ID: 1169248743

View in Genome Browser
Species Human (GRCh38)
Location 20:4044574-4044596
Sequence GGGCCATCTCAGGGGAACAG GGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 6 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1169248743_1169248754 9 Left 1169248743 20:4044574-4044596 CCCCTGTTCCCCTGAGATGGCCC No data
Right 1169248754 20:4044606-4044628 AGCACCCTGGTGAGATTACCGGG No data
1169248743_1169248749 -4 Left 1169248743 20:4044574-4044596 CCCCTGTTCCCCTGAGATGGCCC No data
Right 1169248749 20:4044593-4044615 GCCCTGAGTCCTCAGCACCCTGG No data
1169248743_1169248753 8 Left 1169248743 20:4044574-4044596 CCCCTGTTCCCCTGAGATGGCCC No data
Right 1169248753 20:4044605-4044627 CAGCACCCTGGTGAGATTACCGG No data
1169248743_1169248757 15 Left 1169248743 20:4044574-4044596 CCCCTGTTCCCCTGAGATGGCCC No data
Right 1169248757 20:4044612-4044634 CTGGTGAGATTACCGGGAGTAGG No data
1169248743_1169248758 19 Left 1169248743 20:4044574-4044596 CCCCTGTTCCCCTGAGATGGCCC No data
Right 1169248758 20:4044616-4044638 TGAGATTACCGGGAGTAGGCAGG No data
1169248743_1169248759 24 Left 1169248743 20:4044574-4044596 CCCCTGTTCCCCTGAGATGGCCC No data
Right 1169248759 20:4044621-4044643 TTACCGGGAGTAGGCAGGAGTGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1169248743 Original CRISPR GGGCCATCTCAGGGGAACAG GGG (reversed) Intergenic
No off target data available for this crispr