ID: 1169246734

View in Genome Browser
Species Human (GRCh38)
Location 20:4031908-4031930
Sequence GGACGGTACTGCTGCCATCT CGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total 1988
Summary {0: 125, 1: 829, 2: 365, 3: 139, 4: 530}

Found 14 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1169246718_1169246734 18 Left 1169246718 20:4031867-4031889 CCTCTCCCTCCCCCGCCCCCCTC No data
Right 1169246734 20:4031908-4031930 GGACGGTACTGCTGCCATCTCGG 0: 125
1: 829
2: 365
3: 139
4: 530
1169246723_1169246734 7 Left 1169246723 20:4031878-4031900 CCCGCCCCCCTCTGATGCCGAGC No data
Right 1169246734 20:4031908-4031930 GGACGGTACTGCTGCCATCTCGG 0: 125
1: 829
2: 365
3: 139
4: 530
1169246729_1169246734 -1 Left 1169246729 20:4031886-4031908 CCTCTGATGCCGAGCCAAAGCTG 0: 166
1: 550
2: 465
3: 361
4: 259
Right 1169246734 20:4031908-4031930 GGACGGTACTGCTGCCATCTCGG 0: 125
1: 829
2: 365
3: 139
4: 530
1169246725_1169246734 3 Left 1169246725 20:4031882-4031904 CCCCCCTCTGATGCCGAGCCAAA No data
Right 1169246734 20:4031908-4031930 GGACGGTACTGCTGCCATCTCGG 0: 125
1: 829
2: 365
3: 139
4: 530
1169246728_1169246734 0 Left 1169246728 20:4031885-4031907 CCCTCTGATGCCGAGCCAAAGCT 0: 141
1: 553
2: 480
3: 361
4: 185
Right 1169246734 20:4031908-4031930 GGACGGTACTGCTGCCATCTCGG 0: 125
1: 829
2: 365
3: 139
4: 530
1169246719_1169246734 13 Left 1169246719 20:4031872-4031894 CCCTCCCCCGCCCCCCTCTGATG No data
Right 1169246734 20:4031908-4031930 GGACGGTACTGCTGCCATCTCGG 0: 125
1: 829
2: 365
3: 139
4: 530
1169246732_1169246734 -10 Left 1169246732 20:4031895-4031917 CCGAGCCAAAGCTGGACGGTACT 0: 66
1: 172
2: 632
3: 324
4: 135
Right 1169246734 20:4031908-4031930 GGACGGTACTGCTGCCATCTCGG 0: 125
1: 829
2: 365
3: 139
4: 530
1169246717_1169246734 19 Left 1169246717 20:4031866-4031888 CCCTCTCCCTCCCCCGCCCCCCT No data
Right 1169246734 20:4031908-4031930 GGACGGTACTGCTGCCATCTCGG 0: 125
1: 829
2: 365
3: 139
4: 530
1169246726_1169246734 2 Left 1169246726 20:4031883-4031905 CCCCCTCTGATGCCGAGCCAAAG No data
Right 1169246734 20:4031908-4031930 GGACGGTACTGCTGCCATCTCGG 0: 125
1: 829
2: 365
3: 139
4: 530
1169246724_1169246734 6 Left 1169246724 20:4031879-4031901 CCGCCCCCCTCTGATGCCGAGCC No data
Right 1169246734 20:4031908-4031930 GGACGGTACTGCTGCCATCTCGG 0: 125
1: 829
2: 365
3: 139
4: 530
1169246721_1169246734 9 Left 1169246721 20:4031876-4031898 CCCCCGCCCCCCTCTGATGCCGA No data
Right 1169246734 20:4031908-4031930 GGACGGTACTGCTGCCATCTCGG 0: 125
1: 829
2: 365
3: 139
4: 530
1169246727_1169246734 1 Left 1169246727 20:4031884-4031906 CCCCTCTGATGCCGAGCCAAAGC No data
Right 1169246734 20:4031908-4031930 GGACGGTACTGCTGCCATCTCGG 0: 125
1: 829
2: 365
3: 139
4: 530
1169246722_1169246734 8 Left 1169246722 20:4031877-4031899 CCCCGCCCCCCTCTGATGCCGAG No data
Right 1169246734 20:4031908-4031930 GGACGGTACTGCTGCCATCTCGG 0: 125
1: 829
2: 365
3: 139
4: 530
1169246720_1169246734 12 Left 1169246720 20:4031873-4031895 CCTCCCCCGCCCCCCTCTGATGC No data
Right 1169246734 20:4031908-4031930 GGACGGTACTGCTGCCATCTCGG 0: 125
1: 829
2: 365
3: 139
4: 530

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1169246734 Original CRISPR GGACGGTACTGCTGCCATCT CGG Intergenic
900381960 1:2389059-2389081 GGAGTGCAATGCTGCCATCTCGG - Intronic
900808021 1:4780680-4780702 GGAGTGTAGTGGTGCCATCTCGG + Intronic
901030879 1:6306125-6306147 GGACTGTGCTGCTGCCATCTTGG - Intronic
901100676 1:6716210-6716232 GGATGGTACTGCTGCCATCTCGG - Intergenic
901221863 1:7587949-7587971 AGAAGCTACAGCTGCCATCTGGG - Intronic
901270823 1:7952136-7952158 GGACGGTACTGCTGCCATCTCGG + Intergenic
901478169 1:9505078-9505100 GGAATGCAGTGCTGCCATCTCGG - Intergenic
901555453 1:10028421-10028443 GGACTGTACTGCTGCCATCTCGG + Intergenic
901558664 1:10052115-10052137 GGAGTGTAGTGGTGCCATCTTGG + Intronic
901734972 1:11306507-11306529 GGACTGTACTGCTGCCATCTCGG - Intergenic
901855649 1:12042733-12042755 GGACTGTACTGCTGCCATCTCGG + Intergenic
901869422 1:12128883-12128905 GGAGTGCACTGGTGCCATCTGGG + Intronic
901896075 1:12313356-12313378 GGACTGCAGTGGTGCCATCTCGG + Intronic
901970231 1:12902453-12902475 GGACTGTACTGCTGCCATCTCGG + Intronic
902006131 1:13233677-13233699 GGAGTGTAGTGTTGCCATCTCGG + Intergenic
902014936 1:13299316-13299338 GGACTGTACTGCTGCCATCTCGG - Intergenic
902018500 1:13327697-13327719 GGACGGTACTGCTGCCATCTCGG + Intergenic
902027659 1:13395622-13395644 GGACTGTACTGCTGCCATCTTGG - Intergenic
902062450 1:13657448-13657470 GGACGGTACTGCTGCCATCTCGG + Intergenic
902586611 1:17442971-17442993 GGACTGTAGTGGCGCCATCTTGG + Intergenic
903081199 1:20814842-20814864 GGACGGTACTGCTGCCATCTCGG + Intronic
903100200 1:21023328-21023350 GGACTGTACTGCTGCCATCTCGG + Intronic
903103251 1:21052640-21052662 GGACTGTACTGCTGCCATCTCGG + Intronic
903163128 1:21503393-21503415 GGACTGTACTGCCGCCATCTCGG - Intergenic
903426301 1:23256872-23256894 GGACTGTACTGCCACCATCTCGG + Intergenic
903458169 1:23503328-23503350 GGACTGTACTGCTGCCATCTCGG + Intergenic
903485682 1:23688247-23688269 GGACTGTACTGCTGCCATCTCGG + Intergenic
903508002 1:23852535-23852557 GGACTGTACTGCTGCCACCTCGG + Intronic
903519273 1:23935050-23935072 GGACTGTACTGCTGCCATCTCGG + Intergenic
903531364 1:24032814-24032836 GGACTGTACTGCTGCCATCTCGG - Intergenic
903633762 1:24798715-24798737 GGACTGTACTGCCGCCATCTCGG + Intronic
903638136 1:24834757-24834779 GGACGGTACTGCTGCCATCTCGG - Intronic
903748299 1:25603319-25603341 GGACTGTACTGCTGCCATCTCGG + Intergenic
903857288 1:26344728-26344750 GGATGCTACTGCTGCCTTTTGGG + Exonic
903894597 1:26595536-26595558 GGACTGTACTGCTGCCATCTCGG + Intergenic
903921785 1:26804791-26804813 GGACTGTACTGCTGCCATCTCGG - Intergenic
903961953 1:27063505-27063527 GGACGGTACTGCTGCCATCTCGG + Intergenic
903993495 1:27289921-27289943 GGACTGTACTGCTGCCATCTCGG - Intronic
904024661 1:27494883-27494905 GGAGTGTAGTGCTGCGATCTCGG - Intergenic
904077180 1:27852207-27852229 GGACTGTACTGCTGCCATCTCGG + Intergenic
904349050 1:29893233-29893255 GGGCAGTACTGCTGCCATGATGG + Intergenic
904531922 1:31175869-31175891 GGACTGTACTGCCGCCATCTCGG + Intergenic
904761152 1:32805164-32805186 GGACTGTACTGCCGCCATCTTGG - Intronic
904784935 1:32975776-32975798 GGACGGTACTGCTGCCATCTCGG - Intergenic
904831804 1:33310239-33310261 GGACTGTACTGCCGCCATCTCGG - Intronic
905315443 1:37079838-37079860 GGACTGCACTGCTGCCATCTCGG + Intergenic
905427198 1:37895572-37895594 GGACGGTACTGCTGCCATCTCGG + Intronic
905526916 1:38646868-38646890 GGACTGTACTGCTGCCATCTCGG + Intergenic
905673329 1:39807745-39807767 GGACTGTACTGCCGCCATCTCGG + Intergenic
905680716 1:39869162-39869184 GGACTGTAGTGCCGCCATCTCGG + Intronic
905686777 1:39913952-39913974 GGACGGTACTGCTGCCATCTCGG - Intergenic
905699170 1:39999113-39999135 GGACTGTACTGCTGCCATCTCGG + Intergenic
905948849 1:41928008-41928030 GGAGTGTAATGCTGCAATCTCGG - Intronic
906113779 1:43341941-43341963 GGAGGGCAGTGGTGCCATCTCGG + Intronic
906136006 1:43501343-43501365 GGACTGCACTGCTGCCATCTCGG + Intergenic
906320830 1:44814346-44814368 GGAGGGCAGTGGTGCCATCTCGG + Intronic
906326998 1:44852726-44852748 GGAGTGTAATGCTGCGATCTCGG - Intronic
906329812 1:44875844-44875866 GGACTGTACTGCTGCCATCTCGG + Intronic
906357135 1:45116043-45116065 GGACTGTACTGCCGCCATCTCGG - Intronic
906370215 1:45247529-45247551 GGACTGTATTGCCACCATCTCGG + Intronic
906427041 1:45724041-45724063 GGACTGTACTGCTGCCATCTCGG + Intronic
906741801 1:48191811-48191833 GGACAGTACTGCTGCCATCTCGG + Intergenic
906762071 1:48384272-48384294 GGACGGTACTGCTGCCATCTCGG - Intronic
906770465 1:48478797-48478819 GGACTGTACTGCTGCCATCTCGG + Intergenic
906956671 1:50381072-50381094 GGACTGTACTGCTGCCATCTCGG + Intergenic
907009694 1:50952167-50952189 GGACTGGACTGCCGCCATCTCGG + Intronic
907057031 1:51379168-51379190 GGAGTGCAATGCTGCCATCTTGG + Intronic
907089795 1:51712338-51712360 GGACTGTACTGCTGCCATCTCGG - Intronic
907140414 1:52181142-52181164 GGACTGTACTGCTGCCATCTCGG + Intronic
907494955 1:54837530-54837552 GCAGGGTACTGCTGGCATGTGGG + Intronic
907619979 1:55967744-55967766 GGAGTGCAGTGCTGCCATCTTGG + Intergenic
907792496 1:57681087-57681109 GTATGATACTGCTGACATCTTGG - Intronic
907924015 1:58939169-58939191 GGAGTGCACTGGTGCCATCTCGG - Intergenic
907966003 1:59330516-59330538 GGAGGGCAGTGCTGCGATCTCGG - Intronic
908370046 1:63472530-63472552 GGACGGTACTGCTGCCATCTCGG + Intronic
908445993 1:64200524-64200546 GGACTGTACTGCTGCCATCTCGG + Intergenic
908467701 1:64414308-64414330 GGACTGTACTGCTGTCATCTCGG + Intergenic
908746494 1:67381713-67381735 GGAGGGCAGTGGTGCCATCTCGG - Intronic
909479174 1:76113275-76113297 GGACTGTACTGCTGCCATCTCGG - Intronic
909641294 1:77871022-77871044 GGACGGTACTGCTGCCATCTCGG - Intronic
910343620 1:86215172-86215194 GGACTGTACTGCTGCCATCTCGG + Intergenic
910407114 1:86900524-86900546 GGACTGTACTGCTGCCATCTCGG - Intronic
910412860 1:86964574-86964596 GGACTGTACTGCTGCCATCTCGG - Intronic
910444447 1:87285947-87285969 GGAGGGCAATGGTGCCATCTCGG - Intergenic
910777681 1:90892475-90892497 GGACTGTACTGCTGCCATCTCGG - Intergenic
910815867 1:91289796-91289818 GGACTGTGCTGCCGCCATCTCGG - Intronic
910891814 1:92026821-92026843 GGACGGTACTGCCGCCAACTCGG - Intergenic
911326009 1:96470529-96470551 GGACTGTACTGCTGCCATCTCGG - Intergenic
911534149 1:99079390-99079412 GGACTGTACTGCCACCATCTCGG - Intergenic
911598433 1:99823015-99823037 GGACTGTACTGCTGCCATCTCGG + Intergenic
911602192 1:99857748-99857770 GGACTGTACTGCCGCCATCTCGG - Intronic
912266324 1:108160886-108160908 GGACTGTACTGCTGCCATCTCGG - Intronic
912298682 1:108490755-108490777 GGACTGTACTGCTGCCATCTCGG - Intergenic
912316823 1:108675140-108675162 GGACTGTACTGCTGCCATCTCGG + Intergenic
912355612 1:109052710-109052732 GGACTGTACTGCCGCCATCTCGG + Intergenic
912358275 1:109073458-109073480 GGACTGTACTGCAGCGATCTGGG + Intronic
912669242 1:111608837-111608859 GGACTGTACTGCTGCCATCTCGG - Intronic
912751536 1:112292641-112292663 GGACTGTACTGCTGCGATCTCGG + Intergenic
912844183 1:113064313-113064335 GGACTGTACTGCCGCCATCTCGG - Intergenic
913021299 1:114791401-114791423 GGACTATACTGCTGCCATCTCGG - Intergenic
913022955 1:114805267-114805289 GGACTGTACTGCTGCCATCTCGG - Intergenic
913058972 1:115187448-115187470 GGAGGGTACTGCTGTCATCCAGG - Intergenic
913306377 1:117431135-117431157 GGACTGTACTGCTGCCATCTCGG - Intronic
913993604 1:143637135-143637157 GGACTGTACTGCTGCGATCTCGG + Intergenic
914001971 1:143702123-143702145 GGACTGTACTGCTGCCATCTCGG + Intergenic
914230827 1:145763973-145763995 GGACTGTACTGCTGCCATCTCGG + Intronic
914231685 1:145767909-145767931 GGACTGTGCTGCTGCCATCTCGG - Intronic
914237322 1:145823896-145823918 GGACGGGCCGGCTGCCCTCTCGG - Exonic
914392029 1:147232558-147232580 GGACTGTACTGCTGCCATCTTGG + Intronic
914468480 1:147950869-147950891 GGACTGTACTGCTGCCATCTCGG - Intronic
914775435 1:150729911-150729933 GGACTGTACTGCTGCCATCTCGG - Intergenic
914780430 1:150780935-150780957 GGACTGTACTGCTGCCATCTCGG + Intergenic
914853546 1:151333249-151333271 GGAGTGTAGTGGTGCCATCTCGG + Intergenic
914887848 1:151599648-151599670 GGACGGTACTGCTGCCATCTCGG + Intergenic
914893994 1:151652127-151652149 GGACTGTACTGCTGCCATCTCGG - Intronic
914909126 1:151770008-151770030 GGACTGTACTGCTGCCATCTCGG - Intronic
914954098 1:152145574-152145596 GGACTGTACTGCCACCATCTCGG - Intergenic
914960045 1:152197160-152197182 GGACTGTACTGCTGCCATCTCGG - Intergenic
914965964 1:152257085-152257107 GGACTGTACTGCTGCCATCTCGG - Intergenic
914987468 1:152472692-152472714 GGACTGTACTGCTGCCTTCTCGG - Intergenic
915113726 1:153582374-153582396 GGACTGTACTGCTGCCATCTCGG + Intergenic
915208235 1:154286979-154287001 GGACGGTACTGCTGCCATCTCGG + Intergenic
915502193 1:156327350-156327372 GGACTGTACTACTGCCATCTCGG + Intronic
916049901 1:161029027-161029049 GGACTGTACTGCCGCCATCTCGG + Intronic
916087640 1:161282323-161282345 GGACTGTACTGCTGCCATCTCGG - Intronic
916131783 1:161617301-161617323 GCACTGTGCTGCTGCCATCTCGG - Intronic
916223274 1:162465462-162465484 GGACTGTACTGCTGCCATCTCGG + Intergenic
916324989 1:163546451-163546473 GGACTGTACTGCAGCCATCTCGG - Intergenic
916671867 1:167029306-167029328 GGACTGTACTGCCGCCATCTCGG + Intergenic
916756172 1:167772070-167772092 GGACTGTACTGCCGTGATCTTGG - Intronic
917006025 1:170418311-170418333 GGACTGTACTGCTGCCATCTCGG + Intergenic
917205799 1:172571118-172571140 GGGGGGTACTGCTGCCATCTCGG + Intronic
917304454 1:173612650-173612672 GGACTGTACTGCTGCCATCTCGG + Intronic
917376254 1:174351016-174351038 GGACTGTACTGCTGCCATCTCGG - Intronic
917553163 1:176057394-176057416 GAACTGTACTGCTGCCATCTCGG + Intronic
917848585 1:179041562-179041584 GGACTGTACTGCTGCCATCTCGG - Intronic
917859739 1:179134789-179134811 GGACGGTACTGCTGCCATCTCGG + Intronic
917889294 1:179419550-179419572 GGACTGTACTGCTGCCATCTCGG - Intronic
917921879 1:179757467-179757489 GGAGGGCACTGATGCCATCAGGG - Intronic
917928667 1:179809054-179809076 GGAGTGTAGTGCTGCAATCTCGG - Intronic
918172325 1:182010286-182010308 GGACTGTACTGCCGCCATCTCGG + Intergenic
918255503 1:182742675-182742697 GGACGGTACTGCTGCCATCTCGG - Intergenic
918271487 1:182905983-182906005 GGAGGGCAATGCTGCGATCTCGG + Intronic
918812645 1:189140548-189140570 GGACTGTGCTGCCACCATCTCGG - Intergenic
918818666 1:189225112-189225134 GGACTGTACTGCCGCCATCTCGG + Intergenic
919423742 1:197405135-197405157 GGACTGTACTGCTGCCATCTCGG + Intronic
919624313 1:199896302-199896324 GGAGTGTAGTGGTGCCATCTGGG + Intergenic
919625407 1:199905276-199905298 GGACTGTACTGCTGCCATCTCGG - Intergenic
919647109 1:200106106-200106128 GGAGGGCAGTGGTGCCATCTCGG + Intronic
919926051 1:202192422-202192444 GGACTGTACTGCTGCCATCTCGG - Intergenic
919959564 1:202452486-202452508 GGACTGTACTGCTGCCATCTCGG - Intronic
920144054 1:203842534-203842556 GGACTGTACTGCTGCCATCTCGG - Intronic
920451358 1:206063451-206063473 GGACTATACTGCTGCCATCTCGG + Intronic
920794785 1:209128537-209128559 GGACTGTACTGCTGCCATCTCGG + Intergenic
921109001 1:212014605-212014627 GGACTGTGCTGCCGCCATCTCGG + Intronic
921142843 1:212322124-212322146 GGACTGTACTGCTGCCATCTCGG - Intronic
921192630 1:212724305-212724327 GGACTGTACTGCCGCCATCTCGG + Intergenic
921197943 1:212778458-212778480 GGACTGTACTGCTGCCATCTCGG + Intronic
921238541 1:213153165-213153187 AGACTGTACTGCTGCCATCTCGG - Intronic
921638584 1:217524797-217524819 GGACTGTACTGCTGCCATCTCGG - Intronic
921813898 1:219545064-219545086 GGACTGTACTGCTGCCATCTGGG + Intergenic
921902937 1:220467454-220467476 GGACTGTACTGCTGCCATCTCGG - Intergenic
922102305 1:222487058-222487080 GGACTGTACTGCTGCCATCTCGG + Intergenic
922278371 1:224100276-224100298 GGACGGTGCTGCTGCCATCTCGG + Intergenic
922402374 1:225273386-225273408 GGACTGCACTGGTGCGATCTCGG - Intronic
922436808 1:225615102-225615124 GGACTGTGCTGCCGCCATCTCGG + Intronic
922503999 1:226115885-226115907 GGACTGTACTGCTGCCATCTCGG - Intergenic
922608255 1:226904699-226904721 GGAGTGTAGTGGTGCCATCTTGG + Intronic
922632654 1:227132199-227132221 GGAGAGTACTGCTACCATCTCGG + Intronic
922644735 1:227275662-227275684 GGACTGTACTGCCGCCATCTCGG + Intronic
922693343 1:227711787-227711809 GGACTGTACTGCTGCCATCTCGG - Intergenic
922943289 1:229487892-229487914 GGAGGGTAGTGGTGCAATCTTGG + Intronic
922993145 1:229932501-229932523 GGACTGTACTGCCACCATCTCGG - Intergenic
923136946 1:231127959-231127981 GGACTGTACTGCTGCCATCTCGG + Intergenic
923174738 1:231453614-231453636 GGACTGTACTGCCGCCATCTCGG + Intergenic
923383452 1:233444072-233444094 GGAGTGTAGTGGTGCCATCTTGG + Intergenic
923468399 1:234268389-234268411 GGACGGTACTGCTGCCATCTCGG - Intronic
923607164 1:235454487-235454509 GGAGTGTAGTGGTGCCATCTCGG + Intronic
923710622 1:236385983-236386005 GGACTGTACTGCTGCCATCTCGG + Intronic
923749020 1:236729271-236729293 GGAGGGCAGTGGTGCCATCTCGG - Intronic
923793182 1:237128310-237128332 GGACTGTACTGCTGCCATCTCGG - Intronic
923841008 1:237670225-237670247 GGACTGTACAGCTGCCATCTCGG - Intronic
924307183 1:242701924-242701946 GGAGGGCAGTGGTGCCATCTCGG + Intergenic
924634675 1:245774760-245774782 GGACTGTACTGCTGCCATCTCGG + Intronic
924692116 1:246362520-246362542 GGACTGTACTGCTGCCATCTCGG + Intronic
924765828 1:247031624-247031646 GGACTGTGCTGCTGCCATTTCGG + Intergenic
924788255 1:247220048-247220070 GGACTGTACTGCTGCCATCTCGG + Intergenic
924823992 1:247521440-247521462 GGACTGTACTGCCGCCATCTTGG + Intronic
924925493 1:248676360-248676382 GGACTGTACTGCTGCGATCTCGG + Intergenic
924943601 1:248829830-248829852 GGACTGTACTGCTGCCATCTCGG + Intergenic
1063084824 10:2806916-2806938 GGACTGTACTGCTGCCATCTCGG - Intergenic
1063284138 10:4664604-4664626 GGAGTGCAGTGCTGCCATCTCGG + Intergenic
1063459734 10:6207373-6207395 GGACTGTACTGCTGCCATCTCGG - Intronic
1063744783 10:8868439-8868461 GGACTATGCTGCTGCCATCTCGG + Intergenic
1064070889 10:12227192-12227214 GGACTGTAGTGCCGCCATCTCGG - Intronic
1064108815 10:12520865-12520887 GGACGGTACTGCTGCCATCTCGG - Intronic
1064109251 10:12523681-12523703 GGACTGTACTGCTGCCATCTCGG - Intronic
1064265018 10:13819075-13819097 GGAGGGTAGTGGTGCGATCTCGG - Intronic
1064298161 10:14097089-14097111 GGAGGGCAATGGTGCCATCTTGG - Intronic
1064299702 10:14112574-14112596 GGACTGTAGTGGCGCCATCTTGG + Intronic
1064405668 10:15059753-15059775 GGATTGTAGTGGTGCCATCTTGG - Intronic
1064906909 10:20356915-20356937 GGAGTGCACTGGTGCCATCTTGG - Intergenic
1065017004 10:21471250-21471272 GGAGTGTAGTGGTGCCATCTCGG + Intergenic
1065055188 10:21836970-21836992 AGACTGTACTGCTGCCATCTCGG + Intronic
1065461419 10:25969180-25969202 GGAGTGTACTGGTGCAATCTCGG - Intronic
1065583733 10:27197694-27197716 GGACTGCAATGGTGCCATCTTGG + Intronic
1065594566 10:27297419-27297441 GGACTGTACTGCTGCCATCTCGG - Intergenic
1065676313 10:28178183-28178205 AGGGGGTACTGCTGGCATCTAGG - Intronic
1065737906 10:28771229-28771251 GGACTGTACTGCCGCCATCTCGG + Intergenic
1065840210 10:29696011-29696033 GGACTGTACTGCTGCCATCTCGG + Intronic
1065887199 10:30088925-30088947 GGACTGCAGTGCTGCTATCTTGG - Intronic
1065888267 10:30098025-30098047 GGACGGTATTGCTGCCAAATGGG + Intronic
1066085166 10:31969143-31969165 GGACGGTACTGCTGCCATCTCGG + Intergenic
1066115383 10:32234205-32234227 CGACTGTACTGCCGCCATCTCGG - Intergenic
1066325217 10:34352405-34352427 GGACTGTACTGCTGCCATCTCGG + Intronic
1066952759 10:42137602-42137624 GGACTGTACTGCTGCCATTTCGG + Intergenic
1066982201 10:42427117-42427139 GGAGTGCAGTGCTGCCATCTTGG - Intergenic
1067026308 10:42846761-42846783 GGACTGTACTGCTGCCATCTCGG + Intergenic
1067114265 10:43422694-43422716 GGACGGTACTGCTGCCATCTCGG + Intergenic
1067120225 10:43466124-43466146 GGACTGTACTGCTGCCATCTCGG - Intronic
1067128284 10:43539090-43539112 GGAGTGTAGTGGTGCCATCTTGG + Intergenic
1067325031 10:45259376-45259398 GGACTGTGCTGCTGCCGTCTCGG + Intergenic
1067331996 10:45330845-45330867 GGACTGTACTGCTGCCATCTCGG - Intergenic
1067339625 10:45391152-45391174 GGACTGTACTGCTGCCATCTCGG + Intronic
1067347021 10:45444227-45444249 GGCCGCTCCTGCTGGCATCTGGG + Exonic
1067354313 10:45511467-45511489 GGACTGTACTGCTGCCATCTCGG + Intronic
1067391393 10:45866301-45866323 GGACTGTACTGCTGCCATCTCGG - Intergenic
1067486142 10:46652595-46652617 GGACTGCAGTGTTGCCATCTAGG + Intergenic
1067608613 10:47689060-47689082 GGACTGCAGTGTTGCCATCTAGG - Intergenic
1067871897 10:49969850-49969872 GGACTGTACTGCTGCCATCTCGG + Intronic
1067878007 10:50021216-50021238 GGAGTGTACTGGTGCGATCTCGG + Intergenic
1067911949 10:50355334-50355356 GGACTGTACTGCCGCCATCTCGG + Intronic
1068667836 10:59696163-59696185 GGACTGTGCTGCTGCCATCTTGG + Intronic
1068698501 10:59995163-59995185 GGAGTGTAGTGGTGCCATCTCGG + Intergenic
1068969442 10:62947084-62947106 GGACTGTACTGCTGCCATCTCGG + Intergenic
1069052855 10:63812400-63812422 GGACTGTACTGCTGCCATCTGGG - Intergenic
1069365495 10:67690951-67690973 GGACGGTACTGCTGCCATCTCGG + Intronic
1069645608 10:69993805-69993827 GGACGGTACTGCTGCCATCTCGG - Intergenic
1069675098 10:70240674-70240696 GGACTGTACTGCCGTGATCTCGG - Intergenic
1069732822 10:70630485-70630507 GGACTGTACTGCTGCCATCTTGG + Intergenic
1069741612 10:70688793-70688815 GGACTGTACTGCTGCCATCTCGG - Intronic
1069777088 10:70933554-70933576 GGAGGCTACTGCTGTCATCCAGG - Intergenic
1069929124 10:71870381-71870403 GGACTGTACTGCTGCCATCTCGG - Intergenic
1069930202 10:71876632-71876654 GGATGGTACTGCTGCCATCTCGG - Intergenic
1070135303 10:73689046-73689068 GGACCGTACTGCTGCCATCTCGG + Intronic
1070367592 10:75751251-75751273 GGACTGTGCTGCCGCCATCTCGG - Intronic
1070629818 10:78076593-78076615 GGACTGTTCTGCCGCCATCTCGG - Intergenic
1070684307 10:78469620-78469642 GGACTGTACTGCTGCCATCTCGG - Intergenic
1070807666 10:79279898-79279920 GGACTGTACTGCCGCCATCTCGG - Intronic
1070903680 10:80053025-80053047 GGAGTGTAGTGGTGCCATCTTGG + Intergenic
1070966315 10:80533448-80533470 GGACTGTACTGCTGCCATCTCGG + Intergenic
1071064679 10:81616621-81616643 GGAGGGCAGTGGTGCCATCTTGG - Intergenic
1071289877 10:84181022-84181044 GGACTGTACTGCCGCCGTCTTGG - Intronic
1071538192 10:86454437-86454459 GGACTGTACTGCCGCCATCTCGG + Intronic
1071624195 10:87150707-87150729 GGACTGCAGTGTTGCCATCTAGG - Intronic
1072069684 10:91904235-91904257 GGAGTGTAGTGGTGCCATCTTGG + Intergenic
1072180154 10:92974625-92974647 GCACTGTACTGCTGCCATCTCGG + Intronic
1072291558 10:93970099-93970121 GGACTGTACTGCCGCCATCTCGG + Intergenic
1072561202 10:96576457-96576479 GGAAGGTGCTACTGGCATCTGGG + Intronic
1072583511 10:96760988-96761010 GGACTGCAGTGGTGCCATCTCGG - Intergenic
1072684773 10:97529681-97529703 GGACTGTGCTGCTGCCATCTCGG - Intronic
1072730190 10:97841069-97841091 GGACTGTACTGCCGCCATCTCGG + Intergenic
1072772242 10:98152012-98152034 GGACTGTACTGCTGCCATCTCGG + Intronic
1072956321 10:99891243-99891265 GGACTGTACTGCTGCCATCTCGG + Intronic
1072980006 10:100092250-100092272 GGACTGTACTGCTGCCATCTCGG + Intergenic
1072999526 10:100276561-100276583 GGACTGTACTGCTGCCATCTCGG + Intronic
1073079033 10:100845619-100845641 GGAGTGCAGTGCTGCCATCTTGG + Intergenic
1073238079 10:102035463-102035485 GGACTGTACTGCTGCCATCTCGG + Intronic
1073275008 10:102302201-102302223 GGACTGTACTCCCGCCATCTCGG - Intronic
1073385887 10:103128135-103128157 GGACTGTACTGCTGCCATCTCGG + Intronic
1074002640 10:109388043-109388065 GGACTGCAGTGGTGCCATCTCGG + Intergenic
1074152303 10:110768166-110768188 GGACTGTACTGCTGCCATCTCGG - Intronic
1075013650 10:118894994-118895016 GGACTGTACTGCTGCCATCTCGG + Intergenic
1075045892 10:119146617-119146639 GGAGTGTAATGGTGCCATCTTGG + Intronic
1075051155 10:119183134-119183156 GGACGGTACTGCTGCCATCTCGG - Intergenic
1075061815 10:119261835-119261857 GGACTATACTGCTGCCATCTCGG - Intronic
1075108692 10:119560371-119560393 GGACTGTACTGCCGCCATCTCGG - Intergenic
1075128650 10:119721417-119721439 GGACTGTACTGCTGCCATCTCGG + Intergenic
1075137359 10:119796014-119796036 GGACGGTACTGCTGCCATCTCGG - Intronic
1075181603 10:120215978-120216000 GGACTGTACTGCTGCCATCTCGG - Intergenic
1075407446 10:122204094-122204116 GGACTGTACTGCTGCCACCTCGG - Intronic
1075842637 10:125517828-125517850 GGACTGTACTGCTGCCATCTCGG + Intergenic
1075893068 10:125970750-125970772 GGACTGTACTGCCGCGATCTCGG - Intronic
1076011902 10:126995576-126995598 GGACTGTACTGCCGCCATCTCGG - Intronic
1076212318 10:128658533-128658555 TGACGGAAGTGCTGCCACCTGGG + Intergenic
1076470599 10:130715551-130715573 GGACTGTAATGGTGCAATCTCGG + Intergenic
1076477569 10:130763080-130763102 GGAGGGCAGTGGTGCCATCTCGG - Intergenic
1077040049 11:516898-516920 GGACTGTACTGCTGTGGTCTCGG + Intergenic
1077397383 11:2331817-2331839 GGACTGTACTGCTGCCATCTCGG + Intergenic
1077680617 11:4237231-4237253 GGACTGTACTGCCGCCATCTCGG + Intergenic
1077684895 11:4282629-4282651 GGACTGTACTGCCGCCATCTCGG + Intergenic
1077690295 11:4335301-4335323 GGACTGTACTGCCGCCATCTCGG - Intergenic
1077836922 11:5934076-5934098 GGACTGTACTGCTGCCATCTTGG + Intronic
1077839516 11:5960319-5960341 GGACTGTACTGCCACCATCTCGG + Intergenic
1078122258 11:8522851-8522873 GGACTGTACTGCCGCCATCTCGG + Intronic
1078176721 11:8977427-8977449 GGACGGTACTGCTGCCATCTCGG + Intergenic
1079018183 11:16887453-16887475 GGACTGTACTGCCGCCATCTCGG + Intronic
1079020436 11:16906380-16906402 GGACTGTACTGCTGCCATCTCGG + Intronic
1079040062 11:17051474-17051496 GGACTGTGCTGCTGCCATCTCGG - Intergenic
1079173765 11:18120517-18120539 GGACTGTACTGCCGCCATCTCGG + Intronic
1079372166 11:19860967-19860989 GGACTGTACTGCTGCCATCTCGG - Intronic
1079444668 11:20547807-20547829 GGACGGTACTGCTGCCATCTCGG + Intergenic
1079479424 11:20864044-20864066 GGGCTGTGCTGCTGCCATCTCGG - Intronic
1079509720 11:21196920-21196942 GGAGTGTAGTGGTGCCATCTTGG + Intronic
1080097776 11:28429427-28429449 GGACTGTACTGCTGCCATCTCGG + Intergenic
1080405121 11:31971947-31971969 GGACTGTACTGCCGCCATCTCGG - Intronic
1080514391 11:33006619-33006641 GGAAGGTACTGCAGTAATCTGGG + Intergenic
1080538240 11:33243146-33243168 GGACTGTACTGCCGCCATCTCGG + Intergenic
1080620730 11:33985613-33985635 GGACTGTACTGCTGCCATCTCGG + Intergenic
1080859910 11:36143988-36144010 GGACTGTACTGCTGCCATCTCGG + Intronic
1080983339 11:37432281-37432303 GGACTGTACTGCTGTGATCTCGG - Intergenic
1081288503 11:41303157-41303179 GGACTGTACTGCTGCCATCTCGG + Intronic
1081312950 11:41595323-41595345 GGAGTGCACTGGTGCCATCTCGG + Intergenic
1081432364 11:42990179-42990201 GGAGTGTAGTGGTGCCATCTCGG - Intergenic
1081546368 11:44074873-44074895 GGAATGTAATGGTGCCATCTTGG + Intronic
1081627166 11:44663001-44663023 GGACTGTACTGCTGCCATCTCGG + Intergenic
1081999757 11:47387772-47387794 GGAGTGTAGTGGTGCCATCTTGG - Intergenic
1082064940 11:47892349-47892371 GGACTGTACTGCCGCCATCTCGG + Intergenic
1082166606 11:48956462-48956484 GGACTGTACTGCCGCCATCTTGG - Intergenic
1082233900 11:49799141-49799163 GGACTGCGCTGCCGCCATCTCGG - Intergenic
1082706063 11:56496620-56496642 GGACTGTACTGCCGCCATCTCGG + Intergenic
1082844952 11:57717639-57717661 GGACTGTACTGCTGCCATCTCGG - Intronic
1082871156 11:57944569-57944591 GGACTGTACTGCCGCCATCTCGG - Intergenic
1082960870 11:58917633-58917655 GGCCTGGACTGCAGCCATCTAGG - Intronic
1083079332 11:60073871-60073893 GGACTGTACTGCTGCCATCTCGG - Intergenic
1083114827 11:60450755-60450777 GGACTGTACTGCTGCCATCTCGG + Intronic
1083118744 11:60490987-60491009 GGACTGTACTGCCACCATCTCGG + Intergenic
1083130549 11:60621436-60621458 GGACTGTACTGCTGCCATCTCGG + Intergenic
1083154441 11:60814540-60814562 GGACTGTACTGCTGCCATCTCGG + Intergenic
1083208418 11:61167191-61167213 GGACTGTACTGCTGCCATCTCGG - Intergenic
1083250960 11:61466752-61466774 GGAGGGCAGTGGTGCCATCTCGG - Intronic
1083382129 11:62277990-62278012 GGACTGTACTGCTGCCATCTCGG + Intergenic
1083646361 11:64173383-64173405 GGACTGTACTGCTGCCATCTCGG - Intergenic
1083831889 11:65238688-65238710 GGACTGTACTGCTGCCATCTCGG + Intergenic
1083865302 11:65450454-65450476 GGACTGTACTGCTGCCATCTCGG + Intergenic
1083918153 11:65763605-65763627 GGACTGTACTGCTGCCATCTCGG - Intergenic
1084048758 11:66587056-66587078 GGACTGTACTGCTGCCATCTCGG + Intergenic
1084338559 11:68476399-68476421 GGACTGTACTGCTGCCATCTCGG - Intronic
1084615923 11:70235873-70235895 GGACTGCAGTGCTGCCATCTCGG + Intergenic
1084624609 11:70296618-70296640 GGACTGTACTGCTGCCATCTCGG - Intronic
1084924974 11:72503466-72503488 GGACTGTACTGCTGCCATCTCGG - Intergenic
1085116876 11:73937609-73937631 GGACTGTACTGCTGCCATCTCGG - Intergenic
1085139844 11:74130009-74130031 GGACTGTACTGCTGCCATCTCGG - Intronic
1085159520 11:74327865-74327887 GGACTGTACTGCCGCCATCTCGG + Intergenic
1085360288 11:75878797-75878819 GGACTGTACTGCTGCCATCTCGG - Intronic
1085443494 11:76583243-76583265 GGACTGTACTGCCGCCGTCTCGG - Intergenic
1085480719 11:76820869-76820891 CTGCTGTACTGCTGCCATCTCGG + Intergenic
1085492653 11:76934621-76934643 GGACTGTACTGCTGCCATCTCGG - Intronic
1085513549 11:77099655-77099677 GGACTGTACTGCTGCCATCTCGG - Intronic
1085563039 11:77489508-77489530 GGACTGTACTGCTGCCATCTCGG + Intergenic
1085578267 11:77626740-77626762 GGACTGCAGTGGTGCCATCTCGG + Intronic
1085609363 11:77933282-77933304 GGACTGTACTGCCACCATCTCGG + Intronic
1085754329 11:79191186-79191208 GGACTGTACTGCTGCCATCTCGG + Intronic
1085791171 11:79499315-79499337 GGACTGTACTGCCGCCATCTCGG + Intergenic
1085822059 11:79804073-79804095 GGACTGTACTGCCGCGATCTCGG + Intergenic
1086017057 11:82181262-82181284 GGACTGTACTGCTGCCATCTCGG + Intergenic
1086104307 11:83132688-83132710 GGACTGTACTGCTGCCATCTTGG + Intergenic
1086122766 11:83317733-83317755 GGACTGTACTGCTGCCATCTCGG - Intergenic
1086341387 11:85852433-85852455 GGACTGTACTGCTGCCATCTCGG + Intergenic
1086365917 11:86109998-86110020 GGACTGTACTGCTGCCATCTCGG + Intergenic
1086430366 11:86731625-86731647 GGACTGTACTGCTGCCATCTCGG + Intergenic
1086434984 11:86771404-86771426 GGACTGTACTGCTGCCATCTCGG - Intergenic
1086446682 11:86878322-86878344 GGACTGTACTGCTGCCATCTCGG + Intronic
1086697098 11:89860082-89860104 GGACTGTACTGCTGCCATCTCGG + Intergenic
1086709060 11:89984405-89984427 GGACTGTACTGCTGCCATCTCGG - Intergenic
1086792673 11:91062915-91062937 GGACTGTACTGCTGCCATCTCGG + Intergenic
1086881330 11:92156961-92156983 GGACTGTACTGCTGCCATCTCGG + Intergenic
1087057534 11:93948172-93948194 GGACTGTACTGCTGCCATCTCGG - Intergenic
1087198483 11:95322002-95322024 GGACTGTACTGCTGCCATCTCGG - Intergenic
1087214596 11:95481877-95481899 GGACTGTACTGCTGCCATCTCGG + Intergenic
1087325494 11:96717006-96717028 GGACTGCAGTGGTGCCATCTTGG - Intergenic
1087487139 11:98770691-98770713 GGACTGTGCTGCCACCATCTTGG - Intergenic
1087735050 11:101822955-101822977 GGACTGCACTGGTGCAATCTGGG - Intronic
1088256962 11:107911864-107911886 GGACTGTACTGCTGCCATCTCGG + Intronic
1088659099 11:112027836-112027858 GGACTGTACTGCTGCCTTCTCGG - Intronic
1089421276 11:118332662-118332684 GGACTGTACTGCTGCCATCTCGG - Intergenic
1089449232 11:118580271-118580293 GGACTGTAATGGTGCAATCTTGG - Intronic
1089510308 11:118992453-118992475 GGACTGTACTGCCGCCATCTCGG - Intergenic
1089520548 11:119059855-119059877 AGACTGTACTGCTGCCATCTCGG - Intergenic
1089585807 11:119508808-119508830 GGACTGTACTGCTGCCATCTCGG - Intergenic
1090322743 11:125862278-125862300 GGACTGTGCTGCTGCCATCTCGG + Intergenic
1090686527 11:129128643-129128665 GGACTGTACTGCCGCCATCTCGG + Intronic
1090762330 11:129848449-129848471 GGACTGTGCTGCTGCCATCTCGG - Intronic
1090785622 11:130044817-130044839 GGACTGTCCTGCTGCCATCTCGG - Intergenic
1090791329 11:130092647-130092669 GGACTGTACTGCTGCCATCTCGG - Intronic
1090907053 11:131085082-131085104 GGACGGTACTGCTGCCATCTCGG - Intergenic
1091378415 12:41317-41339 GGACGGTACTGCTGCCATCTCGG + Intergenic
1091586048 12:1817543-1817565 GGACTGTACTGCTGCCATCTCGG + Intronic
1091739958 12:2953972-2953994 GGACTGCAGTGGTGCCATCTCGG + Intergenic
1092081318 12:5718721-5718743 GGAAGGTACTGGTGCCAGATTGG + Intronic
1092296196 12:7200826-7200848 GGACTGTACTGCTGCCATCTCGG - Intronic
1092331639 12:7591080-7591102 GGACTGTACTGCTGCCATCTCGG - Intergenic
1092453381 12:8624416-8624438 GGACGGTGCTGCTGCCGTCTCGG + Intergenic
1092590802 12:9952245-9952267 GGACTGTACTGCTGCCATCTCGG + Intronic
1092828019 12:12415486-12415508 GGACAGTACTGCTGCCATCTCGG - Intronic
1092843675 12:12565469-12565491 GGACTATACTGCTGCCATCTCGG + Intergenic
1092850160 12:12618975-12618997 GGACTGTACTGCCGCCATCTCGG - Intronic
1092875057 12:12840621-12840643 GGACTGCAGTGGTGCCATCTCGG - Intergenic
1094103093 12:26784410-26784432 GGACGGTGCTGCTGCCATCTCGG + Intronic
1094209259 12:27873391-27873413 GGACTGTACTGCTGCCATCTCGG + Intergenic
1094239220 12:28201964-28201986 GGACTGTACTGCTGCCATCTCGG - Intronic
1094670515 12:32563937-32563959 GGACTGTACTGCTGCCATCTCGG - Intronic
1095068988 12:37815844-37815866 GGACTGTACTGCTGCCATCTCGG - Intergenic
1095222397 12:39632145-39632167 GGAGTGCACTGGTGCCATCTCGG + Intronic
1095281257 12:40353920-40353942 GGGCTGTACTGCTGCCATCTCGG - Intronic
1095452986 12:42350902-42350924 GGACTGTACTGCCGCGATCTCGG - Intronic
1095570921 12:43684428-43684450 GGACTGTACTGCTGCCATCTTGG + Intergenic
1096039575 12:48501445-48501467 GGACTGTACTGCTGCCATCTCGG - Intergenic
1096054648 12:48641414-48641436 GGACTGTACTGCCGTGATCTCGG + Intergenic
1096082242 12:48841520-48841542 GGACCGTACTGCTGCCATCTCGG + Intronic
1096093173 12:48916536-48916558 GGACTATACTGCTGCCATCTCGG - Intronic
1096161423 12:49380653-49380675 GGAGGGCAGTGGTGCCATCTCGG - Intronic
1096167727 12:49437765-49437787 GGACTGTACTGCTGCCATCTCGG - Intronic
1096224814 12:49860292-49860314 GGACTGTACTGCTGCCATCTCGG + Intergenic
1096556864 12:52409131-52409153 GGACTGTACTGCTGCCATCTCGG + Intergenic
1096856822 12:54489179-54489201 GGACTGTACTGCTGCCATCTCGG - Intergenic
1096866294 12:54565629-54565651 GGACGGCACTGCAGCCTCCTTGG - Intronic
1096951775 12:55480007-55480029 GGACTGTACTGCTGCCATCTCGG - Intergenic
1097028697 12:56076662-56076684 GGACTGTACTGCTGCCATCTCGG - Intergenic
1097110209 12:56652373-56652395 GGACTGCACTGCCGCCATCTCGG - Intergenic
1097127271 12:56784613-56784635 GGACTGTACTGCTGCCATCTCGG - Intronic
1097128270 12:56790489-56790511 GGACTGTACTGCTGCCATCTTGG - Intergenic
1097138368 12:56878796-56878818 GGACTGTACTGCCACAATCTCGG + Intergenic
1097148952 12:56962906-56962928 GGACTGTACTGCTGCCATCTCGG + Intergenic
1097228770 12:57495936-57495958 GGACTGTACTGCCGCCATCTCGG - Intronic
1097254641 12:57664521-57664543 GGACTGTACTGCCGTGATCTCGG + Intergenic
1097706258 12:62871563-62871585 GGAGGGTACTGGTGCCATCTTGG + Intronic
1097779407 12:63686217-63686239 GGACTGTGCTGCCGCCATCTCGG + Intergenic
1098018796 12:66133992-66134014 GGACTGTACTGCTGCCATCTCGG + Intronic
1098333278 12:69375838-69375860 GGACTGTACTGCCGCCATCTCGG - Intronic
1098371070 12:69760316-69760338 GGACTGTACTGCTGCCATCTTGG - Intronic
1098379690 12:69854281-69854303 GGACTGTGCTGCCGCCATCTCGG - Intronic
1098412445 12:70201190-70201212 GGACGGTACTGCTGCCATCTCGG + Intergenic
1098774035 12:74588869-74588891 GGACTGTACTGCCGCCATCTCGG - Intergenic
1098883583 12:75941102-75941124 GGACTGTACTGCTGCCATCTCGG + Intergenic
1099255693 12:80308903-80308925 GGACGGTACTGCTGCCATCTCGG - Intronic
1099971201 12:89503174-89503196 GGACTGTACTGCTGCCATCTCGG + Intronic
1100048101 12:90410631-90410653 GGACTGTACTGCCACCATCTCGG + Intergenic
1100281765 12:93125021-93125043 GGAGTGCACTGGTGCCATCTTGG - Intergenic
1100507712 12:95236359-95236381 GGACTGTACTGCTGCCATCTCGG - Intronic
1100549287 12:95632027-95632049 GGAGGGTAGTGGTGCGATCTCGG + Intergenic
1100570914 12:95842312-95842334 GGACGGTACTGCTGCCATCTCGG - Intergenic
1100581854 12:95946685-95946707 GGACTGTACTGCTGCCATCTCGG + Intronic
1100606753 12:96158164-96158186 GGACGGTACTGCTGCCATCTCGG + Intergenic
1100995413 12:100295635-100295657 GGACTGTACTGCTGCCATCTCGG - Intronic
1101403853 12:104411400-104411422 GGAATGCACTGGTGCCATCTCGG - Intergenic
1101505843 12:105345437-105345459 GGAGTGTAGTGGTGCCATCTTGG - Intronic
1102089181 12:110172446-110172468 GGACTGTACTGCTGCCATCTCGG + Intronic
1102175163 12:110868657-110868679 GGACTGTACTGCTGCCATCTCGG - Intronic
1102186519 12:110951792-110951814 GGACTGTGCTGCTGCCATCTCGG - Intergenic
1102236058 12:111295452-111295474 GGACGGTAATGCTGTCAACGAGG + Intronic
1102268139 12:111506723-111506745 AGACTGTACTGCTGCCATCTCGG + Intronic
1102323137 12:111956573-111956595 GGACTATACTGCCGCCATCTCGG + Intronic
1102565073 12:113791707-113791729 GGAGTGTAGTGGTGCCATCTTGG + Intergenic
1102656431 12:114485551-114485573 GGACTGTACTGCCACGATCTCGG - Intergenic
1102918291 12:116772140-116772162 GGAAGGTAGTGGTGCCATCATGG + Intronic
1103045241 12:117730568-117730590 GGACTGTACTGCCGCCATCTCGG + Intronic
1103234662 12:119361072-119361094 GGACTATACTGCTGCCATCTCGG - Intronic
1103300050 12:119919661-119919683 GGACTGTACTGCTGCCATCTCGG - Intergenic
1103456881 12:121075397-121075419 GGACTGTACTGCCGCCATCTCGG + Intergenic
1103591099 12:121993037-121993059 GGACTGTACTGCTGCCATCTCGG + Intronic
1103641545 12:122356697-122356719 GGACTGTACTGCTGCCATCTCGG + Intronic
1103861831 12:124021611-124021633 AGACGGTAGTGGTGCTATCTCGG + Intronic
1103872807 12:124102879-124102901 GGACGGTGCTGCTGCCATCTCGG - Intronic
1104029410 12:125053624-125053646 GGACTGTATTGCTGCCATCTCGG - Intergenic
1104323144 12:127771229-127771251 GGAGTGTAATGGTGCCATCTTGG + Intergenic
1104713024 12:130998110-130998132 GGACTGTACTGCTGCCATCTCGG - Intronic
1104861581 12:131927002-131927024 GGACGGTACTGCTGCCATCTCGG - Intergenic
1105367533 13:19778441-19778463 GGACTGTACTGCTGCCATCTCGG + Intronic
1105527239 13:21187339-21187361 GGACTGTACTGCTGCCATCTCGG - Intergenic
1105534863 13:21256468-21256490 TGAGGGTTCTGCTGCCCTCTGGG + Intergenic
1105555788 13:21447352-21447374 GGACTGTACCGCTGCCATCTCGG + Intronic
1105683462 13:22752867-22752889 GGAGTGCAGTGCTGCCATCTCGG + Intergenic
1105748336 13:23398481-23398503 GGAGTGTAATGGTGCCATCTCGG - Intronic
1105754495 13:23452252-23452274 GGAGGGCAGTGGTGCCATCTGGG + Intergenic
1105921931 13:24971120-24971142 GGACTGTGCTGCTGCCATCTCGG - Intergenic
1105956183 13:25285583-25285605 GGAGTGCACTGGTGCCATCTTGG + Intronic
1105976980 13:25481092-25481114 GGACTGTACTGCTGCCATCTCGG - Intronic
1105980729 13:25513893-25513915 GGACTTTACTGCTCCCATCTCGG - Intronic
1106104602 13:26723218-26723240 GGACTGTACTGCTGCCATCTCGG + Intergenic
1106495077 13:30269141-30269163 GGACTGTACTGCTGCCATCTCGG + Intronic
1106594794 13:31126813-31126835 GCACGGTCCTGCTGACACCTTGG + Intergenic
1106679989 13:31999539-31999561 GGACTGTACTGCTGCCATCTCGG + Intergenic
1106746650 13:32715718-32715740 GGACTGTACTGCTGCCATCTCGG + Intronic
1106747852 13:32722292-32722314 GGACTGTACTGCCGCGATCTCGG - Intronic
1106918414 13:34539903-34539925 GGACTGTACTGCTGCCATCTCGG + Intergenic
1107165673 13:37279712-37279734 GGACTGTACTGCTGCCATCTCGG + Intergenic
1107492949 13:40899808-40899830 GGACTGTACTGCTGCCATCTCGG + Intergenic
1107498707 13:40954507-40954529 GGACTGTACTGCTGCCATCTCGG + Intronic
1107562544 13:41571408-41571430 GGACTGTACTGCCGCCATCTCGG + Intronic
1107589069 13:41882740-41882762 GGACTGTACTGCTGCCATCTCGG - Intronic
1107692311 13:42965853-42965875 GGACTGTACTGCTGCCATCTCGG + Intronic
1107863677 13:44683335-44683357 GGACTGTACTGCCGCCATCTCGG - Intergenic
1107953515 13:45486237-45486259 GGACTGTACTGCTGCCATCTCGG - Intronic
1108024281 13:46162359-46162381 GGACTGTACTGCTGCCGTATGGG + Intronic
1108177838 13:47811895-47811917 TGACAGTACAGCTGACATCTGGG + Intergenic
1108330069 13:49377461-49377483 GGACTGTACTGCTGCCATCTCGG + Intronic
1108347999 13:49565074-49565096 GGACTGTACTGCTGCCATCTCGG + Intronic
1108351158 13:49592211-49592233 GGACTGTACTGCTGCCATCTCGG + Intergenic
1108370181 13:49761298-49761320 GGACTGTACTGCTGCCATCTCGG + Intronic
1108501806 13:51077209-51077231 GGACTGTACTGCTGCCATCTCGG + Intergenic
1108608395 13:52063132-52063154 GGACTGTACTGTTGCCATCTCGG + Intronic
1108610360 13:52079359-52079381 GGACTGTACTGCTGCCATCTCGG + Intronic
1108977425 13:56465420-56465442 GGAGTGTAGTGGTGCCATCTTGG + Intergenic
1109403225 13:61862186-61862208 GGAGTGTAGTGGTGCCATCTCGG - Intergenic
1111230763 13:85341442-85341464 GGACTGTACTGCCTCCATCTTGG - Intergenic
1111388462 13:87561153-87561175 GGACTGTGCTGCCGCCACCTCGG + Intergenic
1111418516 13:87977476-87977498 GGACTGTACTGCTGCCATCTCGG - Intergenic
1111861669 13:93715011-93715033 GGTCAGTTTTGCTGCCATCTTGG + Intronic
1111893234 13:94108789-94108811 GGAGTGCAATGCTGCCATCTTGG - Intronic
1112020876 13:95370042-95370064 GGAGTGTACTGGTGCAATCTTGG - Intergenic
1112070702 13:95846361-95846383 GGACTGTACTGCCGCCATCTTGG - Intronic
1112077431 13:95929130-95929152 GGACTGTACTGCCTCCATCTTGG - Intronic
1112219571 13:97474162-97474184 GGAGTGTAGTGGTGCCATCTTGG - Intergenic
1112358640 13:98696360-98696382 GGAGTGCACTGGTGCCATCTTGG - Intronic
1113012998 13:105792510-105792532 GGAGTGCACTGCTGCAATCTCGG - Intergenic
1113193838 13:107782113-107782135 GGACTGTACTGCCGCCATCTCGG + Intronic
1113328970 13:109310957-109310979 GGACTGTACTGCCGCCATCTCGG + Intergenic
1113343144 13:109446640-109446662 GGACGATAGTGCTGCATTCTCGG + Intergenic
1113479150 13:110607222-110607244 GGACTGTACTGCTGCCATCTCGG - Intergenic
1113735905 13:112678975-112678997 GGACTGTACTGCCGCCATCTCGG - Intronic
1114060197 14:19010898-19010920 GTACGGTACTGCAGGCTTCTTGG + Intergenic
1114101859 14:19387937-19387959 GTACGGTACTGCAGGCTTCTTGG - Intergenic
1114102347 14:19390873-19390895 GTACGGTACTGCAGGCTTCTTGG - Intergenic
1114137103 14:19865770-19865792 GGACTGTACTGCCGCCATCTCGG + Intergenic
1114165018 14:20212119-20212141 GGACTGTACTGCTGCCATCTGGG + Intergenic
1114174628 14:20309402-20309424 GGACTGTACTGCTGCCATCTCGG + Intergenic
1114198942 14:20505373-20505395 GGACGGTACTGCTGCCATCTCGG + Intergenic
1114280355 14:21188276-21188298 GGACTGTACTGCTGCCATCTCGG + Intergenic
1114336541 14:21697349-21697371 GGACTGTACTGCCGCCATCTCGG + Intergenic
1114427511 14:22636470-22636492 GGACGGTGCTGCTGCCATCTCGG + Intergenic
1114507741 14:23231699-23231721 GGACTGTACTGCTGCCATCTCGG + Intronic
1114514324 14:23287861-23287883 GGAATGTAGTGGTGCCATCTTGG + Intronic
1114578606 14:23736389-23736411 GGACTGTACTGCCACCATCTCGG + Intergenic
1114594464 14:23899140-23899162 GGACTGTACTGCCACGATCTCGG - Intergenic
1114979395 14:28144179-28144201 GGAGGGCAATGCTGCAATCTTGG + Intergenic
1115259613 14:31438110-31438132 GGACTGTACTGCTGCCATCTCGG - Intronic
1115494048 14:33985024-33985046 GGACTGTACTGCTGCCATCTCGG - Intronic
1115539984 14:34411363-34411385 GGACTGTGCTGCTGCCATCTCGG + Intronic
1115547302 14:34475521-34475543 GGACTGTAGTGCTGCCATCTCGG + Intergenic
1115622477 14:35153326-35153348 GGACTGTACTGCTGCCATCTCGG - Intronic
1115689106 14:35825519-35825541 GGACTGTACTGCTGCCATCTCGG - Intergenic
1115703903 14:35978569-35978591 GGACTGTACTGCTGCCATCTCGG - Intergenic
1116147289 14:41090455-41090477 GGACTGGACTTCTGCCATCGTGG - Intergenic
1116192204 14:41675539-41675561 GGACTGTACTGCTGCCATCTCGG - Intronic
1116407778 14:44586433-44586455 GGAGTGCAGTGCTGCCATCTCGG + Intergenic
1116408974 14:44600875-44600897 GGACTGTACTGCTGCCATCTCGG + Intergenic
1116840956 14:49820677-49820699 GGACTGTGCTGCTGCCATCTCGG + Intronic
1117276846 14:54202678-54202700 GGACTGTACTGCTGCCATCTCGG + Intergenic
1117350904 14:54880873-54880895 GGAGTGTAATGCTGCAATCTCGG + Intronic
1117596723 14:57333149-57333171 GGACTGTACTGCTGCCATCTCGG + Intergenic
1117674657 14:58143512-58143534 GGAGTGCACTGATGCCATCTCGG + Intronic
1117763813 14:59059603-59059625 GGACTGTACTGCTGCCATCTCGG - Intergenic
1118148440 14:63164895-63164917 GGACTGTACTGCTGCCATCTCGG + Intergenic
1118184005 14:63522003-63522025 GGACTGTACTGCTGCCATCTCGG + Intronic
1118209498 14:63751994-63752016 GGACTGTACTGCTGCCATCTCGG - Intergenic
1118233183 14:63973579-63973601 GGAGTGTAGTGCTGCAATCTTGG - Intronic
1118239151 14:64038779-64038801 GGACTGTACTGCTGCCATCTGGG - Intronic
1118341408 14:64896617-64896639 GGACGGTACTGCTGCCATCTCGG - Intergenic
1118423394 14:65633078-65633100 GGACTGTACTGCTGCCATCTCGG + Intronic
1118517888 14:66546708-66546730 GGACTGTACTGCTGCCATCTCGG - Intronic
1119051983 14:71377912-71377934 GGACTGTACTGCTGCGATCTCGG - Intronic
1119241234 14:73061615-73061637 GGAGGGCAGTGCTGCGATCTTGG + Intronic
1119254748 14:73185531-73185553 GGACTGTACTGCTGCCATCTCGG - Intronic
1119303235 14:73587401-73587423 GGAGTGTAGTGATGCCATCTTGG + Intergenic
1119447890 14:74681717-74681739 GGAGTGTAGTGGTGCCATCTTGG - Intronic
1119528483 14:75342112-75342134 GGAGTGTAGTGGTGCCATCTCGG + Intergenic
1119595149 14:75925986-75926008 GGACTATACTGCCGCCATCTCGG - Intronic
1119698777 14:76735411-76735433 GGACTGTGCTGCTGCCATCTCGG - Intergenic
1119700153 14:76749687-76749709 GGACTATACTGCTGCCATCTCGG + Intergenic
1119722179 14:76898804-76898826 GGACTGTACTGCCGCCATCTTGG - Intergenic
1119835584 14:77746976-77746998 GGACTGTGCTGCCACCATCTCGG + Intronic
1120086939 14:80286057-80286079 GGACTGTACTGCTGCCATCTCGG + Intronic
1120170693 14:81245185-81245207 GGACTGTGCTGCCGCCATCTCGG - Intergenic
1120179975 14:81333251-81333273 GTACGGTACTGTTGCCTTCCCGG + Intronic
1120193900 14:81463075-81463097 GGACTGTACTGCCGCCATCTCGG - Intergenic
1120201099 14:81539106-81539128 GGACTGTAGTGGTGCCATCTTGG - Intergenic
1120310028 14:82815223-82815245 GTACTGTACTGCTGCCATCTCGG - Intergenic
1120439832 14:84522016-84522038 GGAGTGGAGTGCTGCCATCTCGG + Intergenic
1120505938 14:85353406-85353428 GGACTGTGCTGCCGCCATCTTGG - Intergenic
1120547743 14:85830567-85830589 GGACTGTACTGCTGCCATCTCGG - Intergenic
1120892720 14:89505334-89505356 GGACTGTGCTGCTGCCATCTCGG + Intronic
1121143059 14:91558283-91558305 GGACTGTACTGCTGCCATCGCGG - Intergenic
1121189608 14:92014952-92014974 GGAGGGCAGTGGTGCCATCTCGG + Intronic
1121306961 14:92912616-92912638 GGACTGTACTGCTGCCATCTCGG - Intergenic
1121531433 14:94657483-94657505 GGACTGTACTGCTGCCATCTCGG + Intergenic
1122110414 14:99496657-99496679 GGAGGGTAGTGGTGCCATCTCGG - Intronic
1122212146 14:100180348-100180370 GGACTGTACTGCTGCCATCTCGG + Intergenic
1122238054 14:100344142-100344164 GGACTGTACTGCTGCCATCTCGG + Intronic
1122465793 14:101932632-101932654 GGAGTGTAGTGGTGCCATCTCGG - Intergenic
1122509209 14:102252402-102252424 GGAGTGTAATGGTGCCATCTCGG - Intronic
1122568699 14:102678139-102678161 GGACGGTACTGCTGCCATCTCGG - Intronic
1122622031 14:103064311-103064333 GGACTGTAATGGTGCAATCTTGG - Intergenic
1122730105 14:103790193-103790215 GGAGTGTAGTGGTGCCATCTTGG - Intronic
1122957914 14:105079982-105080004 GGACTGTACTGCTGCCATCTCGG - Intergenic
1202917456 14_GL000194v1_random:190041-190063 GGACTGTACTGCTGCCATCTTGG + Intergenic
1123430254 15:20208857-20208879 GGAGTGTAGTGGTGCCATCTTGG - Intergenic
1123892113 15:24792273-24792295 GGAGGGCACTGGTGCAATCTTGG - Intergenic
1124245652 15:28069472-28069494 GGACTGTACTGCTGCCATCTCGG + Intronic
1124335234 15:28850577-28850599 GGACTGTACTGCTGCCATCTCGG - Intergenic
1124568254 15:30835645-30835667 GGAGTGTAGTGGTGCCATCTCGG - Intergenic
1124574740 15:30897182-30897204 GGAGGGCAGTGGTGCCATCTCGG + Intergenic
1125022606 15:35000094-35000116 GAACCCTACTGCTGCCATGTTGG + Intergenic
1125459823 15:39895156-39895178 GGACTGTACTGCTGCCATCTCGG - Intronic
1125566396 15:40682156-40682178 GGACTGTACTGCTGCCATCTCGG + Intergenic
1125651304 15:41320337-41320359 GGACTGTACTGCTGCCATCTCGG + Intronic
1125861396 15:43004438-43004460 GGACTGTACTGCCGCCATCTCGG + Intronic
1125862648 15:43013941-43013963 GGACTGTACTGCTGCCATCTCGG + Intronic
1125868332 15:43076034-43076056 GGACGGTACTGCTGCCATCTCGG + Intronic
1125878175 15:43168060-43168082 GGACTGTACCGCTGCCATCTCGG - Intronic
1126125872 15:45293887-45293909 GGACTGTACTGCTGCCATCTCGG - Intergenic
1126295213 15:47131809-47131831 GGACGGTACTGCTGCCATCTCGG + Intergenic
1126517358 15:49551218-49551240 GGACTGTACTGCTGCCATCTCGG - Intronic
1126571476 15:50157814-50157836 GGACTGTGCTGCTGCCATCTCGG + Intronic
1126691678 15:51293616-51293638 GGACTGTACTGCTGCCATCTCGG + Intronic
1126752075 15:51886602-51886624 GGACTGTACTGCTGCCATCTCGG - Intronic
1126799290 15:52285543-52285565 GGACTGTACTGCTGCCATCTCGG + Intronic
1126816677 15:52460582-52460604 GGACTGTACTGCCGCCATCTGGG - Intronic
1127023968 15:54782031-54782053 GGACGGTACTGCCACGATCTCGG - Intergenic
1127088922 15:55447725-55447747 GGACTGTACTGCCGTGATCTCGG - Intronic
1127153938 15:56109105-56109127 GGACTGTACTGCTGCCATCTCGG + Intronic
1127203524 15:56686187-56686209 GGAGGGCAGTGGTGCCATCTCGG + Intronic
1127435923 15:58958258-58958280 GGAGTGTAGTGGTGCCATCTCGG + Intronic
1127584098 15:60365908-60365930 GGACGGTACTGCTGCCATCTCGG + Intronic
1127781685 15:62321925-62321947 GGAGGGCAGTGGTGCCATCTCGG - Intergenic
1127783125 15:62333227-62333249 GGACTGTGCTGCTGCCATCTTGG - Intergenic
1127824501 15:62690950-62690972 GGACTGTACTGCTGCCATCTCGG - Intronic
1127874154 15:63098334-63098356 GGACTGTACTGCTGCCATCTCGG + Intergenic
1128071515 15:64799981-64800003 GGACTGTACTGCTGCCATCTCGG - Intergenic
1128399055 15:67258179-67258201 GGAGTGTACTGGTGCAATCTCGG - Intronic
1128490408 15:68136529-68136551 GGACTGTACTGCTGCCATCTCGG - Intronic
1128587330 15:68861030-68861052 GGACTGTACTGCTGCCATCTCGG - Intronic
1128597631 15:68965452-68965474 GGACTGTACTGCTGCCATCTCGG - Intronic
1129008584 15:72395914-72395936 GGACTGTGCTGCTGCCATCTCGG + Intergenic
1129054305 15:72808005-72808027 GGACTGTACTGCTGCCATCTCGG - Intergenic
1129083187 15:73060312-73060334 GGAGTGTACTGGTGCGATCTTGG + Intronic
1129313618 15:74728331-74728353 GGACTGTACTGCTGCCATCTCGG + Intergenic
1130341000 15:82999096-82999118 GGACTGTACTGCTGCCATCTCGG - Intronic
1130428526 15:83823132-83823154 GGACTGTACTGCTGCCATCTCGG - Intronic
1130522264 15:84672326-84672348 GGACTGTGCTGCTGCCATCTCGG + Intronic
1130604567 15:85304035-85304057 GGACTGCAGTGGTGCCATCTTGG - Intergenic
1130942536 15:88523499-88523521 GAACTGTACTGCCGCCATCTCGG + Intronic
1130946889 15:88554404-88554426 GGACTGTACTGCTGCCATCTCGG - Intergenic
1131001578 15:88942636-88942658 GGACTGTACTGCTGCCATCTCGG - Intergenic
1131044028 15:89297687-89297709 GGACTGTACTGCTGCCATCTCGG - Intronic
1131127008 15:89867082-89867104 GGACTGTACTACTGCCATCTCGG + Intronic
1131141060 15:89977549-89977571 GGACTATACTGCTGCCATCTCGG + Intergenic
1131479532 15:92769256-92769278 GCACTGTACTGCTGCCATCTCGG - Intronic
1131565012 15:93477985-93478007 GGAGGGGGCTTCTGCCATCTTGG + Intergenic
1131720694 15:95165472-95165494 GGAGTGTAGTGGTGCCATCTTGG + Intergenic
1131757898 15:95586034-95586056 GGAGTGCACTGGTGCCATCTTGG + Intergenic
1132050815 15:98606380-98606402 AGAGAGAACTGCTGCCATCTTGG - Intergenic
1132300922 15:100774932-100774954 GGACTGTACTGCTGCCATCTCGG - Intergenic
1132763531 16:1523166-1523188 GGACTGTGGTGGTGCCATCTTGG - Intronic
1132921980 16:2400699-2400721 GGACTGTACTGCTGCCATCTCGG - Intergenic
1132992411 16:2802807-2802829 GGACTGTACTGCTGCCATCTCGG - Intergenic
1133269747 16:4605005-4605027 GGAGTGTAGTGGTGCCATCTCGG + Intergenic
1133365198 16:5203679-5203701 GGACGGTACTGCTGCCATCTCGG - Intergenic
1133450788 16:5902462-5902484 GGAGCGTAGTGATGCCATCTTGG + Intergenic
1133680261 16:8114473-8114495 GGACTGTACTGCTGCCATCTCGG + Intergenic
1133752250 16:8733757-8733779 GGACTGTACTGCTGCCATCTCGG - Intronic
1133786989 16:8981535-8981557 GGACTGTACTGCTGCCATCTCGG + Intergenic
1134471975 16:14533342-14533364 GGACTGTACTGCTGCCATCTCGG - Intronic
1134677382 16:16100033-16100055 GGATTGCACTGGTGCCATCTTGG - Intronic
1134687492 16:16169028-16169050 GGAGGGCAGTGCTGCCGTCTCGG - Intronic
1134750295 16:16619777-16619799 GGACTGTACTGCCACCATCTCGG - Intergenic
1134854453 16:17506746-17506768 GGACTGTACTGCTGCCATCTCGG - Intergenic
1134995162 16:18733821-18733843 GGACTGTACTGCCGCCATCTCGG + Intergenic
1135307228 16:21377554-21377576 GGAGTGCACTGCTGCTATCTGGG + Intergenic
1135639856 16:24110032-24110054 GGACTGTACTGCTGCCATCTCGG - Intronic
1135683857 16:24481958-24481980 GGAGTGTAGTGGTGCCATCTCGG + Intergenic
1135694679 16:24575699-24575721 GGACTGTACTGCTGCCATCTCGG - Intergenic
1136155031 16:28376788-28376810 GGACTGTACTGCTGCCATCTTGG + Intergenic
1136160393 16:28415916-28415938 GGACTGTAGTGCTGCCATCTCGG + Intergenic
1136165021 16:28448019-28448041 GGACTGTACTGCCACCATCTCGG + Intergenic
1136197944 16:28666961-28666983 GGACTGTACTGCCACCATCTCGG - Intergenic
1136202702 16:28699398-28699420 GGACTGTAGTGCTGCCATCTCGG - Intronic
1136208061 16:28738474-28738496 GGACTGTACTGCTGCCATCTTGG - Intergenic
1136214291 16:28781138-28781160 GGACTGTACTGCCACCATCTCGG - Intergenic
1136259011 16:29060983-29061005 GGACTGTACTGCCACCATCTCGG - Intergenic
1136303974 16:29356692-29356714 GGAGTGCACTGCTGCTATCTGGG + Intergenic
1136571970 16:31103690-31103712 GGACGGTGCTGCTGCCATCTCGG + Intergenic
1136593405 16:31231664-31231686 GGACGGTACTGCTGCCATCTCGG + Intergenic
1136670947 16:31856558-31856580 GGACTGCAGTGGTGCCATCTCGG - Intergenic
1136854383 16:33642352-33642374 GGAGTGTAGTGGTGCCATCTTGG + Intergenic
1136919191 16:34246803-34246825 GGACTGTACTGCTGCCATCTCGG - Intergenic
1137240948 16:46654060-46654082 GGACTGTACTGCTGCCAACTCGG - Intergenic
1137283707 16:46999517-46999539 GGACTATACTGCTGCCATCTCGG + Intergenic
1137303739 16:47180442-47180464 GGACTGTACTGCTGCCATCTCGG + Intronic
1137430950 16:48417439-48417461 GGACTGTACTGCCGCCATCTCGG - Intronic
1137439201 16:48483782-48483804 GGACTGTACTGCCGCCATCTCGG - Intergenic
1137493327 16:48951166-48951188 GGACTGTGCTGCTGCCATCTCGG + Intergenic
1137523174 16:49211139-49211161 GGACTGTACTGCTGCCATCTTGG - Intergenic
1137918847 16:52465063-52465085 GGAGGGCAGTGGTGCCATCTCGG + Intronic
1138013877 16:53412100-53412122 GGAGGGCAATGGTGCCATCTCGG - Intergenic
1138028071 16:53538636-53538658 GCACTGTACTGCTGCCATCTCGG + Intergenic
1138037603 16:53624825-53624847 GGACTGTACTGCCGCGATCTCGG + Intronic
1138043233 16:53697421-53697443 GGACTGTGCTGCTGCCATCTCGG + Intronic
1138400733 16:56740951-56740973 GGACTGTACTGCTGCCATCTCGG - Intronic
1138467434 16:57201895-57201917 GGACTGTACTGCTGCCATCTCGG - Intronic
1138642742 16:58397743-58397765 GGACTGTACTGCTGCCATCTCGG - Intronic
1138699485 16:58846984-58847006 GGACTGTGCTGCTGCCATCTCGG - Intergenic
1138729213 16:59176286-59176308 GGAGGGTAATGGTGCGATCTCGG - Intergenic
1139394607 16:66630398-66630420 GGACTGTACTGCTGCCATCTGGG + Intronic
1139424540 16:66871210-66871232 GGAGGGCAGTGGTGCCATCTCGG - Intronic
1139556176 16:67712345-67712367 GGACGGTACTGCTGCCATCTCGG + Intronic
1139623374 16:68164327-68164349 GGACTGTACTGCTGCCATCTCGG - Intronic
1139864033 16:70050386-70050408 GGACTGTACTGCTGCGATCTTGG + Intergenic
1139885283 16:70203932-70203954 GGACTGTACTGCTGCCATCTCGG + Intergenic
1139888117 16:70225393-70225415 GGACTGTGCTGCTGCCATCTCGG - Intergenic
1140066931 16:71619360-71619382 GGAGTGTAGTGGTGCCATCTTGG - Intergenic
1140103167 16:71936254-71936276 GGAGTGTAGTGGTGCCATCTTGG + Intronic
1140173828 16:72635608-72635630 GGAGTGCAGTGCTGCCATCTCGG - Intergenic
1140993929 16:80242612-80242634 GGACTGTACTGCTGCCATCTCGG + Intergenic
1141099635 16:81187829-81187851 GAGCGCTAGTGCTGCCATCTTGG + Intergenic
1141397404 16:83717207-83717229 GGAGGGTAGTGGTGCAATCTTGG - Intronic
1142011655 16:87718429-87718451 GGACTGTACTGCCGCCATCTCGG + Intronic
1142167915 16:88603013-88603035 GGAGTGTAGTGGTGCCATCTTGG + Intronic
1142301848 16:89263275-89263297 GGAGTGTACTGGTGCAATCTTGG + Intergenic
1142332169 16:89462139-89462161 GGACTGTACTGCTGCCATCTCGG + Intronic
1203115961 16_KI270728v1_random:1490802-1490824 GGAGTGTAGTGGTGCCATCTTGG + Intergenic
1142529708 17:571602-571624 GGACTGTGCTGCTGCCATCTTGG + Intronic
1142533452 17:598031-598053 GGACTGTACTGCTGCCATCTCGG + Intronic
1142624273 17:1181791-1181813 GGACGGTGCTGCTGCCTCCTGGG - Intronic
1142627021 17:1198684-1198706 GGAGTGTAGTGATGCCATCTCGG + Intronic
1142628456 17:1207596-1207618 GGAGTGTACTGGCGCCATCTCGG - Intronic
1142629451 17:1215298-1215320 GGACTGTACTGCTGCCATCTCGG + Intronic
1142634410 17:1247831-1247853 GGACTGTACTGCTGCCGTCTGGG - Intergenic
1142657555 17:1403956-1403978 GGACTGTACTGCTGCCATCTCGG - Intergenic
1142705415 17:1690545-1690567 GGACTGTACTGCTGCCATCTCGG - Intergenic
1142818406 17:2446669-2446691 GGACGGTGCTGCTGCCATCTCGG + Intronic
1142825180 17:2506345-2506367 GAACTGTGCTGCTGCCATCTCGG + Intronic
1142913354 17:3113542-3113564 GGACTGTACTGCTGCCATCTCGG - Intergenic
1142940049 17:3372760-3372782 GGACTGTACTGCTGCCATCTCGG - Intergenic
1142949054 17:3464040-3464062 GGACTGTACTGCTGCCATCTCGG + Intronic
1142963351 17:3564943-3564965 GGACTGTACTGCTGCCATCTCGG - Intergenic
1143008680 17:3853710-3853732 GGACTGTACTGCTGCCATCTCGG + Intergenic
1143115395 17:4578962-4578984 GGACTGTGCTGCTGCCATCTCGG - Intergenic
1143225889 17:5302611-5302633 GGAGTGTAGTGGTGCCATCTTGG + Intronic
1143277356 17:5721837-5721859 GGACTGTGCTGCTGCCATCTCGG - Intergenic
1143667548 17:8373234-8373256 GGACTGTACTGCCGCCATCTCGG + Intronic
1143689499 17:8549758-8549780 GGACTGTGCTGCTGCCATCTCGG + Intronic
1144087505 17:11823877-11823899 GGACGGCAGTGGTGCAATCTCGG - Intronic
1144536217 17:16094624-16094646 GGACTGTGCCGCTGCCATCTCGG + Intronic
1144554319 17:16268497-16268519 GGACTGCAATGGTGCCATCTTGG + Intronic
1144559943 17:16312857-16312879 GGACTGTACTGCTGCCATCTCGG - Intronic
1144799143 17:17913123-17913145 GGACTGTACTGCTGCCATCTCGG - Intronic
1144866228 17:18337631-18337653 GGACTGTACTGCCGCCATCTCGG + Intronic
1145026932 17:19475417-19475439 GGACTGTGCTGCTGCCATCTCGG + Intergenic
1145047449 17:19628819-19628841 GGACTGTACTGCTGCCATCTCGG - Intergenic
1145086895 17:19950369-19950391 GGACTGTACTGCCGCCATCTCGG + Intronic
1145158261 17:20557014-20557036 GGACTGTACTGCCGCCATCTCGG + Intergenic
1145198873 17:20921759-20921781 GGAGTGTAGTGGTGCCATCTCGG - Intergenic
1145240862 17:21240528-21240550 GGACGGTCCAGCGGCCAGCTGGG + Exonic
1145417958 17:22740568-22740590 GGACTGTACTGCTGCCATCTCGG + Intergenic
1145684083 17:26637600-26637622 GGACTGTACTGCTGCCATCTCGG + Intergenic
1145717033 17:27033191-27033213 GGACTGTACTGCTGCCATCTCGG + Intergenic
1145733490 17:27211450-27211472 GGACGGTACTGCTGCCATCTCGG + Intergenic
1145831666 17:27921273-27921295 AGAGGGTACTGCAGCCATCTGGG - Intergenic
1145842695 17:28009497-28009519 GGAGTGTAGTGATGCCATCTTGG + Intergenic
1145862656 17:28223136-28223158 GGACTGTACTGCTGCCATCTCGG + Intergenic
1145895984 17:28458242-28458264 GGACTGTACTGCTGCCATCTCGG + Intronic
1145920412 17:28605191-28605213 GGACTGTGCTGCTGCCATCTCGG - Intronic
1145927763 17:28660186-28660208 GGACTGTACTGCCGTGATCTCGG - Intronic
1146049027 17:29533777-29533799 GGACTGTACTGCTGCCATCTCGG - Intronic
1146155740 17:30522875-30522897 GGACTGTACTGCTGCCATCTCGG + Exonic
1146187803 17:30736674-30736696 GGACTGTACTGCTGCCATCTCGG - Intergenic
1146216583 17:30981296-30981318 GGACGGTACTGCTGCCATCTCGG - Intronic
1146319434 17:31834987-31835009 GGAGTGTAGTGGTGCCATCTGGG - Intergenic
1146361065 17:32178240-32178262 GGACTGTACTGCCGTGATCTCGG + Intronic
1146444664 17:32923757-32923779 GGACGGTACTGCTGCCATCTCGG - Intergenic
1146731446 17:35195939-35195961 GGACTGTACTGCTGCCATCTCGG - Intergenic
1147011979 17:37457229-37457251 GGAATGTAGTGGTGCCATCTCGG + Intronic
1147172456 17:38630290-38630312 GGACTGTACTGCTGCCATCTCGG + Intergenic
1147278267 17:39337045-39337067 GGACTGTACTGCTGCCATCTCGG + Intronic
1147337630 17:39737220-39737242 GGAGTGTAGTGGTGCCATCTTGG - Intergenic
1147622188 17:41875501-41875523 GGACTGTACTGCTGCCATCTCGG + Intronic
1147708894 17:42448552-42448574 GGACTGTACTGCTGCCATCTCGG + Intergenic
1147784906 17:42972392-42972414 GGACTGTACTGCTGCCATCTCGG + Intronic
1147909091 17:43844105-43844127 GGAAGGGACTACTGGCATCTAGG + Intergenic
1147938512 17:44028124-44028146 GGAGTGTACTGGTGCGATCTTGG - Intergenic
1147974017 17:44237476-44237498 GGACTGTGCTGCTGCCATCTCGG + Intergenic
1148016166 17:44524084-44524106 GGACGGTGCTGCTGCCATCTCGG + Intergenic
1148117979 17:45188802-45188824 GGAGTGTAATGCCGCCATCTCGG - Intergenic
1148269742 17:46253685-46253707 GGACTGTACTGCCGCCATCTCGG - Intergenic
1148404106 17:47397071-47397093 GGACTGTACTGCTGCCATCTCGG + Intronic
1148406302 17:47420007-47420029 GGACTGTACTGCTGCCATCTCGG + Intronic
1148672396 17:49420389-49420411 GGACTGTACTGCCGTGATCTCGG - Intronic
1148811149 17:50292133-50292155 GGAGTGCACTGCTGCAATCTTGG - Intergenic
1148842367 17:50507421-50507443 GGAGTGTAGTGGTGCCATCTCGG - Intergenic
1149578749 17:57732684-57732706 GGAATGTAGTGGTGCCATCTCGG + Intergenic
1149625263 17:58075149-58075171 GGACTGTACTGCTGCCATCTCGG - Intergenic
1149632873 17:58141888-58141910 GGACTGTACTGCTGCCATCTCGG + Intergenic
1149771560 17:59326218-59326240 GGAGTGTAGTGGTGCCATCTTGG + Intergenic
1149793466 17:59499513-59499535 GGACGATACTGCTGCCATCTCGG + Intergenic
1150380480 17:64716082-64716104 GGACTGTACTGCTGCCATCTCGG + Intergenic
1150425223 17:65072261-65072283 GGAGGGCAGTGGTGCCATCTTGG + Intergenic
1150477094 17:65483881-65483903 GGACTGTGCTGCTGCCATCTCGG + Intergenic
1150518151 17:65836862-65836884 GGACTGTACTGCCGCCATCTCGG + Intronic
1150570715 17:66384677-66384699 GGAGTGTAGTGGTGCCATCTCGG + Intronic
1150780429 17:68116916-68116938 GGACTGTACTGCCGCCATCTTGG - Intergenic
1150894779 17:69196950-69196972 GGACTGTAGTGCCGCCATCTCGG - Intronic
1151556392 17:74848965-74848987 GGACTGCAGTGGTGCCATCTTGG - Intronic
1151999027 17:77633210-77633232 GGAGTGTAGTGGTGCCATCTTGG - Intergenic
1152019949 17:77775724-77775746 GGACGGTACTGCTGCCATCTCGG + Intergenic
1152128985 17:78465000-78465022 GGACTGTGCTGCTGCCATCTCGG + Intronic
1152192856 17:78899119-78899141 GGATGCTGATGCTGCCATCTGGG + Intronic
1152261556 17:79269957-79269979 GGACGCCACTGCTGCCCTCAGGG + Intronic
1152343078 17:79735958-79735980 GGAGGGTAATGGTGCCATCTTGG + Intronic
1152398432 17:80049356-80049378 GGAGTGCACTGGTGCCATCTTGG - Intronic
1152479068 17:80537965-80537987 GGACTGTACTGCTGCCATCTCGG - Intergenic
1152672540 17:81617718-81617740 GGACTGTACTGCTGCCATCTCGG + Intronic
1152765120 17:82132808-82132830 GGAGTGTAGTGGTGCCATCTCGG + Intronic
1152824300 17:82454370-82454392 GGACTGTACTGCCGTGATCTCGG - Intergenic
1153221886 18:2868732-2868754 GGACTGTGCTGCTGCCATCTCGG - Intronic
1153605621 18:6828287-6828309 GGACTGTACTGCTGCCATCTCGG - Intronic
1153633906 18:7097919-7097941 GGACTGCACTGCTGCCATCTCGG + Intronic
1153646964 18:7204170-7204192 GGACTGTACTGCTGCCATCTCGG - Intergenic
1154089478 18:11344105-11344127 GGAGTGTACTGCCGCCATCTCGG + Intergenic
1154154277 18:11931500-11931522 GGAGTGTAGTGGTGCCATCTTGG - Intergenic
1154155091 18:11937711-11937733 GGAGTGCACTGGTGCCATCTTGG - Intergenic
1154158011 18:11959111-11959133 GGACTGTCCTGCTGCCATCTCGG + Intergenic
1154264997 18:12873347-12873369 GGACTGTACTGCTGCCATCTCGG + Intronic
1154290105 18:13099116-13099138 GGACTGTACTGCTGCCATCTCGG - Intronic
1154398492 18:14011787-14011809 GGACTATACTGCTGCCATCTCGG - Intergenic
1154952059 18:21219928-21219950 GGAGGGCAGTGGTGCCATCTTGG + Intergenic
1154990445 18:21593526-21593548 GGACTGTACTGCTGCCATCTCGG - Intronic
1155956299 18:31959589-31959611 GGACTGTACTGCTGCCATCTTGG + Intergenic
1156066485 18:33148360-33148382 GGACTGTACTGCCACCATCTAGG - Intronic
1156326501 18:36078587-36078609 GGACTGTACTGCTGCCATCTCGG - Intergenic
1157341638 18:46784001-46784023 GGAGTGCACTGGTGCCATCTCGG + Intergenic
1157455747 18:47827540-47827562 GGACTGTACTGCCGCCATCTCGG + Exonic
1157629638 18:49081440-49081462 GGACTGTACTGCTGCCATCTCGG - Intronic
1157677604 18:49578948-49578970 GGACTGTACTGCTGCCATCTCGG - Intronic
1157705034 18:49799274-49799296 GGACTGTACTGCTGCCATCTCGG + Intronic
1157779532 18:50425259-50425281 GGACTGGACTGCAGCCATCTAGG + Intergenic
1158148394 18:54342531-54342553 GGACTGTACTGCTGCCATCTCGG + Intronic
1158459498 18:57633808-57633830 GGACTGTACTGCTGCTATCTCGG - Intergenic
1159314735 18:66757480-66757502 GGACAGTAGTGGTGCAATCTCGG + Intergenic
1159340606 18:67127602-67127624 GGACTGTACTGCTGCCATCTCGG - Intergenic
1159840590 18:73394262-73394284 GGAGTGTAGTGGTGCCATCTTGG - Intergenic
1160228555 18:77029347-77029369 GGACTGTACTGCTGCCATCTCGG - Intronic
1160465628 18:79073564-79073586 GGACTGTACTGCCGCAATCTTGG - Intronic
1160769371 19:823389-823411 GGAGGGCAATGGTGCCATCTCGG - Intergenic
1161476003 19:4485689-4485711 GGAGGGCAGTGGTGCCATCTCGG - Intronic
1161790064 19:6354882-6354904 GGACTGTACTGCTGCCATCTCGG + Intergenic
1161810875 19:6470670-6470692 GGAATGTAGTGGTGCCATCTCGG + Intronic
1161871818 19:6876255-6876277 GGAGTGTACTGGTGCCATCACGG + Intergenic
1162148415 19:8627986-8628008 GGAGTGCAGTGCTGCCATCTCGG - Intergenic
1162163722 19:8738838-8738860 GGACTGTACTGCTGCCATCTCGG + Intergenic
1162278818 19:9679400-9679422 GGACTGTACTGCTGCTATCTCGG + Intergenic
1162538339 19:11277424-11277446 GGACTGTAATGCCGCCATCTCGG - Intergenic
1162602281 19:11677812-11677834 GGACTGTACTGCCGCCATCTCGG - Intergenic
1162683092 19:12361779-12361801 GGACTGTAGTGCCGCCATCTCGG + Intronic
1162694924 19:12467197-12467219 GGACTGTACTGCTGCCATCTCGG + Intronic
1162825671 19:13250108-13250130 GGAGTGCACTGGTGCCATCTTGG + Intronic
1163142891 19:15362417-15362439 GGACGGTACTGCTGCCATCTCGG + Intronic
1163277029 19:16291248-16291270 GGAGGGTAGTGGTGCAATCTTGG + Intergenic
1163346038 19:16742961-16742983 GGAGTGTAGTGGTGCCATCTTGG + Intronic
1163413211 19:17169865-17169887 GGAGGGTAGTGGCGCCATCTTGG + Intronic
1163556163 19:17993857-17993879 GGACTGCAGTGGTGCCATCTCGG - Intronic
1163558666 19:18006555-18006577 GGACTGTGCTGCTGCCATCTCGG - Intronic
1163736597 19:18985184-18985206 GGAGTGTAGTGGTGCCATCTCGG - Intergenic
1163792248 19:19314270-19314292 GGAGTGTAGTGGTGCCATCTCGG - Intronic
1163865396 19:19769553-19769575 GGACGGTACTGCCGCCATCTCGG + Intergenic
1163896618 19:20065184-20065206 GGACTGTACTGCTGCCATCTCGG - Intergenic
1163909573 19:20176761-20176783 GGACTGTACTGCTGCCATCTCGG - Intronic
1163921624 19:20295832-20295854 GGACTGTACTGCTGCCATATCGG + Intergenic
1163945656 19:20531164-20531186 GGACTGTGCTGCTGCCATCTCGG - Intergenic
1163986248 19:20953362-20953384 GGACTGTACTGCTGCCATCTCGG - Intergenic
1164012295 19:21213376-21213398 GGACTGTACTGCCGCCATCTCGG - Intergenic
1164016941 19:21261723-21261745 GGACTGTACTGCCGTGATCTCGG - Intronic
1164034931 19:21444375-21444397 GGACTGTGCTGCCGCCATCTCGG - Intronic
1164054886 19:21614351-21614373 GGACTGTGCTGCCGCCATCTCGG + Intergenic
1164066282 19:21720408-21720430 GGACGGTACTGCTGCCATCTCGG + Intergenic
1164071680 19:21775253-21775275 GGACTGTACTGCTGCCATCTCGG + Intergenic
1164081984 19:21866793-21866815 GGACTGTACTGCTGCCATCTCGG - Intergenic
1164106269 19:22108645-22108667 GGACTGTACTGCTGCCATCTCGG - Intergenic
1164126394 19:22322332-22322354 GGACTGTACTGCCGCCATCTCGG - Intergenic
1164161585 19:22628694-22628716 GGTGGGTGCTGCTGCCAGCTGGG + Intergenic
1164168271 19:22701225-22701247 GGACTGTACTGCCGCCATCTCGG - Intergenic
1164186351 19:22872335-22872357 GGACTGTGCTGCTGCCATCTCGG - Intergenic
1164217421 19:23161742-23161764 GGACTGTACTGCCGCCATCTTGG - Intergenic
1164218509 19:23172626-23172648 GGACTGTACTGCTGCCATCTCGG + Intergenic
1164231348 19:23290744-23290766 GGACTGTACTGCCGCCATCTCGG - Intergenic
1164260878 19:23567924-23567946 GGACTGTACTGCTGTGGTCTCGG + Intronic
1164301005 19:23963463-23963485 GGACAGTACTGCTGCCATCTCGG + Intergenic
1164391288 19:27823272-27823294 TGACGGTCCTACAGCCATCTTGG - Intergenic
1164630522 19:29758917-29758939 GGAGTGTAGTGGTGCCATCTCGG - Intergenic
1164659465 19:29949846-29949868 GGACTGTACTGCCGCCATCTCGG - Intronic
1164760739 19:30726592-30726614 AGAGGGTACTGCTGCCCTCTGGG - Intergenic
1165193246 19:34080518-34080540 GGACTGTACTGCTGCCATCTCGG - Intergenic
1165193669 19:34084563-34084585 GGAGTGTAGTGGTGCCATCTAGG + Intergenic
1165199223 19:34131931-34131953 GGACTGTGCTGCTGCCATCTCGG + Intergenic
1165206140 19:34188233-34188255 GGAGGGCAGTGGTGCCATCTCGG - Intronic
1165295580 19:34922948-34922970 GGACTGTACTGCTGCCATCTCGG - Intergenic
1165482052 19:36069934-36069956 GGACTGTACTGCTGCCCTCTCGG - Intronic
1165540672 19:36490526-36490548 GGACTGTACTGCTGCCCTCTCGG + Intergenic
1165727872 19:38124938-38124960 GGACTGTACTGCTGCCATCTCGG - Intronic
1165842806 19:38798748-38798770 GGACTGTGCTGCTGCCATCTCGG - Intergenic
1165852329 19:38856619-38856641 GGACTATACTGCTGCCATCTCGG - Intergenic
1165889088 19:39099940-39099962 GGACTGCAGTGGTGCCATCTTGG - Intronic
1165890279 19:39107833-39107855 GGAGGGCAGTGGTGCCATCTTGG - Intronic
1165964793 19:39567366-39567388 GGACTGTGATTCTGCCATCTTGG + Intergenic
1165967781 19:39598241-39598263 GGACTGTCATTCTGCCATCTTGG - Intergenic
1165977151 19:39686243-39686265 GGACTGTCATTCTGCCATCTTGG - Intergenic
1166028793 19:40109642-40109664 GGACTGTACTGCTGCCATCTCGG - Intergenic
1166029605 19:40117249-40117271 GGACTGTACTGCTGCCATCTCGG + Intergenic
1166115209 19:40649101-40649123 GGACTGTACTGCTGCCATCTCGG - Intergenic
1166163258 19:40967377-40967399 GGACGGTACTGCTGCCATCTCGG - Intergenic
1166418188 19:42611207-42611229 GGACTGTACTGCTGCCATCTCGG - Intronic
1166421625 19:42640474-42640496 GGACTGTACTGCTGCCATCTCGG - Intronic
1166479121 19:43154573-43154595 GGAGTGCAGTGCTGCCATCTTGG - Intronic
1166640066 19:44488324-44488346 GGACTGTACTGCTGCCATCTCGG + Intronic
1166673897 19:44727609-44727631 GGAGTGTAGTGATGCCATCTGGG - Intergenic
1166798503 19:45442267-45442289 GGAGTGTAGTGGTGCCATCTCGG - Intronic
1166832588 19:45647612-45647634 GGACTGTACTGCTGCCATCTCGG + Intergenic
1166834675 19:45660022-45660044 GGAGTGTAGTGGTGCCATCTCGG - Intergenic
1166931893 19:46306026-46306048 GGAGTGTACTGGTGCAATCTTGG - Intronic
1166980137 19:46627255-46627277 GGAGTGTAGTGCTGCAATCTCGG + Intergenic
1167006633 19:46780402-46780424 GGAGTGTACTGTTGCAATCTTGG + Intronic
1167035483 19:46992883-46992905 GGACGGCCCTGCTGCTCTCTGGG + Intronic
1167125250 19:47544795-47544817 GGAGGAGACTGCTGCCACCTGGG + Exonic
1167283019 19:48581953-48581975 GGAGTGTAGTGGTGCCATCTTGG + Intronic
1167415455 19:49368597-49368619 GGAGTGTAGTGGTGCCATCTTGG + Intronic
1167439195 19:49498697-49498719 GGAGAGCAGTGCTGCCATCTCGG - Intronic
1167540733 19:50085815-50085837 GGACTGTACTGCTGCCATCTCGG + Intergenic
1167588863 19:50391633-50391655 GGACTGTGCTGCCGCCATCTCGG - Intronic
1167712289 19:51119854-51119876 GGCTGGTGCTGCTGCCATCCAGG + Intergenic
1167897662 19:52594254-52594276 GGACGGTACTGCTGCCATCTTGG - Intronic
1167913415 19:52721615-52721637 GGACAGTACTGCCGTGATCTGGG - Intronic
1167924351 19:52810949-52810971 GGACGGTACTGCTGCCATCTCGG + Intronic
1167937291 19:52919227-52919249 GGACTATACTGCTGCCATCTCGG + Intergenic
1167956788 19:53072150-53072172 GGAGTGTAGTGCTGCGATCTTGG + Intronic
1167971214 19:53188518-53188540 GGACGGTACTGCTGCCATCTCGG - Intronic
1167980412 19:53270606-53270628 GGACTGTACTGCTGCCATCTCGG - Intergenic
1168036611 19:53724728-53724750 GGAGTGTAGTGGTGCCATCTCGG + Intergenic
1168081400 19:54012887-54012909 GGAGTGTAGTGCTGCAATCTTGG + Intergenic
1168415521 19:56165429-56165451 GGAGTGTAGTGGTGCCATCTTGG - Intergenic
1168572468 19:57482638-57482660 GGACTGTACTGCTGCCATCTCGG + Intergenic
1168658143 19:58146610-58146632 GGACGGTACTGCTGCCATCTCGG + Intronic
1168696392 19:58406283-58406305 GGACGGTACTGCTGCCATCTCGG - Intronic
924970806 2:126264-126286 GGACTGTACTGCTGCGATCTCGG + Intergenic
925400648 2:3569929-3569951 GGACTGTACTGCTGCCATCTCGG - Intergenic
925403789 2:3592184-3592206 GGACGGTGCTGCTGCCATCTCGG - Intergenic
925407739 2:3616695-3616717 GGACTGTACTGCTGCCATCTCGG - Intronic
925702385 2:6651654-6651676 GGAGTGCAATGCTGCCATCTCGG + Intergenic
926215701 2:10903793-10903815 GTACTGTACTGCTGCCATCTCGG - Intergenic
926250551 2:11153389-11153411 GGAGGGAACTGCTCCCACCTGGG - Intergenic
926252923 2:11165952-11165974 GGACTGGACTGCCGCCATCTCGG - Intronic
926322819 2:11760617-11760639 GGACTGCACTGCCGCCATCTCGG - Intronic
926673857 2:15602762-15602784 GGAGGGCAGTGGTGCCATCTCGG + Intronic
926675212 2:15612943-15612965 GGACTGTACTGCTGCCATCTCGG - Intronic
926683500 2:15680972-15680994 GGACTGTACTGCTACCATCTCGG - Intergenic
927747074 2:25633223-25633245 GGACTGTACTGCTGCCATCTCGG + Intronic
927777202 2:25911543-25911565 GGACTGTACTGCTGCCATCTCGG - Intergenic
927833489 2:26371797-26371819 GGACTATACTGCTGCCATCTCGG - Intronic
927978570 2:27358825-27358847 GGACTGTACTGCTGCCATCTCGG + Intergenic
928003391 2:27541331-27541353 GGACGGTACTGCTGCCATCTCGG - Intronic
928005602 2:27558837-27558859 GGACGGTACTGCTGCCATCTCGG - Intronic
928185050 2:29102674-29102696 GGACTGCAGTGGTGCCATCTCGG + Intronic
928314974 2:30237957-30237979 GGAGGGAGCTGCTGCCATCAGGG - Intronic
928542356 2:32295003-32295025 GGACTGTACTGCTGCCATCTCGG - Intronic
928558271 2:32448587-32448609 GGACTGTACTGCTGCGATCTCGG - Intronic
928573283 2:32629170-32629192 GGAGTGCACTGGTGCCATCTCGG + Intronic
928585673 2:32755519-32755541 GGACTGTACTGCTGCCATCTCGG - Intronic
928888661 2:36179374-36179396 GGACTGTACTGCTGCCATCTTGG + Intergenic
928924718 2:36565851-36565873 GGGTGGTACTGCTGGCATCCTGG - Intronic
929062190 2:37933708-37933730 GGATGGTACTGCTGCCATCTCGG - Intronic
929110510 2:38402755-38402777 GGACTGTACTGCTGCCATCTCGG + Intergenic
929152072 2:38756641-38756663 GGACTGTACTGCTGCCATCTCGG - Intronic
929181830 2:39048966-39048988 GGACGGCAGTGGTGCGATCTCGG + Intronic
929238481 2:39629126-39629148 GGACTATACTGCTGCCATCTCGG - Intergenic
929415834 2:41746148-41746170 GGACTGTACTGCTGCCATCTCGG + Intergenic
929445077 2:41995107-41995129 GGACTATACTGCTGCCATCTCGG + Intergenic
929448046 2:42015543-42015565 GGACTATACTGCTGCCATCTCGG - Intergenic
929516429 2:42607005-42607027 GGACTGTACTGCTGCCATCTCGG - Intronic
929577925 2:43063944-43063966 GGACTGTACTGCTGCCATCTCGG - Intergenic
929650952 2:43678646-43678668 GGACTGTACTGCTGCCATCTCGG - Intronic
929690461 2:44068270-44068292 GGACTGTACTGCTGCCATCTCGG - Intergenic
929739368 2:44587535-44587557 GGACGGTACTGCTGCCATCTCGG + Intronic
930079535 2:47434462-47434484 GGACTGTACTGCTGCCATCTCGG - Intronic
930208988 2:48615409-48615431 GGACTGTACTGCTGCCATCTCGG - Intronic
930396537 2:50829165-50829187 GGACTGTACTGCTGCCATCTCGG - Intronic
930503938 2:52258040-52258062 GTATGGTACTGCTGCATTCTTGG + Intergenic
930703799 2:54485250-54485272 GGACTGTACTGCTCCCATCTCGG + Intronic
930834116 2:55774667-55774689 GGACTGTACTGCTGCCATCTCGG - Intergenic
930877747 2:56238364-56238386 GGAGGGCAGTGCTGCAATCTTGG - Intronic
931448191 2:62344999-62345021 GGAGTGTAGTGGTGCCATCTTGG + Intergenic
931458272 2:62428949-62428971 GGAGTGTAGTGGTGCCATCTCGG - Intergenic
931576247 2:63721799-63721821 GGACTGTACTGCTGCCATCTCGG + Intronic
931584093 2:63808401-63808423 GGACTGTACTGCTGCCATCTCGG + Intronic
931604898 2:64042398-64042420 GGACTGTACTGCTGCCATCTCGG - Intergenic
931656471 2:64513145-64513167 GGACTGTACTGCTGCCATCTCGG - Intergenic
931751920 2:65338357-65338379 GGACTGTACTGCTGCCATCTCGG + Intronic
931783876 2:65601778-65601800 GGACTGTACTGCTGCCATCTCGG - Intergenic
932179530 2:69633273-69633295 GGAAGGGACTGCTGCTTTCTGGG - Intronic
932233000 2:70097873-70097895 GGAGTGTAGTGGTGCCATCTCGG + Intergenic
932367105 2:71160513-71160535 GGACTGTACTGCTGCCATCTCGG + Intergenic
932518176 2:72375951-72375973 GGATGGTGCTGCTTCCATCTTGG - Intronic
932778457 2:74543848-74543870 GGAGTGTACTGGTGCAATCTTGG - Intronic
932807693 2:74796967-74796989 GGACTGTACTGCTGCCATCTCGG - Intergenic
932903326 2:75724653-75724675 GGACTGTACTGCTGCCATCTCGG + Intergenic
933734813 2:85487123-85487145 GGACTGTACTGCTGCCATCTCGG + Intergenic
934128215 2:88919978-88920000 GGACTGTACTGCCGCCATCTCGG + Intergenic
934548929 2:95242909-95242931 GGACTGTACCCCTGCCATCTCGG + Intronic
934685392 2:96317497-96317519 GGAGTGTAGTGGTGCCATCTCGG - Intergenic
934703289 2:96460861-96460883 GGACTGTACTGCTGCCATCTCGG + Intergenic
934885687 2:98022182-98022204 GGAGTGTAGTGGTGCCATCTCGG - Intergenic
934998688 2:98989627-98989649 GGACTGTACTGCTGCCATCCCGG - Intergenic
935630983 2:105211852-105211874 GGACGGTACTGCTGCCATCTCGG - Intergenic
935636060 2:105250713-105250735 GGACTGTACTGCTGCCATCTCGG + Intergenic
936158358 2:110064578-110064600 GGACTGTGCTGCCGCCATCTCGG - Intergenic
936186303 2:110306748-110306770 GGACTGTGCTGCCGCCATCTCGG + Intergenic
936345470 2:111672136-111672158 GGACTGTGCTGCCGCCATCTCGG + Intergenic
936457406 2:112685951-112685973 GGAGTGTAATGGTGCCATCTTGG + Intergenic
937168918 2:119845178-119845200 GGACTGTACTGCTGCCATCTCGG - Intronic
937391800 2:121495270-121495292 GGAGGGCAGTGGTGCCATCTCGG - Intronic
937437441 2:121892136-121892158 GGACTGTACTGCTGCCATCTCGG + Intergenic
937492632 2:122386069-122386091 GGAATGCAGTGCTGCCATCTCGG + Intergenic
937735006 2:125277719-125277741 CGACTGTACTGCCACCATCTCGG - Intergenic
937745489 2:125408119-125408141 GGAGTGTAGTGGTGCCATCTTGG + Intergenic
937947332 2:127352758-127352780 GGACTGTACTGCTGCCATCTCGG + Intronic
938006336 2:127789627-127789649 GGACTGTACTGCTGCCATCTCGG - Intronic
938056247 2:128217031-128217053 GGAGTGTAGTGGTGCCATCTTGG - Intergenic
938248093 2:129794451-129794473 GGAATGTGCTGCTGCCTTCTGGG + Intergenic
938253281 2:129833080-129833102 GGACTGTACTGCCGCGATCTCGG + Intergenic
938450180 2:131411432-131411454 GGAGTGTAGTGGTGCCATCTCGG - Intergenic
938533639 2:132220423-132220445 GGACTGTACTGCTGCGATCTCGG + Intronic
938720489 2:134063472-134063494 GGACTGTACTGCTGCCATCTCGG + Intergenic
938822110 2:134969288-134969310 GGACTGTACTGCTGCCATCTCGG - Intronic
938829274 2:135034735-135034757 GGACTGTACTGCTGCCATCTCGG - Intronic
938836074 2:135105291-135105313 GGACTGTACTGCCGCCATCTCGG + Intronic
938887062 2:135660793-135660815 GGAGTGTAGTGCTGCCATCTTGG - Intronic
938946637 2:136218118-136218140 GGAAGGGACTGATGCCCTCTTGG - Intergenic
939477132 2:142701977-142701999 GGACTGTACTGCTGCCATCTCGG + Intergenic
940328823 2:152453149-152453171 GGAGTGTACTGGTGCGATCTTGG - Intronic
940635430 2:156292932-156292954 GGACTGTGCTGCTGCCATCTCGG + Intergenic
940643103 2:156367620-156367642 GGACGGTACTGCTGCCATCTCGG + Intergenic
940652566 2:156452479-156452501 GGACTGTACTGCTGCCATCTCGG - Intronic
940817439 2:158311407-158311429 GGACTGTACTGCCGCGATCTCGG - Intronic
941024151 2:160439991-160440013 GGACGGTACTGCTGCCATCTCGG - Intronic
941024957 2:160448354-160448376 GGACTGTACTGCCGCCATCTCGG + Intronic
941197428 2:162469766-162469788 GGACTGTGCTGCCGCCATCTCGG + Intronic
941482894 2:166039973-166039995 GGAGTGTAGTGGTGCCATCTTGG + Intronic
941768571 2:169326275-169326297 GGACTGTACTGCTGCCATCTCGG + Intronic
941793484 2:169576054-169576076 GGACTGTGCTGCTGCCATCTCGG - Intergenic
941814973 2:169787297-169787319 GGACTGTACTGCTGCCATCTCGG - Intergenic
941822513 2:169856768-169856790 GGACTGTACTGCCGCCATCTTGG - Intronic
941847608 2:170149097-170149119 GGACTGTACTGCTGCCATCTCGG + Intergenic
942012054 2:171774129-171774151 GGACTGTACTGCTGCCATCTTGG + Intergenic
942021178 2:171867558-171867580 GGACTGTACTGCTGCCATCTCGG - Intronic
942024529 2:171899298-171899320 GGACTGTACTGCTGCCATCTCGG + Intronic
942096017 2:172537252-172537274 GGACTGTACTGCTGCCATCTCGG + Intergenic
942629971 2:177944890-177944912 GGACTGTACTGCTGCCATCTTGG + Intronic
942659469 2:178248985-178249007 GGAGGGCAGTGGTGCCATCTCGG + Intronic
942792287 2:179774409-179774431 GGAGTGTAGTGGTGCCATCTTGG + Intronic
943005628 2:182385919-182385941 GGACTGTACTGCTGCCATCTCGG + Intronic
943100186 2:183478609-183478631 GGACTGTGCTGCCGCCATCTCGG + Intergenic
943297345 2:186154935-186154957 GGACTGTACTGCTGCCATCTGGG - Intergenic
943323288 2:186472308-186472330 GGACTATACTGCTGCCACCTCGG + Intergenic
943577905 2:189653011-189653033 GGACTGTAGTGCCGCCATCTCGG + Intergenic
943648481 2:190431641-190431663 GGACTGTACTGCTGCCATCTCGG - Intronic
943773222 2:191741276-191741298 GGACTGTACTGCTGCCATCTTGG + Intergenic
944060544 2:195567253-195567275 GGACTGTACTGCTGCCATCTCGG + Intergenic
944255174 2:197618145-197618167 GGACGGTACTGCTGCCATCTCGG + Intronic
944263305 2:197697348-197697370 GGACTGTACTGCTGCCATCTCGG - Intronic
944283719 2:197924083-197924105 GGACTGTACTGCTGCCATCTCGG - Intronic
944533205 2:200684668-200684690 GGACGGTACTGCTGCCATCTCGG - Intergenic
944570698 2:201042016-201042038 GGACTGTACTGCCGCCATCTCGG + Intronic
944585274 2:201166899-201166921 GGACTGTACTGCTGCCATCTCGG - Exonic
944599032 2:201284613-201284635 GGACGGTACTGCTGCCATCTCGG - Intronic
944720400 2:202417767-202417789 GGAGTGCAGTGCTGCCATCTCGG + Intronic
944722793 2:202440733-202440755 GGACTGTACTGCCACCATCTCGG - Intronic
944751736 2:202716018-202716040 GGACTGTACTGCTGCCATCTCGG - Intronic
944815737 2:203373399-203373421 GGACTGTACTGCTGCCATCTTGG - Intronic
945090528 2:206172535-206172557 GGACTGTACTGCTGCCATCTCGG - Intergenic
945110812 2:206357691-206357713 GAACTGTCCTGCTGCCATCTCGG - Intergenic
945232791 2:207609857-207609879 GGACGGTACTGCTGCCATCTCGG + Exonic
945316811 2:208378309-208378331 GGACTGTACTGCTGCCATCGCGG - Intronic
945530661 2:210950200-210950222 GGACTGTACTGCTGCCATCTCGG + Intergenic
945835974 2:214836291-214836313 GGACGGTACTGCTGCCATCTCGG - Intergenic
945864987 2:215164209-215164231 GGACTGTACTGCCGCCATCTCGG - Intergenic
945970599 2:216227492-216227514 GGACGGTACTGCTGCCATCTCGG - Intergenic
946304033 2:218845970-218845992 GGACTGTACTGCTGCCATCTCGG + Intergenic
946317981 2:218930858-218930880 GGACGGTACTGCTGCCATCTCGG + Intergenic
946751625 2:222897858-222897880 GGACTGTACTGCTGCGATCTCGG - Intronic
947254068 2:228142419-228142441 GGAGTGCACTGGTGCCATCTCGG - Intronic
947402190 2:229742238-229742260 GGACTGTACTGCTGCCATCTCGG + Intergenic
947797647 2:232905161-232905183 GGACTGTCCTGCTGCCATCTCGG + Intronic
947901554 2:233725123-233725145 GGACTGTACTGCTGCCATCTCGG - Intronic
948000297 2:234562225-234562247 GGACTGTACTGCTGCGATCTCGG + Intergenic
948651810 2:239450314-239450336 GGACTGTACTGCTGCCATCTCGG - Intergenic
948967311 2:241392890-241392912 GGAGTGTAGTGGTGCCATCTCGG - Intronic
1168955265 20:1830057-1830079 GGAGGCTACTGCAGCCATCCAGG + Intergenic
1169085506 20:2823125-2823147 GGACGGTACTGCTGCCATCTCGG + Intergenic
1169109011 20:3020010-3020032 GGACGGTACTGCTGCCATCTCGG - Intronic
1169246734 20:4031908-4031930 GGACGGTACTGCTGCCATCTCGG + Intergenic
1169370671 20:5026955-5026977 GGACTGTACTGCTGCCATCTCGG + Intergenic
1169449729 20:5701411-5701433 GGACTGTACTGCTGCCATCTCGG + Intergenic
1169718127 20:8643854-8643876 GGACTGTACTGCCGCCATCTCGG + Intronic
1169992057 20:11514126-11514148 GGACTGTACTGCTGCCATCTCGG - Intergenic
1170460694 20:16574138-16574160 GGAGTGTAATGCTGCGATCTCGG + Intergenic
1170592061 20:17778636-17778658 GGACTGTACTGCCGCCATCTCGG + Intergenic
1170645555 20:18193965-18193987 GGACTGTACTGCTGCCATCTCGG + Intergenic
1170664686 20:18376230-18376252 GGACTGTACTGCCGCCATCTCGG - Intergenic
1170781155 20:19426792-19426814 GGAGGCTACTGCGGCCATCCAGG + Intronic
1170811780 20:19679439-19679461 GGACTGTACTGCTGCCATCTCGG - Intronic
1170929949 20:20760284-20760306 GGAGTGTACTGGTGCAATCTCGG - Intergenic
1171366291 20:24627012-24627034 GGACTGTGCTGCTGCCATCTCGG - Intronic
1171463518 20:25312238-25312260 GGACTGTACTGCCGCCATCTCGG + Intronic
1171496668 20:25561096-25561118 GGACTGTGCTGCTGCCATCTCGG + Intronic
1171848636 20:30292588-30292610 GGACTATACTGCTGCCATCTCGG - Intergenic
1171861085 20:30404277-30404299 GGACTGTACTGCTGCCATCTCGG + Intergenic
1171900043 20:30847874-30847896 GGACTGTACTGCTGCCTTCTCGG - Intergenic
1171951473 20:31426359-31426381 GGACTGTACTGCTGCCATCTCGG + Intergenic
1171957656 20:31472339-31472361 GGACTGTACTGCTGCCATCTCGG - Intronic
1172051783 20:32123105-32123127 GGACTATACTGCTGCCATCTCGG - Intronic
1172058892 20:32175402-32175424 GGACTGTACTGCTGCCATCTCGG + Intergenic
1172141014 20:32723204-32723226 GGACTGTACTGCTGCCATCTCGG + Intronic
1172199459 20:33115022-33115044 GGACTGTACTGCTGCCATCTCGG + Intergenic
1172209372 20:33186131-33186153 GGACTGTGCTGCTGCCATCTCGG - Intergenic
1172258266 20:33537423-33537445 GGACTGTACTGCTGCCATCTCGG - Intronic
1172279145 20:33698548-33698570 GGACTGTACTGCTGCCATCTAGG + Intergenic
1172279791 20:33700836-33700858 GGACTGTGCTGCCGCCGTCTCGG + Intergenic
1172337746 20:34131904-34131926 GGACTGTACTGCTGCCATCTCGG + Intergenic
1172348389 20:34222698-34222720 GGACTGTACTGCTGCCATCTCGG + Intronic
1172354029 20:34266620-34266642 GGAGTGTAGTGGTGCCATCTCGG - Intronic
1172379404 20:34475591-34475613 GGACTGTACTGCTGCCATCTCGG - Intronic
1172401794 20:34658052-34658074 GGACTGTACTGCTGCCATCTCGG + Intronic
1172465388 20:35152933-35152955 GGACTGTACTGCTGCCATCTCGG + Intergenic
1172575203 20:36002333-36002355 GGACTGTACTGCTGCCATCTCGG - Intronic
1172717908 20:36977591-36977613 GGACTGTGCTGCTGCCATCTCGG - Intergenic
1172720819 20:36999551-36999573 GGACTGTACTGCTGCCATCTCGG + Intronic
1172722629 20:37011935-37011957 GGACTGTACTGCTGCCATCTCGG + Intronic
1172728728 20:37068908-37068930 GGACTGTACTGCTGCCATCTCGG + Intronic
1172735666 20:37125279-37125301 GGACTGTACTGCTGCCATCTCGG + Intronic
1172738864 20:37150347-37150369 GGACTGTACTGCCGCGATCTCGG + Intronic
1172907082 20:38378228-38378250 GGACTGTACTGCTGCCATCTCGG + Intergenic
1172918729 20:38462477-38462499 GGACTGTACTGCTGCCATCTCGG - Intergenic
1172963265 20:38813845-38813867 GGAGGGCAGTGGTGCCATCTCGG + Intronic
1173273325 20:41556188-41556210 GGACTGTACTGCTGCCATCTCGG - Intronic
1173473150 20:43338965-43338987 GGACTGTACTGCCGCGATCTCGG - Intergenic
1173508596 20:43608083-43608105 GGACTATACTGCTGCCATCTCGG - Intronic
1173769748 20:45646714-45646736 GGACTGTACTGCTGCCATCTCGG - Intergenic
1173786372 20:45795746-45795768 GGAGTGTAGTGGTGCCATCTCGG - Intronic
1174020805 20:47526697-47526719 GGACGGTACTGCTGCCATCTCGG - Intronic
1174148656 20:48470141-48470163 GGAGTGTAGTGGTGCCATCTCGG - Intergenic
1174344704 20:49921509-49921531 GGACGGTACTGCTGCCATCTCGG + Intergenic
1174835683 20:53853875-53853897 GGACTGTACTGCTGCCATCTCGG + Intergenic
1175336164 20:58197741-58197763 GGAATGTAGTGGTGCCATCTCGG - Intergenic
1175776070 20:61654361-61654383 GGACTGTACTGCTGCCATCTCGG - Intronic
1176180991 20:63749385-63749407 GGAGTGTAGTGTTGCCATCTCGG + Intronic
1176348585 21:5771737-5771759 GGATGGTACTGCTGCCATCTCGG - Intergenic
1176355399 21:5892321-5892343 GGATGGTACTGCTGCCATCTCGG - Intergenic
1176496242 21:7552718-7552740 GGATGGTACTGCTGCCATCTCGG + Intergenic
1176542906 21:8169807-8169829 GGATGGTACTGCTGCCATCTCGG - Intergenic
1176561857 21:8352852-8352874 GGATGGTACTGCTGCCATCTCGG - Intergenic
1176656834 21:9594460-9594482 GGACTGTACTGCTGCCATCTCGG - Intergenic
1177134353 21:17293019-17293041 GGACTGTACTGCTGCCATCTCGG - Intergenic
1177153255 21:17476063-17476085 GGAGGGCAATGGTGCCATCTCGG - Intergenic
1177788447 21:25696324-25696346 GGACTGTACTGCTGCCATCTCGG - Intronic
1178034234 21:28563269-28563291 GGACTGTACTGCTGCCATCTCGG + Intergenic
1178075360 21:29010727-29010749 GGACGGTACTGCTGCCATCTCGG + Intronic
1178468027 21:32866530-32866552 GGAGGGCAGTGGTGCCATCTTGG + Intergenic
1178873269 21:36393148-36393170 GGACGGTACTGCCGCCATCTCGG - Intronic
1179195055 21:39156688-39156710 GGACTGTACTGCTGCCATCTCGG + Intergenic
1179636353 21:42713183-42713205 GGAGTGCAGTGCTGCCATCTCGG + Intronic
1179668124 21:42926429-42926451 GGACTGCAGTGGTGCCATCTTGG + Intergenic
1179803192 21:43821646-43821668 GGACTGTACTGCCGCCATCTCGG + Intergenic
1179969009 21:44824141-44824163 GGACTGTACTGCTGCCATCTCGG + Intergenic
1180034792 21:45240512-45240534 GGAGTGTAGTGGTGCCATCTTGG - Intergenic
1180039331 21:45268053-45268075 GGACTGTGCTGCTGCCATCTCGG + Intronic
1180124936 21:45784520-45784542 GGACTGTACTGCTGCCATCTCGG + Intronic
1180214452 21:46315614-46315636 GGATGGTACTGCACCCATGTCGG + Intronic
1180478677 22:15733510-15733532 GTACGGTACTGCAGGCTTCTTGG + Intergenic
1180671959 22:17560689-17560711 GGACTGTACTGCTGCCATCTCGG + Intergenic
1180673052 22:17568314-17568336 GGAGGGCAGTGGTGCCATCTCGG - Intronic
1180739429 22:18042294-18042316 GGACTGTACTGCTGCCATCTCGG - Intergenic
1180861133 22:19083778-19083800 GGACTGTACTGCTGCCATCTCGG + Intronic
1181274093 22:21677633-21677655 GGACTGTACTGCTGCCATCTCGG - Intronic
1181301688 22:21884717-21884739 GGACTGTACTGCTGCCATCTCGG - Intergenic
1181562404 22:23713544-23713566 GGAGGGCACTGGTGCAATCTTGG - Intergenic
1181585954 22:23853874-23853896 GGACGGTACTGCTGCCATCTCGG + Intergenic
1181598738 22:23936500-23936522 GGACTATACTGCTGCCATCTCGG + Intergenic
1181617706 22:24065940-24065962 GGACTGTACTGCTGCCATCTCGG - Intronic
1181658174 22:24318457-24318479 GGACTGTACTGCTGCCATCTCGG - Intronic
1181792468 22:25278558-25278580 GGACTGTACTGCTGCCATCTCGG - Intergenic
1182166167 22:28175680-28175702 GGAGGGCAGTGGTGCCATCTCGG - Intronic
1182330982 22:29551845-29551867 GGACTGTACTGCGGCCATCTCGG + Intronic
1182343788 22:29644857-29644879 GGACTATACTGCTGCCATCTCGG - Intronic
1182377551 22:29858903-29858925 GGACTGTGCTGCTGCCATCTCGG - Intergenic
1182399679 22:30066157-30066179 GGACTGTACTGCTGCCACCTCGG + Intergenic
1182538730 22:31026349-31026371 GGACGGTACTGCTGCCATCTCGG + Intergenic
1182564164 22:31184851-31184873 GGACAGTACTGCCGCCATCTTGG - Intronic
1182617001 22:31593921-31593943 GGACTGTACTGCTGCCATCTCGG - Intronic
1182953278 22:34397296-34397318 GGAAGGCAGTGGTGCCATCTCGG + Intergenic
1182976461 22:34626913-34626935 GGACTGTACTGCTGCCATCTCGG - Intergenic
1182982591 22:34685211-34685233 GGACTGTACTGCTGCCATCTCGG - Intergenic
1183203330 22:36401360-36401382 GGAGGGCAGTGGTGCCATCTTGG + Intergenic
1183207172 22:36427375-36427397 GGAGTGTAATGGTGCCATCTCGG - Intergenic
1183236115 22:36618867-36618889 GGAGTGTAGTGGTGCCATCTCGG - Intronic
1183434600 22:37786286-37786308 GGACGGTACTGCTGCCATCTCGG + Intergenic
1183483959 22:38079470-38079492 GGAATGTAGTGGTGCCATCTTGG + Intronic
1183537340 22:38410633-38410655 GGACTGTACTGCCGCCATCTCGG - Intergenic
1183595056 22:38806365-38806387 GGACTGTACTGCTGCCATCTCGG + Intergenic
1183871882 22:40746331-40746353 GGACGGTACTGCTGCCATCTCGG - Intergenic
1183894800 22:40959758-40959780 GGAGGGCACTGGTGCAATCTTGG - Intronic
1183923501 22:41188131-41188153 GGAGTGCACTGCTGCGATCTCGG - Intergenic
1183940788 22:41294111-41294133 GGACGGTACTGCTGCCATCTCGG + Intergenic
1183995894 22:41632064-41632086 GGACTGTACTGCTGCCATCTCGG - Intronic
1184145342 22:42607171-42607193 GGACTGTACTGCCGCCATCTCGG + Intronic
1184169600 22:42751183-42751205 GGACTATACTGCTGCCATCTCGG - Intergenic
1184201205 22:42971145-42971167 GGACTGTACTGCCGCCATCTCGG + Intronic
1184202462 22:42980546-42980568 GGACGGTACTGCTGCCATCTCGG + Intronic
1203247773 22_KI270733v1_random:86050-86072 GGATGGTACTGCTGCCATCTCGG - Intergenic
949273729 3:2253690-2253712 GGAGGGCAGTGGTGCCATCTCGG + Intronic
949330574 3:2917237-2917259 GGACTGTGCTGCTGCCATCTCGG - Intronic
949337003 3:2985963-2985985 GGAGTGTAGTGGTGCCATCTCGG + Intronic
949551304 3:5114591-5114613 GGACTGTGCTGCTGCCATCTCGG - Intergenic
949565788 3:5243416-5243438 GGACTGTACTGCTGCCATCTCGG - Intergenic
949570146 3:5284660-5284682 GGACTGTGCTGCTGCCATCTCGG - Intergenic
949853176 3:8439111-8439133 GGACTGTACTGCTGCCATCTCGG + Intergenic
949988604 3:9559456-9559478 GGACTGTACTGCTGCCATCTCGG + Intergenic
949989769 3:9569540-9569562 GGACTGTACTGGGGCCATCTCGG + Intergenic
949992510 3:9591357-9591379 GGACTGTACTGCTGCCATCTCGG + Intergenic
950044407 3:9940604-9940626 GGACTGTACTGCTGCCATCTCGG - Intronic
950060670 3:10069521-10069543 GGACTGTACTGCTGCCATCTCGG + Intronic
950412874 3:12850458-12850480 GGACTGTACTGCTGCCATCTCGG - Intronic
950742241 3:15061275-15061297 GGACTGTACTGCTGCCATCTCGG + Intronic
950755064 3:15164077-15164099 GGACTGTACTGCTGCCATCTCGG - Intergenic
950949318 3:16981072-16981094 GGACGGTACTGCTGCCATCTCGG - Intronic
951264365 3:20548704-20548726 GGACTGTACTGCCGCGAACTCGG - Intergenic
951290637 3:20867726-20867748 GGACTGTACTGCTGCCATCTCGG - Intergenic
951550683 3:23872309-23872331 GGACTGTACTGCTGCCATCTCGG - Intronic
952308727 3:32169150-32169172 GGACTGTACTGCTGCCATCTCGG + Intergenic
952358306 3:32605002-32605024 GGAGTGTAATGGTGCCATCTCGG + Intergenic
952364553 3:32663534-32663556 GGACTGTACTGCTGCCATCTCGG + Intergenic
952892478 3:38052849-38052871 GGACTGTACTGCCGCCATCTCGG + Intronic
953037635 3:39227121-39227143 GGACTGTGCTGCTGCCATCTCGG + Intergenic
953084735 3:39655352-39655374 GGAGTGTACTGCCGCGATCTCGG + Intergenic
953257427 3:41305290-41305312 GGACTGTACTGCTGCCATCTCGG + Intronic
953425842 3:42797018-42797040 GGACTGTACTGCTGCCATCTCGG + Intronic
953465689 3:43117414-43117436 CGAGGGAACAGCTGCCATCTTGG + Intergenic
953854953 3:46493972-46493994 GGACTGTACTGCTGCCATCTCGG + Intergenic
953922666 3:46963515-46963537 GGACTGTACTGCTGCCATCTCGG + Intronic
953959367 3:47255819-47255841 GGACTGTACTGCTGCCATCTCGG + Intronic
954048199 3:47951409-47951431 GGGCTGTACTGCTGCCATCTCGG + Intronic
954059134 3:48055274-48055296 GGACTGTACTGCTGCCATCTCGG + Intronic
954162581 3:48733566-48733588 GGACTGTACTGCTGCCATCTCGG + Intronic
954356423 3:50085784-50085806 GGACAGTACTGCTGCCATCTCGG - Intronic
954399779 3:50312912-50312934 GGACTGTACTGCTGCCATCTCGG - Intergenic
954481501 3:50804675-50804697 GGACTATAGTGCCGCCATCTTGG - Intronic
954529931 3:51309520-51309542 GGACTGTACTGCTGCCATCTCGG - Intronic
954567219 3:51608762-51608784 GGACTGTACTGCCGTCATCTCGG - Intronic
954599632 3:51858050-51858072 GGACTGTACTGCTGCCATCTCGG + Intergenic
954623452 3:52008908-52008930 GGAGGGCAGTGCTGCGATCTTGG - Intergenic
954799297 3:53177994-53178016 GGAGTGTACTGGTGCGATCTTGG + Intronic
955173192 3:56585028-56585050 GGACTGTACTGCTGCCATCTCGG - Intronic
955256506 3:57338061-57338083 GGACTGTACTGCCGTGATCTTGG + Intronic
955277808 3:57564714-57564736 GGAGGGCACTGGTGCCATCACGG + Exonic
955306765 3:57840653-57840675 GGACTGTACTGATGTCATTTTGG + Intronic
955326163 3:58010412-58010434 GGGTGGTGCGGCTGCCATCTGGG - Intronic
955363259 3:58291314-58291336 GGACTGTACTGCTGCCATCTCGG - Intronic
955395071 3:58551057-58551079 GGACTGTACTGCTGCCATCTCGG - Intergenic
955435092 3:58891350-58891372 GGACTGTACTGCTGCCATCTCGG - Intronic
955626697 3:60927059-60927081 GGACTGTACTGCCACGATCTCGG + Intronic
955674714 3:61435654-61435676 GGACTGTGCTGCTGCCATCTCGG - Intergenic
955699961 3:61672655-61672677 GGACGGTACTGCTGCCATCTCGG - Intronic
955976510 3:64485357-64485379 GGAGTGTAGTGGTGCCATCTCGG + Intergenic
957035295 3:75288768-75288790 GGACTGTACTGCTGCCATCTCGG + Intergenic
957043357 3:75354285-75354307 GGAGTGTAATGGTGCCATCTTGG - Intergenic
957316955 3:78584245-78584267 GGACTGTACTGCTGCCATCTCGG - Intergenic
957346810 3:78971814-78971836 GGAGTGCACTGGTGCCATCTTGG + Intronic
957619978 3:82583928-82583950 GGACTGTACTGCCGCCATCTCGG + Intergenic
958047464 3:88303275-88303297 GGACTGTACTGCCGTGATCTGGG + Intergenic
958407348 3:93765253-93765275 GGACTGTACTGCGGTGATCTCGG - Intergenic
958809078 3:98838972-98838994 GGACTGTACTGCTGCCATCTCGG - Intronic
958957647 3:100478912-100478934 GGACGGTGCTGCTGCCGTCTCGG - Intergenic
959201863 3:103255837-103255859 GGACTGTACTGCTGCCATCTCGG - Intergenic
959415911 3:106075725-106075747 GGACGGTACTGCTGCCATCTCGG - Intergenic
959586185 3:108026821-108026843 GGACTGTACTGCTGCCATCTCGG - Intergenic
960030268 3:113047477-113047499 GGACTGTACTGCTGCCATCTCGG - Intergenic
960229871 3:115213069-115213091 GGAGGGCAGTGGTGCCATCTCGG + Intergenic
960344748 3:116518693-116518715 GGACTGTACTGCGGCCATCTCGG + Intronic
960388492 3:117050105-117050127 GGACTGTACTGCTGCCATCTCGG + Intronic
960577347 3:119242025-119242047 GGACTGTACTGCCGCCATCTCGG + Intergenic
960697912 3:120413851-120413873 GGACTGTACTGCTGCCATCTCGG + Intronic
960704830 3:120472001-120472023 GGAGGTTACTACTGGCATCTAGG - Intergenic
960780788 3:121314531-121314553 GGACGGTACTGCTGCCATCTCGG - Intronic
960817400 3:121688245-121688267 GGACTGTACTGCTGCCATCTCGG + Intronic
960861851 3:122163762-122163784 GGACTGTACTGCTGCCATCTCGG + Intergenic
960866227 3:122202354-122202376 GGACTGTACTGCTGCCATCTCGG - Intronic
960920840 3:122746712-122746734 GGACTGTACTGCTGCCATCTCGG + Intronic
960924581 3:122781491-122781513 GGACTGTACTGCTGCCATCTCGG - Intronic
961036504 3:123646071-123646093 GGAGGGCAGTGGTGCCATCTCGG - Intronic
961120923 3:124368986-124369008 GGACTGTACTGCTGCCATCTCGG - Intronic
961164053 3:124751284-124751306 GGACTGTACTGCTGCCATCTCGG - Intergenic
961230211 3:125300020-125300042 GGAGGGCAGTGGTGCCATCTCGG + Intronic
961729044 3:128953675-128953697 GGACTGTACTGCTGCCATCTCGG + Intronic
961784659 3:129340734-129340756 GGACTGTACTGCTGCCATCTCGG - Intergenic
961789275 3:129364275-129364297 GGACTGTACTGCTGCCATCTCGG - Intergenic
961962258 3:130867369-130867391 GGATGGTACTGCTGCCATCTCGG + Intronic
962063037 3:131951622-131951644 GGACTGTACTGCTGCCATCTCGG + Intronic
962113230 3:132472172-132472194 GGACTGTACTGCTGCCATCTCGG - Intronic
962418077 3:135201816-135201838 GGATGGTCCTCCTGGCATCTTGG - Intronic
962559142 3:136587910-136587932 GGAGTGTAATGGTGCCATCTTGG - Intronic
962572018 3:136722751-136722773 GGACTGTACTGCTGCCATCTCGG + Intronic
962623214 3:137199216-137199238 GGACTGTACTGCTGCCATCTCGG - Intergenic
962664588 3:137641432-137641454 GGAGTGTAGTGGTGCCATCTTGG + Intergenic
962761675 3:138520868-138520890 GGACTGTACTGCCGCGATCTCGG + Intronic
962787799 3:138784489-138784511 GGACTGTACTACCACCATCTCGG + Intronic
962867032 3:139455708-139455730 GGCAGGTACTGGAGCCATCTGGG - Intronic
963249245 3:143087524-143087546 GGACTGTACTGCTGCCATCTCGG - Intergenic
963498226 3:146095946-146095968 GGACGGTACTGCTGCCATCTCGG + Intronic
963768570 3:149365092-149365114 GGACTGCAGTGGTGCCATCTTGG + Intergenic
963776533 3:149445680-149445702 GGACTGTACTGCTGCCTTCTCGG - Intergenic
963780795 3:149484432-149484454 GGAGTGTAGTGGTGCCATCTTGG + Intronic
963911773 3:150821773-150821795 GGACGGTGCTGCTGCCATCTCGG - Intergenic
964389473 3:156182747-156182769 GGAGTGCACTGGTGCCATCTCGG + Intronic
965136811 3:164783993-164784015 GGACTGTACTGCCGCGATCTCGG + Intergenic
965302194 3:167018164-167018186 GGACTGTACTGCCGCCATCTCGG + Intergenic
965567923 3:170140642-170140664 GGACTGTAGTGGTGCGATCTCGG + Intronic
965649915 3:170923060-170923082 GAACTGTACTGCTGCCATCTCGG + Intergenic
966015683 3:175133658-175133680 GGACTGTACTGCTGCCATCTGGG - Intronic
966052423 3:175636645-175636667 GGACTGTAGTGGTGCAATCTTGG - Intronic
966617357 3:181926605-181926627 GGACTGTACTGCCGCCATCTCGG - Intergenic
966783693 3:183607398-183607420 GGACTGTACTGCTGCGATCTCGG + Intergenic
966967082 3:185004416-185004438 GGACTGTGCTGCTGCCATCTCGG - Intronic
967126273 3:186427409-186427431 GGAGGGCAGTGGTGCCATCTCGG - Intergenic
967169536 3:186812367-186812389 GGACTGTACTGCTGCCATCTCGG - Intergenic
967175939 3:186863599-186863621 GGACGGTACTGCTGCCATCTCGG + Intergenic
967177345 3:186873318-186873340 GGACTGTACTGCTGCCATCTCGG + Intergenic
967178822 3:186885488-186885510 GGACTGGACTGCTGCCATCTCGG - Intergenic
967524115 3:190472761-190472783 GGACTGTACTGCTGCCATCTCGG + Intergenic
967578663 3:191125719-191125741 GGACTGTAATGCCACCATCTCGG - Intergenic
967793963 3:193578416-193578438 GGAAGCAACTGCTGCCATTTTGG + Intronic
968026739 3:195448939-195448961 GGAGTGCAGTGCTGCCATCTCGG - Intergenic
968042567 3:195600401-195600423 GGACTGTACTGCTGCCATCTCGG - Intergenic
968411499 4:395049-395071 GGACGGTACTGCTGCCATCTCGG + Intergenic
968430014 4:551348-551370 GGACTGTGCTGCCGCCATCTCGG - Intergenic
968506999 4:975402-975424 GGACGGTACTGCCGCCATCTCGG + Intronic
968924457 4:3539645-3539667 GGACTGTACTGCTGCCATCTCGG - Intergenic
969384909 4:6837850-6837872 GGACTGTGCTGCCGCCATCTCGG - Intronic
969404016 4:6977180-6977202 GGACTGTACTGCTGCCATCTCGG + Intronic
969949734 4:10822981-10823003 GGAGGGCAATGGTGCCATCTCGG - Intergenic
970205199 4:13648722-13648744 GGAGGGCAGTGCTGCGATCTCGG + Intergenic
970216251 4:13762021-13762043 GGACTGTACTGCTGCCATCTAGG - Intergenic
970409080 4:15790242-15790264 GGACGGTACTGCTGCCATCTCGG + Intronic
970472895 4:16394237-16394259 GGACTGTACTGCTGCCATCTCGG - Intergenic
970670129 4:18387186-18387208 GGAGGGTAGTGGTGCAATCTTGG + Intergenic
970783270 4:19766017-19766039 GGAGGGCAGTGGTGCCATCTTGG + Intergenic
971282210 4:25250155-25250177 GGACTGTACTGCCGCCATCTCGG - Intronic
971372748 4:26031383-26031405 GGAGGGCAGTGGTGCCATCTCGG - Intergenic
971383905 4:26125746-26125768 GGAGTGCACTGGTGCCATCTTGG - Intergenic
971558106 4:28038989-28039011 GGACTGTAGTGGTGCCATCTTGG - Intergenic
971594998 4:28515714-28515736 GGACTGTACTGCTGCCATCTCGG - Intergenic
972270863 4:37509899-37509921 GGACTGTACTGCCACCATCTCGG - Intronic
972288124 4:37668275-37668297 GGACTGTACTGCTGCCATGTCGG + Intronic
972412264 4:38806900-38806922 GGACTGTACTGCTGCCATCTCGG + Intronic
972545103 4:40072774-40072796 GGACTGCAATGGTGCCATCTCGG + Intronic
972551936 4:40142024-40142046 GGACTGTCCTGCTGCCATCTCGG - Intronic
972552790 4:40148387-40148409 GGACTGTACTGCTGCCATCTCGG - Intronic
972577115 4:40362256-40362278 GGAGTGCACTGCTGCAATCTTGG + Intergenic
972653997 4:41048732-41048754 GGACTGTACTGCTGCCAACTCGG + Intronic
972757765 4:42067125-42067147 GGAGGATACTGCTGCAGTCTTGG + Exonic
973263216 4:48185917-48185939 GGACTGTACTGCCGCCATCTCGG + Intronic
973274235 4:48291827-48291849 GGACTGTACTGCTGCCATCTCGG + Intergenic
973281670 4:48364801-48364823 GGACTGTACTGCTGCCATCTCGG - Intronic
973325121 4:48852930-48852952 GGACTGTAGTGGTGCGATCTCGG + Intronic
973583211 4:52364938-52364960 GGAGTGTACTGGTGCAATCTTGG - Intergenic
973593258 4:52464174-52464196 GGACTGTACTGCTGCCATCTCGG + Intergenic
973618599 4:52705220-52705242 GGAGGGCAGTGGTGCCATCTCGG - Intergenic
973663971 4:53138930-53138952 GGACTGTACTGCCGCCATCTCGG + Intronic
973673327 4:53239286-53239308 GGACTGTACTGCTGCCATCTCGG - Intronic
973675378 4:53256801-53256823 GGACTGTACTGCTGCCATCTCGG - Intronic
973752184 4:54032325-54032347 GGACTGTACTGCTGCCATCTCGG + Intronic
973785214 4:54326447-54326469 GGACTGTACTGCTGCCATCTCGG - Intergenic
974021368 4:56694224-56694246 GGACTGTACTGCTGCCATCTCGG - Intergenic
974076446 4:57172597-57172619 GTCCTGTACTGCTGCCATCTCGG + Intergenic
974082029 4:57223860-57223882 GGACTGTACTGCTGCCATCTGGG + Intergenic
974256277 4:59459053-59459075 GGACTGCACTGGTGCCATCTCGG - Intergenic
974597723 4:64036705-64036727 GGACTGTACTGCCACGATCTCGG + Intergenic
975042306 4:69761420-69761442 GGACTGTACTGCTGCCATCTCGG + Intronic
975063670 4:70037013-70037035 GGACTGTGCTGCCGCCATCTCGG + Intergenic
975220907 4:71811774-71811796 GGAGGGCAGTGGTGCCATCTCGG + Intergenic
975633307 4:76422797-76422819 GGACTGTACTGCTGCCATGTCGG + Intergenic
975685427 4:76916139-76916161 GGACGGTGCTGCTGCCATCTCGG + Intergenic
975793850 4:77984700-77984722 GGACTGTACTGCTGCCATCTCGG - Intergenic
975848221 4:78547398-78547420 GGACTGTACTGCTACCATCTCGG + Intergenic
975908632 4:79244687-79244709 GGACTGTACTGCCGCAATCTCGG + Intronic
976264921 4:83181536-83181558 GGACTGTACTGCTGCCATCTCGG + Intergenic
976266149 4:83186931-83186953 GGACTGTACTGCTGCGATCTCGG - Intergenic
976341021 4:83944598-83944620 GGACAGTACTGCTGCCATCTCGG - Intergenic
976607261 4:86995371-86995393 GGACGGTACTGCTGCCATCTCGG + Intronic
977204965 4:94157344-94157366 GGACTGTACTGCTGCCATCTCGG + Intergenic
977542300 4:98331232-98331254 GGACTGTACTGCCGTGATCTCGG - Intronic
978014133 4:103722762-103722784 GGACTGTACTGCCACCATCTCGG + Intergenic
978157089 4:105501156-105501178 GGACTGTACTGCCGTGATCTCGG - Intergenic
978370055 4:108020760-108020782 GGACGCTGATGCTGCCATGTGGG + Intronic
978408975 4:108408879-108408901 GGACGGTACTGCTGCCATCTCGG + Intergenic
978519204 4:109598532-109598554 GGACTGTACTGCTGCCATCTCGG - Intronic
978820415 4:112958530-112958552 GGACTGTACTGCTGCCATCTCGG - Intronic
978947377 4:114515961-114515983 GGACTGTGCTGCTGCCATCTCGG + Intergenic
979482731 4:121238041-121238063 GGACTGTACTGCCGTGATCTCGG + Intergenic
979576655 4:122300054-122300076 GGAATGTAGTGGTGCCATCTCGG + Intronic
979622219 4:122811251-122811273 GGACTGTACTGCTGCCATGTCGG + Intergenic
979641787 4:123017058-123017080 GGACTGTACTGCTGCCATCTCGG - Intronic
979702372 4:123684377-123684399 GGACTGTATTGCCGCGATCTCGG + Intergenic
980056679 4:128084561-128084583 GGACTGTACTGCTGCCATCTCGG - Intronic
980398505 4:132247692-132247714 GGAGTGTAGTGCTGCAATCTCGG - Intergenic
980895002 4:138853527-138853549 GGACTATACTGCTGCCATCTCGG + Intergenic
981677319 4:147357335-147357357 GGACTGTGCTGCTGCCATCTTGG + Intergenic
981970262 4:150658807-150658829 GGACTGTACCGCTGCCATCTCGG + Intronic
981993538 4:150953424-150953446 GGACTGTACTGCCGCCATCTCGG + Intronic
981994685 4:150963245-150963267 GGACTGTACTGCTGCCATCTTGG + Intronic
982040254 4:151390229-151390251 GGACGGTACTGCTGCCATCTCGG + Intergenic
982053785 4:151527460-151527482 GGACGGTACTGCTGCCATCTCGG - Intronic
982083159 4:151809619-151809641 GCACAGTGCTGCTGCCATCATGG - Intergenic
982183023 4:152766056-152766078 GGACTGTACTGCCGCCACCTCGG - Intronic
982192213 4:152867432-152867454 GGACTATACTGCTGCCATCTCGG - Intronic
982709865 4:158747413-158747435 GGGCTGTACTGCTGCCATCTCGG - Intergenic
982711049 4:158759232-158759254 GGACTGTACTGCCGTGATCTCGG + Intergenic
982821088 4:159940580-159940602 GGACTGTACTGCTGCCATCTCGG - Intergenic
982999727 4:162398688-162398710 GGAGAGTAGTGGTGCCATCTCGG - Intergenic
983218299 4:165020884-165020906 GGACTGTACTGCTGCCATATCGG - Intergenic
983604405 4:169569551-169569573 GGACTGTACTGCTGCCATCTAGG + Intronic
983628620 4:169827863-169827885 GGACTGTACTGCCGCCATCTGGG + Intergenic
983652082 4:170045813-170045835 GGACTGTACTGCTGCCATCTTGG + Intergenic
984037731 4:174691449-174691471 GGACTGTACTGCTGCCATCTCGG + Intronic
984728289 4:183041586-183041608 GGACTGTACTGCTGCCATCTCGG - Intergenic
984804395 4:183737725-183737747 GGACGGTACTGCTGCCATCTCGG - Intergenic
984974182 4:185215838-185215860 GGAGGGCAGTGGTGCCATCTTGG + Intronic
985104091 4:186484828-186484850 GGAGTGTAGTGGTGCCATCTTGG + Intronic
985179143 4:187237594-187237616 GGAGTGTAGTGGTGCCATCTCGG + Intergenic
985216246 4:187657552-187657574 GGACTGTACTGCTGCCATCTTGG + Intergenic
985247373 4:187991882-187991904 GGACTGTACTGCTGCCATCTTGG - Intergenic
985334612 4:188878451-188878473 GGAGTGTAGTGCTGCAATCTTGG + Intergenic
985569429 5:636757-636779 GGAGTGTAGTGATGCCATCTAGG - Intronic
985736277 5:1585469-1585491 GGACTGTACTGCTGCCATCTCGG + Intergenic
987268157 5:16277785-16277807 GGACTGTACTGCTGCCATCTCGG - Intergenic
987469138 5:18309043-18309065 GGACTGTACTGCTGCCATCTCGG + Intergenic
988524361 5:31974029-31974051 GGAATGTAGTGGTGCCATCTTGG + Intronic
988544177 5:32141661-32141683 GGACGGTACTGCTGCCATCTCGG + Intronic
988760838 5:34307635-34307657 GGACTGTACTGCTGCCATCTCGG - Intergenic
989021661 5:37014143-37014165 GGACGGTACTGCTGCCATCTCGG - Intronic
989061744 5:37416445-37416467 GGACTGTACTGCTGCCATCTCGG - Intronic
989068308 5:37484491-37484513 GGACTGTACTGCTGCCATCTCGG - Intronic
989076165 5:37564463-37564485 GGACTGTACTGCTGCCATCTCGG - Intronic
989191900 5:38678582-38678604 GGAGTGTAGTGGTGCCATCTCGG + Intergenic
989211715 5:38863100-38863122 GGACTGTACTGCTGCCATCTCGG - Intronic
989252510 5:39333671-39333693 GGACTGTACTGCCGCCATCTTGG + Intronic
989535402 5:42557911-42557933 GGAAGGGACTGATGCTATCTAGG - Intronic
989574602 5:42978756-42978778 GGACTGTACTGTCGCCATCTTGG + Intergenic
989574886 5:42979892-42979914 GGACTGTACTGCTGCCATCTCGG + Intergenic
989588157 5:43089055-43089077 GGACTGTACTGCTGCGATCTCGG - Intronic
989633335 5:43510500-43510522 GGACTGTACTGCTGCCATCTCGG + Intronic
989634702 5:43521560-43521582 GGACTGTACTGCTGCCATCTCGG + Intergenic
989640617 5:43579085-43579107 GGACTGTACTGCTGCCATCTCGG - Intergenic
989648921 5:43666528-43666550 GGACTGTACTGTCGCCATCTCGG - Intronic
989656083 5:43747025-43747047 GGACTGTACTGCCGCCATCTCGG - Intergenic
989828730 5:45890035-45890057 GGACTGTACTGCTGCCATCTCGG + Intergenic
990137147 5:52659942-52659964 GGAGTGCAGTGCTGCCATCTCGG - Intergenic
990293751 5:54380840-54380862 GGACTGTACTGCTGCCATCTCGG + Intergenic
990459253 5:56015909-56015931 GGACTGTACTGCTGCCATCTCGG - Intergenic
990462172 5:56039504-56039526 GGACTGTACTGCTGCCATCTTGG - Intergenic
990498448 5:56371993-56372015 GGACTGTGCTGCTGCCATCTTGG + Intergenic
990617097 5:57519144-57519166 GGACTGTACTGCCGTGATCTCGG - Intergenic
990871180 5:60432008-60432030 GGACTGTACTGCTGCCACCTCGG - Intronic
991073978 5:62514528-62514550 GGACTGTACTGCTGCCATCTCGG - Intronic
991127517 5:63084563-63084585 GGACGGTACTGCTGCCATCTCGG - Intergenic
991279931 5:64901405-64901427 GGAGTGTAGTGGTGCCATCTCGG - Intronic
991373085 5:65939606-65939628 GGACTGTACTGCTGCCATCTCGG + Intronic
991598044 5:68324489-68324511 GGACGGTACTGCTGCCATCTCGG - Intergenic
991672752 5:69063633-69063655 GGACTGTACTGCTGCCATCTCGG - Intergenic
991723821 5:69516433-69516455 GGACTGTACTGCTGCCATCTCGG - Intronic
991910268 5:71552756-71552778 GGACTGTACTGCTGCCATCTCGG - Intronic
992415962 5:76551790-76551812 GGACTGTACTGCCGCCATCTCGG - Intronic
992418218 5:76573660-76573682 GGACTGCAGTGGTGCCATCTCGG + Intronic
992442824 5:76811664-76811686 GGACTGTACTGCTGCCATCTCGG + Intergenic
992463958 5:76985830-76985852 GGACTGTGCTGCTGCCATCTCGG - Intergenic
992499613 5:77329076-77329098 GAACAGTACTCCTTCCATCTGGG - Intronic
992540602 5:77760471-77760493 GGACTGTACTGCCGTGATCTCGG + Intronic
992574305 5:78096070-78096092 GGACTGTACTGCTGCCATCTCGG + Intronic
992600330 5:78391943-78391965 GGACTGTACTGCTGCCATCTCGG - Intronic
992801600 5:80300630-80300652 GGACTGTACTGCTGCCATCTCGG + Intergenic
992977849 5:82138912-82138934 GGACTGTACTGCTGCCATCTCGG + Intronic
993294027 5:86110831-86110853 GTATGGTTCTGCTGACATCTTGG - Intergenic
993658043 5:90596726-90596748 GGACTGTACTGCTGCCATCTCGG - Intronic
993956651 5:94242674-94242696 GGAGTGCAGTGCTGCCATCTCGG + Intronic
994517063 5:100785218-100785240 GGACAGTACTGCTGTGATCTTGG + Intergenic
994907362 5:105858978-105859000 GGACTGTACTGCCGCCATCTGGG + Intergenic
995123768 5:108560066-108560088 GGACTGTACTGCTGCCATCTCGG - Intergenic
995162003 5:108993475-108993497 GGACTGTACTGCTGCCATCTCGG - Intronic
995193134 5:109340710-109340732 GGACTGTACTGCTGCCATCTCGG + Intronic
995236384 5:109833606-109833628 GGACTGTAGTGCTGCCATCTCGG - Intronic
995456704 5:112360333-112360355 GGACTGTACTGCCGCCATCTCGG + Intronic
995515814 5:112954269-112954291 GGACTATACTGCTGCCATCTCGG + Intergenic
995895126 5:117002829-117002851 GGACTGTGCTGCTGCCATCTCGG - Intergenic
995942511 5:117600720-117600742 GGACTGTGCTGCTGCCATCTCGG - Intergenic
996070222 5:119123239-119123261 GGACTGTACTGCCGCCATCTCGG - Intronic
996159745 5:120147481-120147503 GGACTGTGCTGCCGCCATCTCGG + Intergenic
996341169 5:122440694-122440716 GAACGGCACTGTTGCCATCCTGG - Exonic
996386433 5:122914046-122914068 GGACTGTACTGCTGCCATCTCGG - Intronic
996738063 5:126775751-126775773 GGAGTGTAATGGTGCCATCTCGG + Intergenic
997321791 5:132983867-132983889 GGACTGTACTGCTGCCATCTCGG - Intergenic
997433710 5:133858782-133858804 GGACTGTACTGCCGTGATCTCGG - Intergenic
997481478 5:134188364-134188386 GTAAGGGGCTGCTGCCATCTGGG - Intronic
997565455 5:134882776-134882798 GGACTGTACTGCTGCCATCTCGG - Intronic
997875124 5:137539015-137539037 GGACGGTACTGCTGCCATCTCGG - Intronic
997993264 5:138564152-138564174 GGACTGCAGTGGTGCCATCTGGG + Intronic
998025454 5:138811855-138811877 GGACTGTACTGCTGCCATCTCGG - Intronic
998053482 5:139055730-139055752 GGACTGTACTGCTGCCATCTCGG + Intronic
998059926 5:139111904-139111926 GGACTGTACTGCTGCCATCTCGG + Intronic
998067286 5:139169926-139169948 GGACTGTACTGCTGCCATCTCGG + Intronic
998074304 5:139223937-139223959 GGACTGTACTGCTGCCATCTCGG + Intronic
998239640 5:140428572-140428594 GGACTGTACTGCTGCCATCTGGG - Intronic
998432360 5:142077268-142077290 GGACTGTACTGCTGCCATCTCGG - Intergenic
998634510 5:143938340-143938362 GTGAGGGACTGCTGCCATCTGGG + Intergenic
998833699 5:146184294-146184316 GGAGTGCAGTGCTGCCATCTTGG - Intergenic
999181285 5:149671332-149671354 GGACTGTACTGCTGCCATCTTGG - Intergenic
999442043 5:151609343-151609365 GGACTGCACTGGTGCAATCTTGG - Intergenic
999455801 5:151714782-151714804 GGACTGTACTGCTGCCATCTCGG - Intergenic
999604336 5:153297716-153297738 GGACTGTGCTGCTGCCATCTCGG - Intergenic
999969906 5:156848890-156848912 GGAGTGTACTGGTGCAATCTTGG - Intergenic
999978907 5:156940016-156940038 GGACTGTACTGCCGCGATCTCGG + Intronic
999986855 5:157013602-157013624 GGACTGTACTGCTGCCATCTCGG + Intergenic
1000032787 5:157419008-157419030 GGACTGTACTGCTGCCATCTCGG + Intronic
1000103591 5:158037931-158037953 GGACTGTACTGCGGCCATCTCGG - Intergenic
1000158999 5:158581857-158581879 GGACTGTACTGCTGCCATCTCGG + Intergenic
1000630403 5:163584521-163584543 GGACTGTACTGCCGCCATCTCGG - Intergenic
1001078068 5:168644354-168644376 GGACTGTACTGCTGCCATCTCGG - Intergenic
1001481893 5:172094411-172094433 GGAGTGTAGTGGTGCCATCTTGG + Intronic
1002008182 5:176253075-176253097 GGACTGTACTGCTGCCATCTCGG - Intronic
1002013481 5:176304257-176304279 GGACTGTACTGCTGCCATCTCGG + Intronic
1002031394 5:176433181-176433203 GGACTGTACTGCTGCCAACTCGG + Intergenic
1002115597 5:176960701-176960723 GGACTGTACTGCTGCCATCTCGG + Intronic
1002529535 5:179835622-179835644 GGACTGTACTGCTGCCATCTCGG - Intronic
1002611573 5:180422261-180422283 GGAGTGTAGTGGTGCCATCTCGG - Intergenic
1002626320 5:180531920-180531942 GGACTGTACTGCCGCCATCTCGG - Intronic
1003319620 6:5038813-5038835 GGACGGTGCTGCTGCCATCTCGG - Intergenic
1003376366 6:5581469-5581491 GGAGAGTTCTGCTGCCCTCTGGG - Intronic
1003407592 6:5836584-5836606 GGACTGTACTGCTGCCATCTCGG - Intergenic
1004109200 6:12698725-12698747 GGAGGGTAGTGGTGCGATCTCGG + Intergenic
1004152331 6:13133353-13133375 GGACTGTAATGCCGCCATCTCGG + Intronic
1004220498 6:13742775-13742797 GGAGTGTAATGGTGCCATCTTGG + Intergenic
1004415148 6:15416624-15416646 GGACTGTACTGCTGCCATCTCGG - Intronic
1004448981 6:15727253-15727275 GGACTGTACTGCTGCCATCTCGG - Intergenic
1004664410 6:17736414-17736436 GGACTGTACTGCTGCCATCTCGG - Intergenic
1004874194 6:19938759-19938781 GGACTGTACTGCCGCCATCTCGG + Intergenic
1005063751 6:21798307-21798329 GGACAGTACTGCTGCCATCTCGG - Intergenic
1005158590 6:22835794-22835816 GGACTGTACTGCTGCCATCTCGG + Intergenic
1005414633 6:25586890-25586912 GGACTGTACTGCTGCCATCTCGG - Intronic
1005607213 6:27486375-27486397 GGACTGTACTGCTGCCATCTCGG - Intergenic
1005644873 6:27828412-27828434 GGACTATACTGCTGCCATCTCGG - Intergenic
1005710725 6:28501615-28501637 GGACTGTACTGCCGCCATCTGGG + Intergenic
1005747318 6:28850136-28850158 GGAGGGCAGTGGTGCCATCTTGG - Intergenic
1005837042 6:29717957-29717979 GGACGGTACTGCTGCCATCTCGG + Intergenic
1005865194 6:29932123-29932145 GGACTGTACTGCTGCCATCTCGG + Intergenic
1005929675 6:30474541-30474563 GGACTGTACTGCTGCCATCTCGG + Intergenic
1006065249 6:31456439-31456461 GGACTGTACTGCTGCCATCTCGG - Intergenic
1006097891 6:31667180-31667202 GGAGGGTAGTGGTGCGATCTCGG + Intronic
1006128687 6:31855293-31855315 GGACTGTACTGCTGCCATCTCGG - Intergenic
1006141664 6:31933052-31933074 GGACGGTACTGCTGCCATCTCGG - Intronic
1006210073 6:32386029-32386051 GGACTGTGCTGCTGCCATCTCGG - Intergenic
1006225213 6:32531603-32531625 GGACTGTACTGCAGCCATCTCGG + Intergenic
1006232588 6:32596723-32596745 GGACTGTACTGCTGCCATCTCGG - Intergenic
1006282044 6:33060689-33060711 GGACGATACTGCTGCCATCACGG - Intergenic
1006346466 6:33486499-33486521 GGACTGTGCTGCTGCCATCTTGG - Intergenic
1006370420 6:33640707-33640729 GGCTTGCACTGCTGCCATCTTGG + Intronic
1006403987 6:33833482-33833504 GGACTGTACTGCTGCCATCTCGG - Intergenic
1006487111 6:34352213-34352235 GGACTGCACTGGTGCCATCTTGG + Intronic
1006546498 6:34785886-34785908 GGACTGTGCTGTTGCCATCTCGG + Intergenic
1006617405 6:35339805-35339827 GGACTGTACTGCTGCCATCTCGG + Intergenic
1006804193 6:36777827-36777849 GGACGGTCTTTCTGCCCTCTGGG + Intronic
1007283624 6:40731112-40731134 GCACGGTAGTGCTGCCTCCTGGG + Intergenic
1007411598 6:41665973-41665995 GGAGGGCAATGGTGCCATCTCGG + Intergenic
1007437670 6:41827607-41827629 GGAGGGTAGTGGTGCGATCTTGG - Intronic
1007545137 6:42687420-42687442 GGACTGTACTGCCGCCATCTTGG - Intronic
1007651365 6:43424719-43424741 GGACTGTACTGCCGCTATCTCGG + Intergenic
1008096987 6:47349102-47349124 GGAGTGTAGTGGTGCCATCTCGG - Intergenic
1008106458 6:47444572-47444594 GGACTGTACTGCCGCCATCTGGG - Intergenic
1008112365 6:47506727-47506749 GGACTGTACTGCTGCCATCTCGG - Intronic
1008184489 6:48371997-48372019 GGACTGTACTGCTGCCATCTTGG - Intergenic
1008282345 6:49611790-49611812 GGAGGGTAATGGTGCCATCTCGG + Intronic
1008377761 6:50810705-50810727 GGACTGTACTGCCGCCATCTCGG - Intergenic
1008480541 6:51981405-51981427 GGACGGTGCTGCTGCCATCTCGG + Intronic
1008553910 6:52656856-52656878 GGCCTGTACTGCTGCCATCTCGG - Intergenic
1008624908 6:53306140-53306162 GGACTGTGCTGCTGCCATCTCGG - Intronic
1008841765 6:55910923-55910945 GGACTGTACTGCTGCCATCTCGG - Intergenic
1008919089 6:56824068-56824090 GGACTGTACTGCTGCCATCTCGG + Intronic
1008926775 6:56895953-56895975 GGACGGTACTGCTGCCATCTCGG - Intronic
1009048932 6:58257183-58257205 GGACTGTACTGCTGCCATCGTGG + Intergenic
1009622816 6:66097520-66097542 GGGCTGTACTGCTGCCATCTCGG - Intergenic
1010030638 6:71267331-71267353 GGACTGTACTGCTGCCATCTCGG - Intergenic
1010246143 6:73661635-73661657 GGACTGTACTGCTGCCATCTCGG - Intergenic
1010264574 6:73851889-73851911 GGACTGTACTGCTGCCATCTCGG - Intergenic
1010300771 6:74255901-74255923 GGACTGTACTGCTGCCATCTCGG - Intergenic
1010400758 6:75442690-75442712 GGACTGTACTGCTGCCATCTCGG - Intronic
1010512995 6:76743724-76743746 GGACTGTACTGCTGCCATCTCGG + Intergenic
1011148808 6:84245550-84245572 GAACTGTCCTGCTGCCATCTCGG - Intergenic
1011297090 6:85838008-85838030 GGACTGTACTGCTGCCGTCTCGG + Intergenic
1011467537 6:87673788-87673810 GGAGTGCAGTGCTGCCATCTCGG - Intergenic
1011474360 6:87736757-87736779 GGACTGTACTGCTACCATCTCGG - Intergenic
1011476267 6:87752020-87752042 GGACTGTGCTGCTGCCATCTCGG - Intergenic
1011587922 6:88946714-88946736 GGACTGTACTGCTGCCATCTCGG + Intronic
1011823892 6:91283925-91283947 GGACAGGACTGCTGATATCTTGG - Intergenic
1012428540 6:99141436-99141458 GGACTGTACTGCTGCCATCTCGG + Intergenic
1012479533 6:99650968-99650990 GGACTGTACTGCTGCCATCTCGG - Intergenic
1012983853 6:105854824-105854846 GGACTGTACTGCTGCCATCTCGG - Intergenic
1012989086 6:105906795-105906817 GGACTGTAGTGGTGCCATCTTGG + Intergenic
1013190762 6:107802803-107802825 GGACTGTACTGCTGCCATCTCGG + Intronic
1013204406 6:107933780-107933802 GGACTGTACTGCTGCCATCTTGG + Intronic
1013243744 6:108269274-108269296 GGACTGTACTGCTGCCATCTCGG + Intergenic
1013325838 6:109046153-109046175 GGACTGTACTGCTGCCATCTCGG + Intronic
1013343237 6:109236011-109236033 GGGAGGTACTGCTGGCATCTGGG - Intergenic
1013506228 6:110803128-110803150 GGAGGGCAGTGGTGCCATCTCGG + Intronic
1013637953 6:112047168-112047190 GTACTGTACTGCTGCCATCTCGG + Intergenic
1013681469 6:112529103-112529125 GGACTGTACTGCTGCCATCTCGG - Intergenic
1013801823 6:113955262-113955284 GGACTGCAGTGGTGCCATCTCGG + Intronic
1014123280 6:117750448-117750470 GGACTGTACTGCTGCCATCTCGG + Intergenic
1014220034 6:118790626-118790648 GGAGGGCAGTGGTGCCATCTTGG - Intergenic
1014238121 6:118984097-118984119 GGAGTGTAGTGCTGCGATCTCGG - Intronic
1014463791 6:121730337-121730359 GGACTGTACTGCCACCATCTCGG - Intergenic
1014557300 6:122850226-122850248 GGACTGTACTGCTGCCATCTCGG - Intergenic
1014755353 6:125296769-125296791 AGAGGATACTGCTGCCTTCTAGG - Intronic
1014764399 6:125390063-125390085 GGACTGTACTGCTGCCATCTCGG - Intergenic
1014800195 6:125770259-125770281 GGACTGTACTGCTGCCATCTCGG + Intergenic
1014820303 6:125981944-125981966 GGAAGGTGCAGCTGACATCTAGG - Intergenic
1015643845 6:135364828-135364850 GGACGGTACTGCTGCCATCTCGG - Intronic
1015794561 6:136998044-136998066 GGAGGGTGCTGCTGGCATGTAGG - Intergenic
1016476609 6:144434279-144434301 GGACTGTACTGCTGCCATCTCGG - Intronic
1016480023 6:144470962-144470984 GGACTGTCCTGCCGCCATCTCGG - Intronic
1016480214 6:144472816-144472838 GGAGTGTAGTGGTGCCATCTTGG + Intronic
1016862924 6:148739536-148739558 GGACTGTAGTGGTGCGATCTTGG + Intergenic
1017104051 6:150871550-150871572 GGACTGCAGTGCTGCGATCTCGG + Intronic
1017170247 6:151449708-151449730 GGACTGTACTGCTGCCATCTCGG + Intronic
1017340434 6:153315220-153315242 GGAGTGCACTGGTGCCATCTCGG - Intergenic
1017465011 6:154686735-154686757 GGACTATACTGCTGCCATCTCGG + Intergenic
1017660506 6:156669695-156669717 GGACTGTACTGCTGCCATCTCGG + Intergenic
1017760326 6:157563199-157563221 GGCCAGTACTTCTGCCATCCAGG - Intronic
1017851683 6:158309825-158309847 GGACTGTACTTCTGCCATCTCGG - Intronic
1017981763 6:159406802-159406824 GGACTGTACTGCCGCCATCTCGG + Intergenic
1018295159 6:162338322-162338344 GGACTGTACTGCTGCCATCTCGG + Intronic
1018528294 6:164736940-164736962 GGACTGTACTGCTGCCATCCCGG - Intergenic
1018644411 6:165934032-165934054 TGAGTGTACTGGTGCCATCTCGG + Intronic
1019225259 6:170503202-170503224 GGAATGTACTGCAGCTATCTGGG + Intergenic
1019296960 7:282735-282757 GGAGGGTGCTGCTGCCAAGTGGG + Intergenic
1019438934 7:1037314-1037336 GGACTGTACTGCTGCCATCTCGG + Intronic
1019445583 7:1069419-1069441 GGACTGTACTGCTGCCATCTCGG + Intronic
1019459293 7:1147898-1147920 GGACGGTACTGCTGCCATCTCGG - Intergenic
1019668852 7:2267382-2267404 GGACTGTACTGCTGCCATCTCGG + Intronic
1019674279 7:2302162-2302184 GGACTGTACTGCTGCCATCTCGG + Intronic
1019715168 7:2535224-2535246 GGACGGTACTGCTGCCATCTCGG - Intergenic
1019891147 7:3948306-3948328 GGACTGCAGTGATGCCATCTCGG + Intronic
1019981194 7:4623408-4623430 GAACTATACTGCTGCCATCTCGG + Intergenic
1020171492 7:5848335-5848357 GGAGGGCAGTGGTGCCATCTCGG + Intergenic
1020285065 7:6672365-6672387 GGACTGTACTGCTGCCATCTCGG - Intergenic
1020498736 7:8890019-8890041 GGACTGTACTGCTGCCATCTCGG + Intergenic
1020831554 7:13102013-13102035 GGACTGTACTGCTGCCATCTCGG + Intergenic
1021120571 7:16790973-16790995 GGACTGTGCTGCTGCCATCTCGG - Intergenic
1021440072 7:20667781-20667803 GGACTGTACTGCTGCCATCTCGG + Intronic
1021510016 7:21425366-21425388 GGAGTGCACTGGTGCCATCTTGG + Intergenic
1021617804 7:22520546-22520568 GGAGGGCACTGGTGCGATCTCGG + Intronic
1021647226 7:22800306-22800328 GGACTGTACTGCTGCCATCTCGG + Intergenic
1021672628 7:23047312-23047334 GGACTGTACTGCTGCCATCTCGG - Intergenic
1021735159 7:23635942-23635964 GGACGGTACTGCTGCCATCTCGG + Intronic
1021991722 7:26147555-26147577 GGACTGTACTGCTGCCATCTCGG + Intergenic
1022005241 7:26261324-26261346 GGACTGTACTGCTGCCATCTCGG + Intergenic
1022083122 7:27044140-27044162 GGACTGTACTGCTGCCATCTCGG + Intergenic
1022187718 7:27986715-27986737 GGACTGTACTGCTGCCATCTCGG + Intronic
1022273949 7:28838251-28838273 GGACTGTACTGCTGCCATCTCGG + Intergenic
1022317930 7:29263088-29263110 GGACTGTACTGCCGCCATCTCGG + Intronic
1022700175 7:32753232-32753254 GGACTGTACAGCCACCATCTCGG + Intergenic
1022756938 7:33303567-33303589 GGACTGTACTGCCGTGATCTCGG + Intronic
1023044031 7:36196471-36196493 GGACTGTACTGCTGCCATCTTGG + Intronic
1023160426 7:37292007-37292029 GGACGGTACTGCTGCCATCTCGG + Intronic
1024259995 7:47566978-47567000 GGAGTGTAGTGGTGCCATCTTGG - Intronic
1024309688 7:47958881-47958903 GGACTGTACTGCTGCCATCTCGG + Intronic
1024538540 7:50459016-50459038 GGACTGTACTGCTGCCATCTCGG + Intronic
1024625666 7:51207489-51207511 GGACGGTACTGCTGCCATCTCGG + Intronic
1024931438 7:54668659-54668681 GGACTGTACTGCTGCCATCTCGG - Intergenic
1024989367 7:55221115-55221137 GGACTGTACTGCTGCCATCTCGG - Intronic
1025000428 7:55311281-55311303 GGACTGTACTGCTGCCATCTCGG + Intergenic
1025011785 7:55403379-55403401 GGACTGTACTGCTGCCATCTCGG - Intronic
1025090374 7:56057828-56057850 GGAGTGTAGTGGTGCCATCTTGG - Intronic
1025095963 7:56095546-56095568 GGACTGCAGTGGTGCCATCTTGG + Intergenic
1025250044 7:57345721-57345743 GGACTGCAATGGTGCCATCTCGG + Intergenic
1025573156 7:62600585-62600607 GGACTGTACTGCTGCCATCTCGG - Intergenic
1025719611 7:63998173-63998195 GGAAGGCATTGGTGCCATCTAGG + Intergenic
1025775009 7:64553645-64553667 GGACTGTACTGCCGCCATCTCGG + Intronic
1025793512 7:64717383-64717405 GGACTGTACTGCTGCCATCTCGG + Intergenic
1025796178 7:64739502-64739524 GGACTGTGCTGCTGCCATTTCGG - Intergenic
1025800673 7:64784170-64784192 GGACTGTACTGCTGCCATCTCGG + Intergenic
1025803824 7:64810383-64810405 GGACTGTACTGCTGCCATCTCGG - Intronic
1025808119 7:64855581-64855603 GGACTGTACTGCTGCCATCTCGG + Intergenic
1025821793 7:64969006-64969028 GGACTGTACTGCTGCCATCTCGG - Intergenic
1025852680 7:65257453-65257475 GGACTGTACTGCTGCCATCTCGG + Intergenic
1025979678 7:66395008-66395030 GGACGGTACTGCTGCCATCTCGG - Intronic
1026161303 7:67871216-67871238 GGAGTGCACTGGTGCCATCTTGG + Intergenic
1026234469 7:68514258-68514280 GGAGTGTAGTGGTGCCATCTCGG + Intergenic
1026687028 7:72519993-72520015 GGACTGCAGTGGTGCCATCTCGG + Intergenic
1026783609 7:73285250-73285272 GGACTGTACTGCTGCCATCTCGG - Intergenic
1026791747 7:73337362-73337384 GGAGTGTACTGGCGCCATCTCGG + Intronic
1026862238 7:73798018-73798040 GGACGGTACTGCTGCCATCTCGG - Intergenic
1026868057 7:73835283-73835305 GGACTGTACTGCTGCCATCTCGG + Intronic
1027183105 7:75953255-75953277 GGACTGTACTGCTGCCATCTCGG - Intronic
1027826664 7:83124814-83124836 GGACTGTACTGCTGCGATCTCGG + Intronic
1028227613 7:88267330-88267352 GGACTGTACTGCTGCCATCTCGG - Intergenic
1028548002 7:92026383-92026405 GGACTGTACTGCCGTGATCTCGG + Intronic
1028595822 7:92545748-92545770 GGACTGTAATGCCGCCATCTCGG - Intergenic
1028679400 7:93507870-93507892 GGAGTGTAGTGGTGCCATCTCGG - Intronic
1029014304 7:97298969-97298991 GGACAGAACTGCTGGCTTCTGGG + Intergenic
1029149254 7:98468469-98468491 GGAGGGCAGTGGTGCCATCTCGG + Intergenic
1029334743 7:99889145-99889167 GGACTGTACTGCTGCCATCTCGG - Intronic
1029430289 7:100524502-100524524 GGACTGTGCTGCTGCCATCTCGG - Intergenic
1029469131 7:100742792-100742814 GGACTGTACTGCTGCCATCTCGG - Intronic
1029525559 7:101091847-101091869 GGACTGTACTGCTGCCATCTCGG + Intergenic
1029569473 7:101360232-101360254 GGACTGTACTGCTGCCATCTCGG - Intergenic
1029851838 7:103469665-103469687 GGAGTGTAGTGGTGCCATCTTGG + Intergenic
1030036473 7:105411681-105411703 GGACTGTACTGCTGCCATCTCGG - Intergenic
1030329218 7:108255226-108255248 GGACTGTACTGCCGCCATCTCGG + Intronic
1030602584 7:111609369-111609391 GGACTGTACTGCTGCCATCTCGG + Intergenic
1030692544 7:112551078-112551100 GGACTGTACTGCTGCCATCTCGG + Intergenic
1030725552 7:112922015-112922037 GGACTGTACTGCTGCCATCTCGG + Intronic
1030990013 7:116288501-116288523 GGAGGGCAGTGGTGCCATCTCGG + Intronic
1031596313 7:123653653-123653675 GGAGGGCAGTGGTGCCATCTTGG + Intergenic
1032028507 7:128462923-128462945 GGACTGTACTGCTGCGATCTCGG + Intergenic
1032043057 7:128577628-128577650 GGACTGTACTGCTGCCATCTCGG - Intergenic
1032290933 7:130590315-130590337 GGACTGTGCTGCTGCCATCTCGG + Intronic
1032558699 7:132865241-132865263 GTACCTAACTGCTGCCATCTCGG + Intronic
1032569390 7:132984122-132984144 GGACTGTACTGCTGCCATCTCGG + Intronic
1032835165 7:135665950-135665972 GGAGTGCACTGGTGCCATCTTGG + Intronic
1033163794 7:139020555-139020577 GGAGTGTACTGCTGCAATCTTGG - Intergenic
1033173031 7:139100902-139100924 GGACTGTACTGCTGCCATCTCGG + Intronic
1033219901 7:139520984-139521006 GGACTGTGCTGCTGCCATCTCGG - Intergenic
1033293912 7:140114227-140114249 GGACTGTACTGCCGCCATCTCGG + Intronic
1033323605 7:140361608-140361630 GGACGGTACTGCTGCCATCTCGG + Intronic
1033332965 7:140431038-140431060 GGACTGTGCTGCTGCCATCTCGG + Intergenic
1033565547 7:142574984-142575006 GGACTGTACTGCCGCCATCTCGG + Intergenic
1034034292 7:147802712-147802734 GGACTGTACTGCTGCCATCTCGG - Intronic
1034233821 7:149553603-149553625 GGACTGTACTGCTGCCACCTTGG + Intergenic
1034322352 7:150197914-150197936 GGACTGTACTGCTGCCATCTCGG + Intergenic
1034328943 7:150265641-150265663 GGAGTGTAATGGTGCCATCTCGG - Intronic
1034539902 7:151750828-151750850 GGAGTGTAGTGGTGCCATCTTGG - Intronic
1034639012 7:152587169-152587191 GGACGGTACTGCTGCCATCTCGG - Intergenic
1034669105 7:152844106-152844128 GGAGTGTAATGGTGCCATCTCGG + Intronic
1034723702 7:153316095-153316117 GGACTGTACTGCTGCCATCTCGG - Intergenic
1034961972 7:155368370-155368392 GGACTGTACTGCTGCGATCTCGG - Intergenic
1035609192 8:948903-948925 GGGCGTGACTGCCGCCATCTTGG + Intergenic
1036095839 8:5724778-5724800 GGACTGTACTGCTGCCATCTCGG + Intergenic
1036172844 8:6506946-6506968 GGATTGTACTGGTGCGATCTCGG + Intronic
1036245019 8:7108666-7108688 GGAGTGTAGTGGTGCCATCTCGG - Intergenic
1036483130 8:9154812-9154834 GGACTGTACTGCTGCCATCTCGG - Intronic
1036737052 8:11329373-11329395 GGACTGTACTGCTGCCATCTCGG + Intergenic
1037141042 8:15521092-15521114 GCACTGTCCTGCTGCCATCCAGG - Intronic
1037466290 8:19163648-19163670 GGAGTGTAATGGTGCCATCTTGG - Intergenic
1037756420 8:21712943-21712965 GGACTGTACTGCTGCCATCTCGG - Intronic
1038159825 8:25025878-25025900 GGAGCGCACTGGTGCCATCTTGG - Intergenic
1038160527 8:25032874-25032896 GGAGTGTAATGGTGCCATCTCGG - Intergenic
1038167814 8:25102493-25102515 GGACTCTACTGCCGCCATCTCGG + Intergenic
1038551446 8:28472692-28472714 GGAGTGTAATGGTGCCATCTCGG - Intronic
1038745035 8:30247819-30247841 GGACGGTACTGCTGCCATCTCGG - Intergenic
1039072427 8:33659159-33659181 GGACTGTACTGCTGCCATCTCGG - Intergenic
1039153548 8:34530132-34530154 GGACTGTACTGCTGCCATCTCGG - Intergenic
1039201164 8:35095011-35095033 GGACTGTACTGCTGCCATCTTGG - Intergenic
1039488049 8:37927183-37927205 GGACTGTACTGCTGCCATCTCGG + Intergenic
1039881347 8:41627202-41627224 GGACTGTACTGCTGCCATCTCGG - Intergenic
1039977143 8:42376886-42376908 GTACGGGACTGCTGACAGCTGGG - Intronic
1040043670 8:42940418-42940440 GGACTGTACTGCTGCCATCTCGG - Intronic
1040053011 8:43033911-43033933 GGACTGTACTGCTGCCATCTCGG - Intronic
1040070170 8:43181029-43181051 GGACGGTACTGCTGCCATCTCGG - Intronic
1040121486 8:43688576-43688598 GGACTGTACTGCTGCCATCTCGG - Intergenic
1040409177 8:47137552-47137574 GGACTGTACTGCCGTGATCTCGG + Intergenic
1040616404 8:49042227-49042249 GGACTGTACTGCCGCAATCTCGG - Intergenic
1040785339 8:51158510-51158532 GGACTGTACTGCTGCCATCTCGG + Intergenic
1040818491 8:51533553-51533575 GGACGGTACTGCTGCCATCTCGG + Intronic
1041066121 8:54085060-54085082 GGACTGTACTGCCGCCATCTCGG + Intronic
1041270643 8:56105547-56105569 GGACTGTACTGCTGCCATCTCGG - Intergenic
1041287149 8:56272919-56272941 GGACGGTACTGCTGCCATCTCGG - Intergenic
1041357893 8:57021293-57021315 GGACTGTACTGCTGCCATCTCGG + Intergenic
1041513737 8:58677185-58677207 GGACTGTACTGCTGCCATCTCGG - Intergenic
1041796819 8:61754007-61754029 GGACTGTACTGCTGCCATCTCGG - Intergenic
1041921006 8:63180910-63180932 GGACGGTACTGCTGCCATCTCGG - Intronic
1042133860 8:65616192-65616214 GGACTGTACTGCTGCCATCTCGG + Intronic
1042139179 8:65662157-65662179 GGACTGTACTGCTGCCATCTCGG + Intronic
1042195909 8:66231722-66231744 GGACTGTACTGCTGCCACCTCGG + Intergenic
1042290890 8:67168233-67168255 GGACTGTACTGCTGCCATCTCGG - Intronic
1042303386 8:67310167-67310189 GGACTGTACTGCTGCCATCTCGG + Intronic
1042475526 8:69245077-69245099 GGACTATACTGCTGCCATCTCGG + Intergenic
1043928242 8:86061797-86061819 GGATGGGACTGCAGTCATCTGGG - Intronic
1043958698 8:86390630-86390652 GGACTGTGCTGCCGCCATCTCGG - Intronic
1043961756 8:86424741-86424763 GGACTGTACCGCTGCCATCTCGG - Intronic
1043986171 8:86695233-86695255 GGACTGTACTGCTGCCATCTCGG - Intronic
1044597351 8:93971349-93971371 GGACTGTACTGCCGCCATCTCGG - Intergenic
1044969286 8:97604414-97604436 GGACTGTACTGCCGCCATCTCGG + Intergenic
1045022057 8:98052453-98052475 GGTCTCTACTGCCGCCATCTCGG - Intergenic
1045118293 8:99007768-99007790 GGAGTGTACTGGTGCGATCTCGG + Intergenic
1045120603 8:99029712-99029734 GGACTGTACTGCTGCCATCTCGG - Intronic
1045235644 8:100350818-100350840 GGACTATACTGCCACCATCTCGG + Intronic
1045316618 8:101049021-101049043 GGAGGCCACTGCAGCCATCTGGG - Intergenic
1046286745 8:112103229-112103251 GAACTGTCCTGCTGCCATCCAGG + Intergenic
1046636114 8:116678049-116678071 GGACGGTACTGCTGCCATCTCGG + Intronic
1046941973 8:119940164-119940186 GGAGTGTAATGGTGCCATCTTGG - Intronic
1047109399 8:121772196-121772218 GGACTGCAATGCTGCGATCTCGG - Intergenic
1047388752 8:124432767-124432789 GGACGGTACTGCTGCCATCTCGG - Intergenic
1048368222 8:133756966-133756988 GGACTGTGCTGCTGCCATCTCGG + Intergenic
1048464152 8:134650171-134650193 GGAGTGTAGTGGTGCCATCTTGG + Intronic
1048868931 8:138781431-138781453 GGAGGGTGCTGCTGGCATCTAGG - Intronic
1049177571 8:141203086-141203108 GGACTGTACTGCTGCCATCTCGG - Intergenic
1049481767 8:142827745-142827767 GGACTGTACTGCCGCGATCTCGG - Intergenic
1049485462 8:142856913-142856935 GGACTGTACTGCTGCCATCTCGG - Intronic
1049626588 8:143625803-143625825 GGAGTGCACTGGTGCCATCTTGG + Intergenic
1049892559 9:83851-83873 GGACGGTACTGCTGCCATCTCGG - Intergenic
1049958437 9:714408-714430 GGAGGGTGGTGGTGCCATCTCGG + Intronic
1049976156 9:862437-862459 GGACTGTGCTGCCGCCATCTCGG - Intronic
1050435483 9:5605422-5605444 GGAGGGCAGTGGTGCCATCTTGG - Intergenic
1050534767 9:6622301-6622323 GGACTGTGCTGCTGCCATCTTGG + Intronic
1050557216 9:6799501-6799523 GGACTGTGCTGCTGCCATCTTGG - Intronic
1050717289 9:8544215-8544237 GGAGGGCAGTGGTGCCATCTTGG + Intronic
1050862185 9:10449099-10449121 GGACTGTACTGCCGCCATCTCGG + Intronic
1051150602 9:14074890-14074912 GGACGGCAGTGGTGCCATCTTGG - Intergenic
1051257903 9:15233415-15233437 GGACTGTACTGCTGCCATCTGGG + Intronic
1051276702 9:15405896-15405918 GGACTGTACTGCTGCCATCTCGG + Intergenic
1051281202 9:15443107-15443129 GGACTGTACTGCCGCCATCTCGG - Intronic
1051430789 9:16978267-16978289 GGACAGTACTGCTGCCATCTGGG - Intergenic
1051662042 9:19434709-19434731 GGACTATACTGCTGCCATCTCGG - Intronic
1051778220 9:20659167-20659189 GGAGGGCAGTGGTGCCATCTTGG - Intronic
1052236357 9:26215833-26215855 GGACTGTACTGCTGCAATCTCGG - Intergenic
1052274678 9:26663717-26663739 GGACTGTACTGCTGCGATCTCGG + Intergenic
1052338484 9:27342526-27342548 GGACTGTACTGCCGCCATCTTGG + Intronic
1052492994 9:29189948-29189970 GGACTGTACTGCTGCCATCTCGG - Intergenic
1052880892 9:33600347-33600369 GGACTGTACTGCCGCCATCTCGG + Intergenic
1052928536 9:34038342-34038364 GGACTGTACTGCCGCCATCTCGG + Intronic
1053047960 9:34936128-34936150 GGACTGTACTGCCGCCATCTCGG + Intergenic
1053233033 9:36427759-36427781 GGAGGGTAGTGGTGCGATCTTGG + Intronic
1053467850 9:38324095-38324117 GGACTGTACTGCTGCCATCTCGG + Intergenic
1053621847 9:39827568-39827590 GGAAGGGACTGCAGCCAGCTTGG - Intergenic
1053837780 9:42159426-42159448 GGAAGGGACTGCAGCCAGCTTGG - Intergenic
1053858968 9:42366355-42366377 GGAGTGTAGTGGTGCCATCTTGG - Intergenic
1053883238 9:42616704-42616726 GGAAGGGACTGCAGCCAGCTTGG + Intergenic
1053889431 9:42677595-42677617 GGAAGGGACTGCAGCCAGCTTGG - Intergenic
1054222262 9:62424177-62424199 GGAAGGGACTGCGGCCAGCTTGG + Intergenic
1054228451 9:62484995-62485017 GGAAGGGACTGCGGCCAGCTTGG - Intergenic
1054359566 9:64100407-64100429 GGACTGTACTGCCGCCATCTCGG + Intergenic
1055134091 9:72807189-72807211 GGACTGTACTGCTGCCATCTCGG - Intronic
1055137704 9:72842297-72842319 GGACTGTACTGCTGCCATCTCGG - Intergenic
1055241930 9:74196904-74196926 GGACTGTACTGCTGCCATCTCGG + Intergenic
1055506523 9:76954923-76954945 GGACTGTACTGCTGCCATCTCGG + Intergenic
1055519039 9:77061539-77061561 GGACTGTACTGCTGCCATCTCGG - Intergenic
1055580715 9:77703758-77703780 GGACTGTACTGCCGCCATCTTGG - Intergenic
1055585895 9:77760266-77760288 GGACTGTACTGCTGCCATCTCGG + Intronic
1055948112 9:81709610-81709632 GGACTGTACTGCTGCCATCTCGG + Intergenic
1056097658 9:83272163-83272185 GGACTGTACTGCCGCCATCTTGG + Intronic
1056152342 9:83803312-83803334 GGACTGTACTGCTGCCATCTCGG + Intronic
1056166648 9:83947573-83947595 GGACCGTACTGCCGCCATCTCGG + Intronic
1056336285 9:85573163-85573185 GGACTGTACTGCTGCCATCTCGG + Intronic
1056409437 9:86311679-86311701 GGACTGTACCGCTGCCATCTCGG + Intronic
1056470454 9:86900521-86900543 GGAGTGTAGTGCCGCCATCTCGG - Intergenic
1056483630 9:87031944-87031966 GGAGTGCACTGATGCCATCTTGG - Intergenic
1056564567 9:87759830-87759852 GGACTGTACTGCTGCCATCTCGG - Intergenic
1056625022 9:88245879-88245901 GGACTGTACTGCTGCCATCTCGG - Intergenic
1056649165 9:88443067-88443089 GGAGGGCAGTGGTGCCATCTTGG - Intronic
1056670709 9:88625551-88625573 GGACTGTACTGCTGCCATTTCGG + Intergenic
1056995545 9:91454181-91454203 GGAGTGTAGTGGTGCCATCTTGG - Intergenic
1057155260 9:92832395-92832417 GGACGGTACTGCTGCCATCTTGG - Intergenic
1057630646 9:96716451-96716473 GAACTGTACTGCCGCCATCTCGG - Intergenic
1057716334 9:97498829-97498851 GGACTGTAGTGCCGCCATCTCGG - Intergenic
1058018690 9:100067250-100067272 GGACTGTACTGCTGCCATCTCGG + Intronic
1058244345 9:102604206-102604228 GGACTGTGCTGCTGCGATCTCGG - Intergenic
1058390563 9:104490515-104490537 GGACTGTACTGCCGCCATCTCGG - Intergenic
1058452549 9:105110656-105110678 GGACTGTAGTGGCGCCATCTTGG - Intergenic
1058660114 9:107258433-107258455 GGACTGTACTGCTGCCATCTCGG - Intergenic
1058722353 9:107775426-107775448 GGACTGTACTGCTGCCATCTCGG + Intergenic
1058899096 9:109425961-109425983 GGAGTGTAGTGGTGCCATCTTGG - Intronic
1058972783 9:110098097-110098119 GGACTGTACTGCTGCCATCTCGG - Intronic
1059120619 9:111639996-111640018 GGACTGTACTGCTGCCATCTCGG + Intronic
1059707939 9:116841313-116841335 GGACGGTACTGCTGCCATCTCGG - Intronic
1059880099 9:118678983-118679005 GGACTGTACTGCCGCCATCTCGG - Intergenic
1060334660 9:122710848-122710870 GGACTGTACTGCTGCCATCTTGG + Intergenic
1060349936 9:122851556-122851578 GGACTATACTGCTGCCATCTCGG + Intronic
1060351630 9:122866464-122866486 GGACTGTACTGCTGCCATCTCGG + Intronic
1060369815 9:123057989-123058011 GGACTGTGCTGCTGCCGTCTCGG - Intronic
1060471282 9:123950615-123950637 GGAGGGCAGTGGTGCCATCTCGG - Intergenic
1060651286 9:125329059-125329081 GGACTGTACTGCTGCCATCTTGG - Intronic
1060669940 9:125459751-125459773 GGACTGTACTGCTGCCATCTCGG - Intronic
1060686890 9:125622866-125622888 GGACTGTACTGCTGCCATCTCGG + Intronic
1061142935 9:128779577-128779599 GGACTGTACTGCTGCCATCTCGG + Intergenic
1061427297 9:130507292-130507314 GGACTGTACTGCTGCCATCTCGG - Intergenic
1061533506 9:131232957-131232979 AGACGGTAGTGGTACCATCTTGG - Intronic
1061750835 9:132776017-132776039 GGCCGGTGCTGCTGCTTTCTCGG - Intronic
1061977156 9:134075219-134075241 GGACTGTACTGCTGCCATCTCGG + Intergenic
1062167585 9:135115617-135115639 GGAAAGTGCTGCTGGCATCTAGG - Intronic
1062483040 9:136761309-136761331 GGACTGTAATGGTGCAATCTCGG + Intronic
1203464176 Un_GL000220v1:69285-69307 GGATGGTACTGCTGCCATCTCGG - Intergenic
1203562478 Un_KI270744v1:70836-70858 GGACTGTACTGCTGCCATCTCGG + Intergenic
1203634548 Un_KI270750v1:97944-97966 GGACTGTACTGCTGCCATCTCGG - Intergenic
1185522597 X:752737-752759 GGAGGGCAGTGGTGCCATCTCGG + Intergenic
1185781651 X:2853063-2853085 GGAGGGCAGTGGTGCCATCTCGG + Intronic
1186408953 X:9328968-9328990 GGAGTGTAGTGGTGCCATCTTGG - Intergenic
1186786732 X:12962701-12962723 GGACTCTACTGCTGCCATCTCGG + Intergenic
1186923109 X:14303396-14303418 GGACTGTACTGCTGCCATCTCGG - Intergenic
1187061214 X:15789191-15789213 GGAGGGCAGTGGTGCCATCTCGG + Intergenic
1187183857 X:16966046-16966068 GGACAGTACTGCTGCCATCTCGG - Intronic
1187184477 X:16969662-16969684 GGACTGTACTGCTGCCATCTTGG - Intronic
1187336239 X:18384594-18384616 GGAGTGTAATGCTGCAATCTCGG - Intergenic
1187880871 X:23846258-23846280 GGAGTGTAATGGTGCCATCTTGG - Intronic
1188368132 X:29335199-29335221 GGACGGTACTGCTGCCATCTCGG - Intronic
1188476932 X:30601562-30601584 GGACTGTACTGCTGCCATCTTGG + Intergenic
1188492847 X:30754702-30754724 GGACTGTACTGCTGCCATCTCGG - Intergenic
1189057018 X:37708142-37708164 GGACTGTACTGCTGCCATCTCGG - Intronic
1189210046 X:39276948-39276970 GGACTGTACTGCTGCCATCTCGG + Intergenic
1189442679 X:41051177-41051199 GGAGTGCAGTGCTGCCATCTTGG - Intergenic
1189505710 X:41611758-41611780 GGACTGTACTGCTGCCAACTCGG + Intronic
1189587424 X:42474909-42474931 GGACTGTACTGCTGCCATCTCGG - Intergenic
1189838227 X:45042188-45042210 GGACGGTACTGCTGCCATCTCGG - Intronic
1189955644 X:46274779-46274801 GGACTGTACTGCTGCCATCTCGG + Intergenic
1189968761 X:46396935-46396957 GGACTGTGCTGCTGCCATCTCGG - Intergenic
1190029254 X:46956113-46956135 GGAGTGTAGTGGTGCCATCTTGG + Intronic
1190095441 X:47476300-47476322 GGAGCGTAGTGGTGCCATCTCGG - Intronic
1190158896 X:48016364-48016386 GGACTGTACTGCCGCCATCTCGG + Intronic
1190171352 X:48114701-48114723 GGACTGTGCTGCTGCCATCTCGG + Intergenic
1190174593 X:48138629-48138651 GGACTGTACTGCCGCCATCTCGG + Intergenic
1190184383 X:48221848-48221870 GGACTGTACTGCTGCCATCTCGG + Intronic
1190241544 X:48660504-48660526 GGACTGTGCTGCTGCCATCTCGG - Intergenic
1190505425 X:51120423-51120445 GGACTGTACTGCCGCCATCTCGG - Intergenic
1190520955 X:51279356-51279378 GGACTGTACTGCTGCCATCTCGG + Intergenic
1190681081 X:52827713-52827735 GGACTGTACTGCTGCCATCTCGG - Intergenic
1190769461 X:53503467-53503489 GGACTGTACTGCCACCATCTCGG + Intergenic
1190778807 X:53577578-53577600 GGACGGTACTGCTGCCATCTCGG + Intronic
1190793471 X:53721197-53721219 GGACTGTACTGCCACCATCTCGG + Intergenic
1190820149 X:53966291-53966313 GGACTGTACTGCTGCCATCTCGG + Intronic
1190839322 X:54129956-54129978 GGACTGTACTGTTGCCATCTCGG - Intronic
1190848388 X:54215250-54215272 GGACTGTACTGCCGCCATCTTGG + Intronic
1190891667 X:54573443-54573465 GGACTATACTGCTGCCATCTCGG - Intergenic
1191009721 X:55747927-55747949 GGACTGTACTGCTGCCATCTCGG + Intronic
1191679503 X:63826254-63826276 GGACTGTACTGCTGCCATCTCGG - Intergenic
1191828549 X:65391825-65391847 GGACTGTAATGCCGCGATCTTGG + Intronic
1191835209 X:65456498-65456520 GGACGGTACTGCTGCCATCTCGG + Intronic
1191894340 X:65975980-65976002 GGACTGTACTGCCGCCATCTCGG - Intergenic
1192106837 X:68325925-68325947 GGACGGTACTGCTGCCATCTCGG + Intronic
1192353054 X:70372579-70372601 GGACTGTACTGCTGCCATCTTGG - Intronic
1192464236 X:71342466-71342488 GGACTGTACTGCTGCCATCTCGG - Intergenic
1192477161 X:71452997-71453019 GGACTGTGCTGCTGCCATCTCGG - Intronic
1192530389 X:71877681-71877703 GGACTGTACTGCCGCCATCTCGG - Intergenic
1192547857 X:72028507-72028529 GGAAGGACCTGCTGCCATATTGG - Intergenic
1192567541 X:72178002-72178024 GGACGGTGCTGCTGCCATCTCGG + Intergenic
1192610099 X:72559131-72559153 GGACTGTACTGCCACCATCTCGG + Intronic
1192739770 X:73881746-73881768 CGACTGTACTGCCACCATCTCGG + Intergenic
1192761152 X:74097829-74097851 GGACTGTACTGCCGCCATCTCGG + Intergenic
1192768364 X:74165770-74165792 GGACTGTACTGCTGCCATCTCGG + Intergenic
1192794308 X:74413289-74413311 GGACTGTACTGCTGCCATCTCGG - Intergenic
1192813664 X:74569752-74569774 GGACTGTACTGCCGCCATCTCGG - Intergenic
1192970060 X:76219146-76219168 GGACTGTACTGCTGCCATCTCGG - Intergenic
1193067913 X:77278762-77278784 GGACTGTACTGCTGCCATCTCGG + Intergenic
1193115009 X:77767156-77767178 GGACTGTACTGCTGCCATCTCGG - Intronic
1193132571 X:77932841-77932863 GGACTGTACTGCTGCCATCTCGG - Intronic
1193164779 X:78266376-78266398 GGACTGTACTGCTGCCATCTCGG - Intergenic
1193345418 X:80397865-80397887 GGACTGTACTGCTGCCATCTCGG - Intronic
1193362042 X:80590448-80590470 GGACTGTACTGCTGCCATCTCGG + Intergenic
1193372198 X:80712208-80712230 GGACTGTACTGCTGCCATCTCGG + Intronic
1194120848 X:89961915-89961937 GGAAAGTCCTACTGCCATCTAGG + Intergenic
1194181054 X:90713168-90713190 GGACTGTACTGCCGCCATCTCGG + Intergenic
1194714835 X:97276213-97276235 GGACTGTACTGCTGCCATCTCGG - Intronic
1195009657 X:100723179-100723201 GGACTGTACTGCTGCCATCTCGG + Intronic
1195081332 X:101373992-101374014 GGAATGCACTGGTGCCATCTTGG - Intronic
1195257689 X:103105216-103105238 GGCCTGTACTGCTGCCATCTCGG - Intergenic
1196214915 X:113039240-113039262 GGAGTGCACTGGTGCCATCTCGG + Intergenic
1196778379 X:119361455-119361477 GGACTGTACTGCTGCCATCTCGG + Intergenic
1197452788 X:126640813-126640835 GGACTGTACTGCTGCCATCTCGG + Intergenic
1197735765 X:129849841-129849863 GGACTGTACTGCTGCCATCTCGG + Intergenic
1197819415 X:130529915-130529937 AGACGGTGGTGCTGCCATCCAGG - Intergenic
1198189275 X:134286646-134286668 GGACTGTACTGCCGCCATCTCGG - Intergenic
1198246704 X:134838753-134838775 GGACTGTACTGCTGCCATCTCGG + Intronic
1198260283 X:134959799-134959821 GGACTGTACTGCTGCCATCTCGG + Intergenic
1198476725 X:137001604-137001626 GGACTGTACTGCTGCCATCTCGG - Intergenic
1198600944 X:138283387-138283409 GGACTGTACTGCCGCCATCTCGG - Intergenic
1198830442 X:140744618-140744640 GGAGGGTAGTGGTGCGATCTTGG + Intergenic
1199230818 X:145435686-145435708 GGACTGTACTGCTGCCATCTCGG + Intergenic
1199452869 X:147993342-147993364 GGACTGTACTGCTGCCATCTCGG - Intronic
1199586280 X:149420198-149420220 GGACTGTACTGCTGCCATCTCGG + Intergenic
1200387564 X:155908475-155908497 GGACTGTACTACTGCTATCTCGG - Intronic
1200473714 Y:3619420-3619442 GGAAAGTCCTACTGCCATCTAGG + Intergenic
1200527675 Y:4295057-4295079 GGACTGTACTGCCGCTGTCTTGG + Intergenic
1201335648 Y:12878192-12878214 GGACTGTACTGCTGCCATCTCGG + Intergenic
1201440388 Y:14001498-14001520 GGACTGTACTGCCGCCATCTCGG - Intergenic
1201444183 Y:14041210-14041232 GGACTGTACTGCCGCCATCTCGG + Intergenic
1201948174 Y:19535259-19535281 GGACTGTACTGCCGCCATCTCGG + Intergenic