ID: 1169246731

View in Genome Browser
Species Human (GRCh38)
Location 20:4031891-4031913
Sequence GATGCCGAGCCAAAGCTGGA CGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total 363
Summary {0: 54, 1: 81, 2: 38, 3: 20, 4: 170}

Found 7 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1169246722_1169246731 -9 Left 1169246722 20:4031877-4031899 CCCCGCCCCCCTCTGATGCCGAG No data
Right 1169246731 20:4031891-4031913 GATGCCGAGCCAAAGCTGGACGG 0: 54
1: 81
2: 38
3: 20
4: 170
1169246717_1169246731 2 Left 1169246717 20:4031866-4031888 CCCTCTCCCTCCCCCGCCCCCCT No data
Right 1169246731 20:4031891-4031913 GATGCCGAGCCAAAGCTGGACGG 0: 54
1: 81
2: 38
3: 20
4: 170
1169246723_1169246731 -10 Left 1169246723 20:4031878-4031900 CCCGCCCCCCTCTGATGCCGAGC No data
Right 1169246731 20:4031891-4031913 GATGCCGAGCCAAAGCTGGACGG 0: 54
1: 81
2: 38
3: 20
4: 170
1169246719_1169246731 -4 Left 1169246719 20:4031872-4031894 CCCTCCCCCGCCCCCCTCTGATG No data
Right 1169246731 20:4031891-4031913 GATGCCGAGCCAAAGCTGGACGG 0: 54
1: 81
2: 38
3: 20
4: 170
1169246721_1169246731 -8 Left 1169246721 20:4031876-4031898 CCCCCGCCCCCCTCTGATGCCGA No data
Right 1169246731 20:4031891-4031913 GATGCCGAGCCAAAGCTGGACGG 0: 54
1: 81
2: 38
3: 20
4: 170
1169246720_1169246731 -5 Left 1169246720 20:4031873-4031895 CCTCCCCCGCCCCCCTCTGATGC No data
Right 1169246731 20:4031891-4031913 GATGCCGAGCCAAAGCTGGACGG 0: 54
1: 81
2: 38
3: 20
4: 170
1169246718_1169246731 1 Left 1169246718 20:4031867-4031889 CCTCTCCCTCCCCCGCCCCCCTC No data
Right 1169246731 20:4031891-4031913 GATGCCGAGCCAAAGCTGGACGG 0: 54
1: 81
2: 38
3: 20
4: 170

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1169246731 Original CRISPR GATGCCGAGCCAAAGCTGGA CGG Intergenic
900693921 1:3998402-3998424 GATGAAGAGCCATAGCTGCAGGG - Intergenic
901100678 1:6716227-6716249 GATGCTGAGCCGAAGCTGGATGG - Intergenic
901270820 1:7952119-7952141 GATGCCGAGCCAAAGCTGGACGG + Intergenic
902018497 1:13327680-13327702 CATGCCGAGCCAAAGCTGGACGG + Intergenic
903081196 1:20814825-20814847 GATGCCGAGCCAAAGCTGGACGG + Intronic
903638139 1:24834774-24834796 CATGCCGAGCCAAAGCTGGACGG - Intronic
903961950 1:27063488-27063510 GATGCCGAGCCGAGGCTGGACGG + Intergenic
904784937 1:32975793-32975815 GATGCGGAGCCAAAGCTGGACGG - Intergenic
905427195 1:37895555-37895577 GATGCCGAGCCGAAGCTGGACGG + Intronic
905686780 1:39913969-39913991 GATGCCGAGCCAAAGCTGGACGG - Intergenic
906762074 1:48384289-48384311 GATGCCGAGCCAAGGCTGGACGG - Intronic
907565547 1:55430406-55430428 GAGGGCGAGCCAAAGCAGGGTGG + Intergenic
907953455 1:59206326-59206348 GAGGGCGAGCCAAAGCAGGGTGG + Intergenic
908370043 1:63472513-63472535 GATGCCGAGCCAAAGGTGGACGG + Intronic
909403215 1:75257895-75257917 GAGGGCGAGCCAAAGCAGGGTGG + Intronic
909641297 1:77871039-77871061 GATGCCGAGCCAAAGCTGGACGG - Intronic
910610223 1:89133630-89133652 GATGCAGACCCAAGGCTGAAGGG + Intronic
910799448 1:91131106-91131128 GAGGGCGAGCCAAAGCAGGGTGG + Intergenic
910891817 1:92026838-92026860 GATGCCCAGCGGAGGCTGGACGG - Intergenic
910956835 1:92715631-92715653 GAGGGCGAGCCAAAGCAGGGCGG + Intronic
911079737 1:93916618-93916640 GACGGCGAGCCAAAGCAGGGCGG - Intergenic
911777985 1:101839468-101839490 GATGCCCAGCTAAAACTGCAGGG - Intronic
914887845 1:151599631-151599653 GATGCCGAGCCAAAGCTGGACGG + Intergenic
915208233 1:154286962-154286984 GATGTCGAGCCAAAGCTGGACGG + Intergenic
915304481 1:154969844-154969866 GGGGCCCAGGCAAAGCTGGAAGG + Intronic
916104644 1:161422320-161422342 GATGCGGAGCTGAAGCTGGACGG + Intergenic
916545588 1:165801277-165801299 GATGGCTAGCCAAAGCAGGGTGG + Intronic
917157864 1:172024647-172024669 GAGGGCAAGCCAAAGCAGGATGG + Intronic
917583293 1:176397529-176397551 GATGCCGAGCTGAAGCTGGACGG - Intergenic
917859737 1:179134772-179134794 GATGCCGAGCTGAAGCTGGACGG + Intronic
918255506 1:182742692-182742714 GATGCCGAGCCAAAGCTGGACGG - Intergenic
918968268 1:191378780-191378802 GAGGGTGAGCCAAAGCAGGACGG - Intergenic
919079834 1:192856416-192856438 GATGCCGAGCTGAAGCTGGACGG + Intergenic
921084962 1:211781414-211781436 GCAGCCGAGCCAAAGCTTGAAGG - Intronic
921401470 1:214727933-214727955 GAGGGCGAGCCAAAGCAGGGTGG - Intergenic
922278369 1:224100259-224100281 GATGCCGAGCTGAAGCTGGACGG + Intergenic
923468402 1:234268406-234268428 GATGCCGAGCCAAAGCTGGACGG - Intronic
1064108818 10:12520882-12520904 GATGCCGAGCCAAAGCTGGACGG - Intronic
1065357440 10:24856233-24856255 GTCGCCCAGCCCAAGCTGGAGGG - Intronic
1066085163 10:31969126-31969148 CATGCCGAGCCAAAGCTGGACGG + Intergenic
1067114262 10:43422677-43422699 GATGCCGAGCCAAGGCTGGACGG + Intergenic
1069365492 10:67690934-67690956 GATGCCGAGCCGAAGCTGGACGG + Intronic
1069645611 10:69993822-69993844 GATGCCGAGCCAAGGCTGGACGG - Intergenic
1069930205 10:71876649-71876671 GATGCCGAGCCGAAGCTGGATGG - Intergenic
1070936720 10:80304200-80304222 GAGGGCGAGCCAAAGCAGGATGG + Intergenic
1071189973 10:83089045-83089067 GAGGGCGAGCCAAAGCAGGGTGG + Intergenic
1072516265 10:96186194-96186216 GAGGGCGAGCCAAAGCAGGGTGG - Intronic
1072602560 10:96942396-96942418 GATGCCGAGCCAAAGCTGGACGG - Intronic
1072891506 10:99329331-99329353 GAAGCCGAGCGAGAGCTGGAGGG - Exonic
1075051158 10:119183151-119183173 GATGCCGAGCCGAAGCTGGACGG - Intergenic
1075137363 10:119796031-119796053 GATGCCCAGCCGAAGCTGGACGG - Intronic
1075288441 10:121207465-121207487 GAGGACAAGACAAAGCTGGAAGG - Intergenic
1078176718 11:8977410-8977432 GATGCCGAGCCAAAGCTGGACGG + Intergenic
1079444665 11:20547790-20547812 GATGCCGAGCCAAAGCTGGACGG + Intergenic
1081950597 11:47039421-47039443 GATGCGGAGCTGAAGCTGGACGG - Intronic
1083368421 11:62157944-62157966 GAGGGCGAGCCAAAGCAGGGTGG + Intergenic
1084745870 11:71168751-71168773 GATGCCGAGCTGAAGCTGGACGG - Intronic
1087780980 11:102301334-102301356 GAGGGCGAGCCAAAGCAGGGTGG - Intergenic
1090907056 11:131085099-131085121 GATGCCGAGCCAAAGCTGGACGG - Intergenic
1091378412 12:41300-41322 CATGCCGAGCCAAAGCTGGACGG + Intergenic
1092401621 12:8183450-8183472 GATGCCGAGCTGAAGCTGGACGG + Intronic
1092453378 12:8624399-8624421 GATGCCGAGCCAAAGCTGGACGG + Intergenic
1093004334 12:14035620-14035642 GAGGGTGAGCCAAAGCAGGATGG + Intergenic
1094103090 12:26784393-26784415 GATGCCGAGCCAAGGCTGGACGG + Intronic
1096566769 12:52488466-52488488 GATGCCAAGAACAAGCTGGAAGG - Exonic
1097635279 12:62114286-62114308 GAGGACGAGCCAAAGCAGGGTGG - Intronic
1098412442 12:70201173-70201195 GATGCCGAGCCAAGGCTGGACGG + Intergenic
1099053545 12:77809466-77809488 GAGGGCGAACCAAAGCTGGGTGG - Intergenic
1099255696 12:80308920-80308942 GATGCCGAGCCGAAGCTGGACGG - Intronic
1100570917 12:95842329-95842351 CATGCCGAGCCAAAGCTGGACGG - Intergenic
1100606750 12:96158147-96158169 GATGCCGAGCCGAGGCTGGACGG + Intergenic
1103839120 12:123848412-123848434 GATTATGAACCAAAGCTGGACGG - Intronic
1103872810 12:124102896-124102918 GATGCCGAGCCGAAGCTGGACGG - Intronic
1104861583 12:131927019-131927041 GATGCCGAGCGGAAGCTGGACGG - Intergenic
1105769324 13:23593947-23593969 GAGGGTGAGCCAAAGCAGGATGG + Intronic
1106095071 13:26636482-26636504 GAGGGCGAGCCAAAGCAGGGCGG - Intronic
1108153684 13:47563754-47563776 GAGGGCGAGCCAAAGCAGGATGG + Intergenic
1108236749 13:48416277-48416299 GAAGGCGAGCCAAAGCAGGGTGG + Intronic
1112056332 13:95692008-95692030 GATGCCGAGCTGAAGCTGGATGG - Intronic
1113760042 13:112840586-112840608 AGTGCCGAGCAAAGGCTGGAGGG - Intronic
1114198939 14:20505356-20505378 GATGCCGAGCCAAAGCTGGACGG + Intergenic
1114341864 14:21753920-21753942 GAGGGCGAGCCAAAGCAGGGTGG + Intergenic
1114427508 14:22636453-22636475 GATGCCGAGCCAAGGCTGGACGG + Intergenic
1115721178 14:36162523-36162545 GAGGGCGAGCCAAAGCAGGGTGG - Intergenic
1117599914 14:57364752-57364774 GAGGGCGAGCCAAAGCAGGGTGG + Intergenic
1117613070 14:57504144-57504166 GGTGCCCAGCCCAAGCTGAAAGG + Intergenic
1117930628 14:60837515-60837537 GAGGGTGAGCCAAAGCAGGATGG - Intronic
1118341411 14:64896634-64896656 CATGCCGAGCCAAAGCTGGACGG - Intergenic
1118379395 14:65205227-65205249 GAGGCCGAGGCAAAGCTGCACGG - Intergenic
1120843244 14:89105121-89105143 GATGGCAAGCCAAAGCAGGGTGG - Intergenic
1121655401 14:95591783-95591805 GAGGCCGAGGCAAGGCAGGAGGG + Intergenic
1121734334 14:96207216-96207238 GATGCCTAGCCCAACATGGATGG + Intronic
1122568702 14:102678156-102678178 GATGCCGAGCCAAAGCTGGACGG - Intronic
1124893859 15:33757988-33758010 GAGGGCGAGCCAAAGCAGGGTGG + Intronic
1125330085 15:38573864-38573886 GAGGGCGAGCCAAAGCAGGGTGG - Intergenic
1125868329 15:43076017-43076039 GATGCCGAGCCAAAGCTGGACGG + Intronic
1126295210 15:47131792-47131814 GATGCCGAGCCAAAGCTGGACGG + Intergenic
1126941980 15:53777797-53777819 GATCAGGAGTCAAAGCTGGAAGG + Intergenic
1126952283 15:53894135-53894157 GAGGGCGAGCCAAAGCAGGGTGG - Intergenic
1127584095 15:60365891-60365913 GATGCCGAGCCAAAGCTGGACGG + Intronic
1131544883 15:93307787-93307809 GCTGCCGTGCAAAAGCCGGACGG + Intergenic
1132311882 15:100863193-100863215 GAGGCTGAGCCAGAGCTGGGAGG - Intergenic
1132578032 16:672869-672891 GTGGCCGAGGCACAGCTGGAGGG - Intronic
1132909233 16:2299769-2299791 GAGGCCGAGGCACTGCTGGACGG + Intronic
1133365201 16:5203696-5203718 GATGCCGAGCCGAAGCTGGACGG - Intergenic
1135418725 16:22289621-22289643 GCAGACGAGCCAAATCTGGAAGG - Intergenic
1135807476 16:25555986-25556008 GAGGGCGAGCCAAAGCAGGGTGG + Intergenic
1136571967 16:31103673-31103695 GATGCCGAGCCAAGGCTGGACGG + Intergenic
1136593403 16:31231647-31231669 GATGCCGAGCGGAAGCTGGACGG + Intergenic
1139486707 16:67261228-67261250 GGTGGTGAGCCAAGGCTGGAGGG - Intronic
1139556173 16:67712328-67712350 GATGCCGAGCCAAGGCTGGACGG + Intronic
1139971761 16:70780801-70780823 GATGCCCTGCCAAAGCAGGAGGG - Exonic
1140456535 16:75109052-75109074 GATGGGGAGCAAAGGCTGGAAGG - Exonic
1140685039 16:77425382-77425404 GATGCAGTGCTAAGGCTGGATGG + Intronic
1140888592 16:79266190-79266212 GGGACAGAGCCAAAGCTGGAGGG + Intergenic
1142818403 17:2446652-2446674 GATGCCGAGCCAAGGCTGGACGG + Intronic
1144860263 17:18297492-18297514 GATGCCGAGCTGAAGCTGGACGG + Intronic
1145733487 17:27211433-27211455 CATGCCGAGCCAAAGCTGGACGG + Intergenic
1146197269 17:30824452-30824474 GATGCCGGGCGAAGGCTGGGAGG - Intronic
1146216585 17:30981313-30981335 GATGCTGAGCCAAAGCTGGACGG - Intronic
1146444667 17:32923774-32923796 GATGCCGAGCCAAAGCTGGACGG - Intergenic
1147441694 17:40451478-40451500 TCTGCCTAGCCAAAGCTGGGGGG - Intronic
1148016164 17:44524067-44524089 GATGCCGAGCTGAAGCTGGACGG + Intergenic
1148686742 17:49505367-49505389 GTTCCCCACCCAAAGCTGGAAGG + Intronic
1149130993 17:53302560-53302582 GATGCAGACCCCAAGCTGAAAGG + Intergenic
1150213759 17:63455882-63455904 GATGCCGAGCTGAAGCTGGACGG + Intergenic
1151340294 17:73466722-73466744 GATGCAGAGCCTAAGCCGGGGGG - Intronic
1152019946 17:77775707-77775729 GATGCCGAGCCAAAGCTGGACGG + Intergenic
1154440365 18:14383490-14383512 GATGCCGAGCTGAAGCTGTACGG - Intergenic
1155923972 18:31634083-31634105 TATGCCCTGCCACAGCTGGAGGG + Intronic
1157058296 18:44256269-44256291 GATGGTGAGCCAAAGCAGGGAGG - Intergenic
1157342003 18:46787248-46787270 GATGCAGAGCCTGAGGTGGAGGG - Intergenic
1159562104 18:70007104-70007126 GAGGGCGAGCCAAAGCAGGGTGG + Intronic
1163142888 19:15362400-15362422 GATGCCGAGCCGAAGCTGGACGG + Intronic
1163542078 19:17917666-17917688 GATGCCGAGCTGAAGCTGGACGG + Intergenic
1163865394 19:19769536-19769558 GATGCGGAGCCGAGGCTGGACGG + Intergenic
1164066279 19:21720391-21720413 CATGCCGAGCCAAAGCTGGACGG + Intergenic
1166163261 19:40967394-40967416 GATGCCGAGCCAAAGCTGGACGG - Intergenic
1167840660 19:52115546-52115568 GATGCCTTGCAAAAGCTGAACGG + Exonic
1167897665 19:52594271-52594293 GATGCCGAGCCGAAGCTGGACGG - Intronic
1167924348 19:52810932-52810954 GATGCCGAGCCAAAGCTGGACGG + Intronic
1167971217 19:53188535-53188557 GATGCCGAGCCAAGGCTGGACGG - Intronic
1167975354 19:53222312-53222334 GATGCCGAGCTGAAGCTGGACGG + Intergenic
1168658140 19:58146593-58146615 GATGCCGAGCCGAAGCTGGACGG + Intronic
1168696395 19:58406300-58406322 GATGCCGAGCCGAAGCTGGACGG - Intronic
925403792 2:3592201-3592223 GATGCCGAGCCAAGGCTGGACGG - Intergenic
926113447 2:10196756-10196778 GATGCCAAGCCAGAGCCGGGAGG + Intronic
928003394 2:27541348-27541370 GATGCCGAGCCAAAGCTGGACGG - Intronic
928005605 2:27558854-27558876 GATGCCGAGCCAAGGCTGGACGG - Intronic
929062193 2:37933725-37933747 GATGCCGAGCCGAAGCTGGATGG - Intronic
929518053 2:42622359-42622381 CATGCCGAGCCGAAGCTGGACGG - Intronic
929739365 2:44587518-44587540 GATGCCGAGCCAAAGCTGGACGG + Intronic
930269016 2:49233634-49233656 GAGGGCGAGCCAAAGCAGGGTGG - Intergenic
930821292 2:55650212-55650234 GATGCCGAGCTGAAGCTGGACGG + Intronic
931030316 2:58168295-58168317 GAGGGCGAGCCAAAGCAGGGTGG + Intronic
932323904 2:70842343-70842365 GAGGGCGAGCCAAAGCAGGGTGG + Intergenic
935630986 2:105211869-105211891 GATGCCGAGCCAAAGCTGGACGG - Intergenic
937356487 2:121201119-121201141 GATTAGGAGCCAAAGCTGGGAGG + Intergenic
938370289 2:130764074-130764096 GATGCAGAGCCCATGCTGGCAGG + Exonic
938581726 2:132652512-132652534 GATGCAGACCCAGAGCTAGAAGG + Intronic
940594091 2:155767353-155767375 GAGGGCGAGCCAAAGCAGGGTGG - Intergenic
940643101 2:156367603-156367625 GATGCTGAGCCAAAGCTGGACGG + Intergenic
941024154 2:160440008-160440030 GATGCCGAGCCGAAGCTGGACGG - Intronic
942372564 2:175300847-175300869 AATGGGGAGCCTAAGCTGGAAGG + Intergenic
942722141 2:178965470-178965492 GAAGGCGAGCCAAAGCAGGATGG + Intronic
943740180 2:191399219-191399241 GATGCCGAGCCAAAGCTGGATGG - Intronic
944255170 2:197618128-197618150 GATGCCCAGCCGAAGCTGGACGG + Intronic
944533208 2:200684685-200684707 GATGCCGAGCCAAAGCTGGACGG - Intergenic
944599035 2:201284630-201284652 CATGCCGAGCCAAAGCTGGACGG - Intronic
945232788 2:207609840-207609862 GATGCCGAGCCAAGGCTGGACGG + Exonic
945835977 2:214836308-214836330 GATGCCGAGCCAAAGCTGGACGG - Intergenic
945970602 2:216227509-216227531 CATGCCGAGCCAAAGCTGGACGG - Intergenic
946317978 2:218930841-218930863 GATGCCGAGCCGAAGCTGGACGG + Intergenic
946650804 2:221891564-221891586 GATGCCAAGCCGAAGCTGGACGG + Intergenic
946696897 2:222368725-222368747 GAGGGCGAGCCAAAGCAGGGTGG - Intergenic
948356115 2:237378699-237378721 GCTGCTGAGGCAAAGCTGGCAGG + Exonic
1169085503 20:2823108-2823130 GATGCCGAGCCAAAGCTGGACGG + Intergenic
1169109014 20:3020027-3020049 GATGCCGAGCCGAAGCTGGACGG - Intronic
1169246731 20:4031891-4031913 GATGCCGAGCCAAAGCTGGACGG + Intergenic
1171443564 20:25186824-25186846 GAGGGCGAGCCAAAGCAGGGTGG - Intergenic
1172027199 20:31956704-31956726 GAGGCCCAGCCAGAGCTGGTAGG - Intergenic
1172855273 20:37996874-37996896 GATGTCCTGCCAAAGCTGGCTGG - Exonic
1174020808 20:47526714-47526736 GATGCCGAGCCGAAGCTGGACGG - Intronic
1174344701 20:49921492-49921514 GATGCCGAGCCGAAGCTGGACGG + Intergenic
1176348588 21:5771754-5771776 GATGCCGAGCCGAAGCTGGATGG - Intergenic
1176355402 21:5892338-5892360 GATGCCGAGCCGAAGCTGGATGG - Intergenic
1176496239 21:7552701-7552723 GATGCCGAGCCGAAGCTGGATGG + Intergenic
1176542909 21:8169824-8169846 GATGCCGAGCCGAAGCTGGATGG - Intergenic
1176561860 21:8352869-8352891 GATGCCGAGCCGAAGCTGGATGG - Intergenic
1178075357 21:29010710-29010732 GATTCCGAGCCGAAGCTGGACGG + Intronic
1178873272 21:36393165-36393187 GATGCCAAGCCGAGGCTGGACGG - Intronic
1180104895 21:45612080-45612102 CACGAGGAGCCAAAGCTGGATGG - Intergenic
1180700593 22:17779549-17779571 GATGCTGAGACAAAGCTCGGTGG + Intergenic
1181472966 22:23152168-23152190 GAGGCCGAGTCACAGGTGGAGGG - Intronic
1181585951 22:23853857-23853879 GATGCCGAGCCAAGGCTGGACGG + Intergenic
1182538727 22:31026332-31026354 GATGCCGAGCCAAAGCTGGACGG + Intergenic
1183434597 22:37786269-37786291 GATGCCGAGCCAAAGCTGGACGG + Intergenic
1183678129 22:39311113-39311135 GCTGCAGAGCCAAAGATGGGAGG + Intergenic
1183871885 22:40746348-40746370 CATGCCGAGCCAAAGCTGGACGG - Intergenic
1183940785 22:41294094-41294116 GATGCCGAGCCGAAGCTGGACGG + Intergenic
1184202459 22:42980529-42980551 GATGCCGAGCCAAAGCTGGACGG + Intronic
1203247776 22_KI270733v1_random:86067-86089 GATGCCGAGCCGAAGCTGGATGG - Intergenic
949154923 3:816344-816366 GAGGGCAAGCCAAAGCAGGATGG + Intergenic
949440101 3:4071319-4071341 GAGGGCGAGCCAAAGCAGGGTGG + Intronic
949449991 3:4174706-4174728 GAGGGTGAGCCAAAGCAGGATGG + Intronic
949869409 3:8575060-8575082 CATCCAGTGCCAAAGCTGGAGGG + Intergenic
950949321 3:16981089-16981111 GATGCCGAGCCGAAGCTGGACGG - Intronic
951237795 3:20254976-20254998 GAGGGCGAGCCAAAGCAGGGTGG - Intergenic
953642896 3:44726306-44726328 GATGCTGAGCCTGAGGTGGAAGG + Intergenic
954415047 3:50389169-50389191 GAGGCCGGGCCCAAGCTGCAGGG + Intronic
954530980 3:51320165-51320187 GAGGGCGAGCCAAAGCAGGGTGG + Intronic
954537801 3:51374417-51374439 GATGACAAGCCACAGATGGAGGG - Intronic
955699964 3:61672672-61672694 GATGCCGAGCCGAAGCTGGACGG - Intronic
958957650 3:100478929-100478951 CATGCCGAGCCGAAGCTGGACGG - Intergenic
959415914 3:106075742-106075764 GATGCCGAGCCAAAGCTGGACGG - Intergenic
960037074 3:113112573-113112595 GATGCCGAGCCTCAGGTGGCTGG - Intergenic
960276845 3:115738464-115738486 GAGGGCGAGCCAAAGCAGGGTGG - Intergenic
960780791 3:121314548-121314570 GATGCCGAGCCAAAGCTGGACGG - Intronic
960913119 3:122668967-122668989 GAGGGCGAGCCAAAGCAGGGTGG - Intergenic
961310498 3:125996396-125996418 GAGGGCGAGCCAAAGCAGGGTGG + Intergenic
961353872 3:126321709-126321731 GATGTCGAGTCAAAGAAGGAAGG - Intergenic
961962255 3:130867352-130867374 GATGCCGAGCCAAAGCTGGATGG + Intronic
962711528 3:138090610-138090632 GATGGAAAGCCAAAGGTGGAAGG - Intronic
962914140 3:139883414-139883436 GAGGGTGAGCCAAAGCAGGATGG - Intergenic
963498223 3:146095929-146095951 GATGCCGAGCCAAAGCTGGACGG + Intronic
963911776 3:150821790-150821812 GATGCCGAGCCAAGGCTGGACGG - Intergenic
964701746 3:159575075-159575097 GAGGGCGAGCCAAAGCAGGGCGG - Intronic
964740034 3:159955408-159955430 GAGGCCAAGCCAAACCTAGATGG + Intergenic
966420358 3:179728908-179728930 GATGCCGAGCTGAAGCTGGACGG - Intronic
966557741 3:181282812-181282834 AATGAGGAGCCAAGGCTGGATGG + Intergenic
967175936 3:186863582-186863604 GATGCCGAGCCAAAGCTGGACGG + Intergenic
967199340 3:187058267-187058289 GAGGACGAGCCAAAGCAGGGTGG - Intronic
968226088 3:196973267-196973289 GATGCCGAGCTGAAGCTGGACGG + Intergenic
968411496 4:395032-395054 GATGCCGAGCCGAAGCTGGACGG + Intergenic
968506996 4:975385-975407 GATGCCGAGCCAAAGCTGGACGG + Intronic
968829186 4:2923433-2923455 GAGGGCGAGCCAAAGCAGGGTGG - Intronic
969427416 4:7133467-7133489 AAGGCCAAGCCAAAGCTGGTGGG + Intergenic
970409077 4:15790225-15790247 GATGCCGAGCCAAAGCTGGACGG + Intronic
971430144 4:26556816-26556838 GAGGGCGAGCCAAAGCAGGGTGG - Intergenic
973108946 4:46376812-46376834 GATGCCGAGCTGAAGCTGGACGG + Intronic
973137649 4:46727699-46727721 GAGGGCGAGCCAAAGCAGGGTGG - Intergenic
975219487 4:71797642-71797664 GAGGGCGAGCCAAAGCAGGGCGG - Intronic
975247975 4:72142402-72142424 GAGGGTGAGCCAAAGCAGGACGG - Intronic
975685424 4:76916122-76916144 GATGCCGAGCCAAGGCTGGACGG + Intergenic
976100000 4:81551192-81551214 GATGATAAGCCAAAGCTGGAAGG - Intronic
976159534 4:82184260-82184282 GAGGGCGAGTCAAAGCAGGATGG + Intergenic
976607258 4:86995354-86995376 GATGCCGAGCCGAAGCTGGACGG + Intronic
977313660 4:95417656-95417678 GAGGCAGAGCCAAGGCAGGAAGG + Intronic
977383039 4:96301302-96301324 GATGGCAAGCACAAGCTGGAGGG + Intergenic
977500190 4:97828233-97828255 GATTGCGAGCCAAAGCAGGCTGG + Intronic
978408972 4:108408862-108408884 GATGCCGAGCCAAAGCTGGACGG + Intergenic
979462731 4:121001984-121002006 GAGGGCGAGCCAAAGCAGGATGG - Intergenic
980037856 4:127905474-127905496 GAGGGCGAGCCAAAGCAGGATGG - Intergenic
980613227 4:135184910-135184932 GAAGCCCAGCCTCAGCTGGAAGG + Intergenic
981110760 4:140930652-140930674 GATGATGAGCCAATGCAGGAGGG - Intronic
981199640 4:141965850-141965872 GAGGGTGAGCCAAAGCAGGAAGG + Intergenic
981466464 4:145077915-145077937 CATACCGAGCAAAAACTGGAAGG + Intronic
982040252 4:151390212-151390234 GATGCTGAGCCAAAGCTGGACGG + Intergenic
982053788 4:151527477-151527499 GATGCCGAGCCGAAGCTGGACGG - Intronic
984804398 4:183737742-183737764 GATGCCGAGCCAAAGCTGGACGG - Intergenic
985977459 5:3431673-3431695 GTTGCAGAGCCCAAGGTGGAAGG - Intergenic
987949846 5:24660730-24660752 GAGGGCGAGCCAAAGCAGGGTGG - Intergenic
988056907 5:26108945-26108967 GATGAGGAGACAGAGCTGGAAGG + Intergenic
988187872 5:27889856-27889878 GAGGGCGAGCCAAAGCAGGGTGG - Intergenic
988544174 5:32141644-32141666 GATGCCGAGCCAAAGCTGGACGG + Intronic
989021664 5:37014160-37014182 GATGCCGAGCCGAAGCTGGACGG - Intronic
989675335 5:43966227-43966249 GAGGGTGAGCCAAAGCAGGATGG - Intergenic
991127520 5:63084580-63084602 GATGCCGAGCCGAAGCTGGACGG - Intergenic
991598047 5:68324506-68324528 GATGCCCAGCTGAAGCTGGACGG - Intergenic
991934678 5:71789944-71789966 GATGGCAAGCCAAAGCAGGGTGG + Intergenic
992001273 5:72438685-72438707 GATGCTGAGACAAATTTGGATGG - Intergenic
992950485 5:81852541-81852563 GATGGCGAGGCAAAGCTGGGAGG + Intergenic
993496465 5:88615299-88615321 GATGCCGAGCTGAAGCTGGACGG + Intergenic
995612276 5:113923449-113923471 GAGGGCGAGCCAAAGCAGGGTGG + Intergenic
997474419 5:134134315-134134337 GAGCCAGAGCCAAGGCTGGATGG + Intronic
997875127 5:137539032-137539054 GATGCCGAGCCGAAACTGGACGG - Intronic
999965559 5:156806006-156806028 GAGGGCGAGCCAAAGCAGGGTGG + Intergenic
1002658389 5:180771735-180771757 GATGCCGAGCTGAAGCTGGACGG - Intergenic
1003308849 6:4951356-4951378 GATGCCGAGATAAGGCGGGAAGG - Intronic
1003319623 6:5038830-5038852 GATGCCGAGCCAAGGCTGGACGG - Intergenic
1005837039 6:29717940-29717962 CATGCCGAGCCAAAGCTGGACGG + Intergenic
1006141667 6:31933069-31933091 GATGCCGAGCCGAAGCTGGACGG - Intronic
1006170608 6:32089835-32089857 GTTGCCAGGGCAAAGCTGGAGGG - Intronic
1006902787 6:37513741-37513763 GGTGCTGAGCCAAATTTGGAAGG + Intergenic
1007462885 6:42030859-42030881 GGAGCTGAGCCAAGGCTGGAGGG + Intronic
1008480538 6:51981388-51981410 GATGCCGAGCCAAGGCTGGACGG + Intronic
1008785025 6:55158152-55158174 GAGGGTGAGCCAAAGCTGGATGG + Intronic
1008926778 6:56895970-56895992 CATGCCGAGCCAAAGCTGGACGG - Intronic
1011776872 6:90740040-90740062 GAGGGCGAGCCAAAGCAGGGTGG - Intergenic
1012423991 6:99094465-99094487 GATGCCCAGACAAAGCTGGGAGG + Intergenic
1012945069 6:105456667-105456689 CAAGCAGAGCCAAAGGTGGAAGG - Intergenic
1015643848 6:135364845-135364867 GATGCCAAGCCGAAGCTGGACGG - Intronic
1016111383 6:140229983-140230005 GAGGGCGAGCCGAAGCAGGATGG + Intergenic
1016802345 6:148179656-148179678 GATGCCGAGCTGAAGCTGGACGG - Intergenic
1019459296 7:1147915-1147937 GATGCCGAGCCAAGGCTGGACGG - Intergenic
1019715171 7:2535241-2535263 GATGCCAAGCCAAAGCTGGACGG - Intergenic
1020760444 7:12262162-12262184 GAGGCCGAGGCTAGGCTGGAAGG - Intergenic
1021735156 7:23635925-23635947 GATGCCGAGCCAAAGCTGGACGG + Intronic
1023146184 7:37153307-37153329 GAGGGCGAGCCAAAGCAGGGTGG + Intronic
1023160423 7:37291990-37292012 GATGCCGAGCCGAAGCTGGACGG + Intronic
1023276833 7:38528869-38528891 GCAGCCGAGGCAATGCTGGAAGG - Intronic
1023734062 7:43219437-43219459 GATACCGAGCTAAAGAAGGAAGG + Intronic
1024625663 7:51207472-51207494 GATGCCGAGCCGAAGCAGGACGG + Intronic
1025979681 7:66395025-66395047 GATGCCGAGCCAAAGCTGGACGG - Intronic
1026862241 7:73798035-73798057 GATGCCGAGCCGAAGCTGGACGG - Intergenic
1027179072 7:75925146-75925168 GATGCCAAGGCAAAGAAGGATGG + Intronic
1028378029 7:90167992-90168014 GAGGGCGAGCCAAAGCAGGGTGG + Intronic
1028378251 7:90170624-90170646 GATTCCGACCCAGAGCTTGATGG + Intronic
1030331778 7:108278729-108278751 GAGGGCGAGCCAAAGCAGGGTGG - Intronic
1031521503 7:122771682-122771704 GATCCCAAGCCAAAGAGGGAAGG + Intronic
1033323602 7:140361591-140361613 GATGCCGAGCCAAAGCTGGACGG + Intronic
1033679965 7:143584234-143584256 GAAGGCGAGCCAAAGCAGGGTGG + Intergenic
1033691869 7:143745209-143745231 GAAGGCGAGCCAAAGCAGGGTGG - Intergenic
1034639015 7:152587186-152587208 GATGCCGAGCCGAGGCTGGACGG - Intergenic
1035097607 7:156368118-156368140 GATGCCCAGGCAGAGCTGGCAGG + Intergenic
1038594953 8:28880301-28880323 GATGCCGAGCCAAAGCTGGACGG + Intronic
1038745038 8:30247836-30247858 GATGCCGAGCCAAAGCTGGACGG - Intergenic
1039400664 8:37266299-37266321 GATGCCGTGCCAGAGGGGGAAGG - Intergenic
1039480980 8:37873078-37873100 GATGCCTGGCCAGAGCTAGAAGG + Exonic
1040070173 8:43181046-43181068 GATGCCGAGCCAAGGCTGGACGG - Intronic
1040818488 8:51533536-51533558 GATGCCGAGCCAAAGCTGGACGG + Intronic
1040943130 8:52852939-52852961 GAGGGCGAGCCAAAGCAGGGTGG - Intergenic
1041287152 8:56272936-56272958 GATGCCGAGCCGAAGCTGGACGG - Intergenic
1041323396 8:56637612-56637634 GAAGGCGAGCCAAAGCAGGGTGG - Intergenic
1041723585 8:60998239-60998261 GGTGCTGAGTCAATGCTGGAGGG + Intergenic
1041921009 8:63180927-63180949 GATGCCGAGCCGAAGCTGGACGG - Intronic
1042327324 8:67541793-67541815 GAGGGCGAGCCAAAGCAGGGTGG - Intronic
1046636111 8:116678032-116678054 GATGCCGAGCCAAAGCTGGACGG + Intronic
1047388755 8:124432784-124432806 GATGCCGAGCCGAAGCTGGACGG - Intergenic
1048708162 8:137178040-137178062 CATGACTAGCAAAAGCTGGAAGG + Intergenic
1049892562 9:83868-83890 GATGCCGAGCCAAAGCTGGACGG - Intergenic
1051243748 9:15087592-15087614 GATGTCGAGCAATAACTGGAAGG + Intergenic
1056000904 9:82215740-82215762 GAGGGCGAGCCAAAGCAGGGTGG + Intergenic
1056249754 9:84735447-84735469 GATGCCCTGCAGAAGCTGGAGGG + Intronic
1057155263 9:92832412-92832434 GATGCCGAGCCGAAACTGGACGG - Intergenic
1059143900 9:111879890-111879912 TATGGCAAGCAAAAGCTGGAAGG + Intergenic
1059707942 9:116841330-116841352 CATGCCGAGCCGAAGCTGGACGG - Intronic
1061470863 9:130824394-130824416 GATGCCCAGCCAAAGTGGGGAGG + Intronic
1062175022 9:135156841-135156863 GGGGCAGAGCCCAAGCTGGATGG + Intergenic
1062360703 9:136186604-136186626 GAGGCTGAGCCAGAGCTGGGTGG - Intergenic
1203464179 Un_GL000220v1:69302-69324 GATGCCGAGCCGAAGCTGGATGG - Intergenic
1186245303 X:7610251-7610273 GATGCCGAGCTGAAGCTGGACGG - Intergenic
1186955144 X:14673515-14673537 GATGAGGAGCCAAATCAGGAAGG - Intronic
1188368135 X:29335216-29335238 GATGCCGAGCCAAAGCTGGACGG - Intronic
1188758038 X:33988068-33988090 GATGCAATGCCAAATCTGGAAGG + Intergenic
1189838230 X:45042205-45042227 GATGCCGAGCCGAAGCTGGACGG - Intronic
1190778804 X:53577561-53577583 GATGCCGAGCCAAAGCTGGACGG + Intronic
1191181126 X:57565077-57565099 GATGCCAAGCTGAAGCAGGACGG + Intergenic
1191835206 X:65456481-65456503 GATGCCGAGCCAAAGCTGGACGG + Intronic
1192106834 X:68325908-68325930 CATGCCGAGCCAAAGCTGGACGG + Intronic
1192386655 X:70679008-70679030 GATGCCGAGCTGAAGCTGGACGG + Intronic
1192567538 X:72177985-72178007 GATGCCGAGCCAAGGCTGGACGG + Intergenic
1192977741 X:76303715-76303737 GAGGGCGAGCCAAAGCAGGGTGG - Intergenic
1193338534 X:80319417-80319439 GAGGGCGAGCCAAAGCAGGGTGG + Intergenic
1193774127 X:85622295-85622317 GAAGGCGAGCCAAAGCAGGGTGG + Intergenic
1194098507 X:89673962-89673984 GAGGACGAGCCAAAGCAGGGTGG + Intergenic
1194576431 X:95619228-95619250 GAGGGCAAGCCAAAGCAGGATGG - Intergenic
1196158975 X:112461951-112461973 GAGGGCGAGCCAAAGCAGGGTGG + Intergenic
1197191011 X:123648152-123648174 GAGGGCGAGCCAAAGCAGGGTGG + Intronic
1197639258 X:128950121-128950143 GATACAGAGCCAAAGTTGGAGGG + Intergenic
1199524976 X:148781980-148782002 GATGGCGAGCAGAAGCAGGATGG - Intronic
1200451529 Y:3335337-3335359 GAGGACGAGCCAAAGCAGGGTGG + Intergenic
1201670666 Y:16516420-16516442 GAGGGTGAGCCAAAGCTGGGCGG - Intergenic