ID: 1169248748

View in Genome Browser
Species Human (GRCh38)
Location 20:4044584-4044606
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 6 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1169248748_1169248757 5 Left 1169248748 20:4044584-4044606 CCTGAGATGGCCCTGAGTCCTCA No data
Right 1169248757 20:4044612-4044634 CTGGTGAGATTACCGGGAGTAGG No data
1169248748_1169248753 -2 Left 1169248748 20:4044584-4044606 CCTGAGATGGCCCTGAGTCCTCA No data
Right 1169248753 20:4044605-4044627 CAGCACCCTGGTGAGATTACCGG No data
1169248748_1169248758 9 Left 1169248748 20:4044584-4044606 CCTGAGATGGCCCTGAGTCCTCA No data
Right 1169248758 20:4044616-4044638 TGAGATTACCGGGAGTAGGCAGG No data
1169248748_1169248754 -1 Left 1169248748 20:4044584-4044606 CCTGAGATGGCCCTGAGTCCTCA No data
Right 1169248754 20:4044606-4044628 AGCACCCTGGTGAGATTACCGGG No data
1169248748_1169248761 24 Left 1169248748 20:4044584-4044606 CCTGAGATGGCCCTGAGTCCTCA No data
Right 1169248761 20:4044631-4044653 TAGGCAGGAGTGGTGAGCTCTGG No data
1169248748_1169248759 14 Left 1169248748 20:4044584-4044606 CCTGAGATGGCCCTGAGTCCTCA No data
Right 1169248759 20:4044621-4044643 TTACCGGGAGTAGGCAGGAGTGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1169248748 Original CRISPR TGAGGACTCAGGGCCATCTC AGG (reversed) Intergenic
No off target data available for this crispr