ID: 1169248036

View in Genome Browser
Species Human (GRCh38)
Location 20:4039108-4039130
Sequence CTGTGGGCCTGGAATCATGC AGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 4 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1169248030_1169248036 5 Left 1169248030 20:4039080-4039102 CCATTCAAAACAGATAAATAGAG No data
Right 1169248036 20:4039108-4039130 CTGTGGGCCTGGAATCATGCAGG No data
1169248027_1169248036 16 Left 1169248027 20:4039069-4039091 CCCTTTGGATCCCATTCAAAACA No data
Right 1169248036 20:4039108-4039130 CTGTGGGCCTGGAATCATGCAGG No data
1169248028_1169248036 15 Left 1169248028 20:4039070-4039092 CCTTTGGATCCCATTCAAAACAG No data
Right 1169248036 20:4039108-4039130 CTGTGGGCCTGGAATCATGCAGG No data
1169248029_1169248036 6 Left 1169248029 20:4039079-4039101 CCCATTCAAAACAGATAAATAGA No data
Right 1169248036 20:4039108-4039130 CTGTGGGCCTGGAATCATGCAGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1169248036 Original CRISPR CTGTGGGCCTGGAATCATGC AGG Intergenic
No off target data available for this crispr