ID: 1169246719

View in Genome Browser
Species Human (GRCh38)
Location 20:4031872-4031894
Sequence CATCAGAGGGGGGCGGGGGA GGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 3 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1169246719_1169246731 -4 Left 1169246719 20:4031872-4031894 CCCTCCCCCGCCCCCCTCTGATG No data
Right 1169246731 20:4031891-4031913 GATGCCGAGCCAAAGCTGGACGG 0: 54
1: 81
2: 38
3: 20
4: 170
1169246719_1169246730 -8 Left 1169246719 20:4031872-4031894 CCCTCCCCCGCCCCCCTCTGATG No data
Right 1169246730 20:4031887-4031909 CTCTGATGCCGAGCCAAAGCTGG 0: 142
1: 549
2: 481
3: 358
4: 290
1169246719_1169246734 13 Left 1169246719 20:4031872-4031894 CCCTCCCCCGCCCCCCTCTGATG No data
Right 1169246734 20:4031908-4031930 GGACGGTACTGCTGCCATCTCGG 0: 125
1: 829
2: 365
3: 139
4: 530

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1169246719 Original CRISPR CATCAGAGGGGGGCGGGGGA GGG (reversed) Intergenic
No off target data available for this crispr