9:112015874-112015896 CTGCATGCTCTCTCATTCCAGGG - Intergenic
1060107985 9:120886288-120886310 TTCCCTGCACACACATGCCTGGG - Intronic
1060349443 9:122845392-122845414 ATGCATGCACTTCCATGCCTTGG + Exonic
1060961604 9:127684704-127684726 CTGCTGGCTCACCCATGCCTTGG + Intronic
1061841073 9:133358925-133358947 CTCAATCCACACTCATGCTTCGG - Intronic
1061995463 9:134180749-134180771 CAGCATGCACCCACATGCCAGGG + Intergenic
1185524668 X:767954-767976 GTGCATACACATGCATGCCTGGG + Intergenic
1190834131 X:54084788-54084810 ATGAATACACAATCATGCCTAGG - Intronic
1196010409 X:110880956-110880978 CTGTGTGCACACCCATGCCCTGG + Intergenic
1198300728 X:135332021-135332043 CTGCCTGGACACTCCTGCATCGG + Intronic
1198307879 X:135400526-135400548 CTGCCTGGACACTCCTGCGTCGG + Intergenic
1200080506 X:153573862-153573884 TTGTGTGCACACTCATGCCCAGG - Intronic
1202369274 Y:24186248-24186270 CTGCATGCTCAGCCATGCCATGG + Intergenic
1202501511 Y:25483869-25483891 CTGCATGCTCAGCCATGCCATGG - Intergenic