ID: 1169248757

View in Genome Browser
Species Human (GRCh38)
Location 20:4044612-4044634
Sequence CTGGTGAGATTACCGGGAGT AGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 9 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1169248745_1169248757 13 Left 1169248745 20:4044576-4044598 CCTGTTCCCCTGAGATGGCCCTG No data
Right 1169248757 20:4044612-4044634 CTGGTGAGATTACCGGGAGTAGG No data
1169248742_1169248757 16 Left 1169248742 20:4044573-4044595 CCCCCTGTTCCCCTGAGATGGCC No data
Right 1169248757 20:4044612-4044634 CTGGTGAGATTACCGGGAGTAGG No data
1169248747_1169248757 6 Left 1169248747 20:4044583-4044605 CCCTGAGATGGCCCTGAGTCCTC No data
Right 1169248757 20:4044612-4044634 CTGGTGAGATTACCGGGAGTAGG No data
1169248748_1169248757 5 Left 1169248748 20:4044584-4044606 CCTGAGATGGCCCTGAGTCCTCA No data
Right 1169248757 20:4044612-4044634 CTGGTGAGATTACCGGGAGTAGG No data
1169248743_1169248757 15 Left 1169248743 20:4044574-4044596 CCCCTGTTCCCCTGAGATGGCCC No data
Right 1169248757 20:4044612-4044634 CTGGTGAGATTACCGGGAGTAGG No data
1169248746_1169248757 7 Left 1169248746 20:4044582-4044604 CCCCTGAGATGGCCCTGAGTCCT No data
Right 1169248757 20:4044612-4044634 CTGGTGAGATTACCGGGAGTAGG No data
1169248744_1169248757 14 Left 1169248744 20:4044575-4044597 CCCTGTTCCCCTGAGATGGCCCT No data
Right 1169248757 20:4044612-4044634 CTGGTGAGATTACCGGGAGTAGG No data
1169248751_1169248757 -6 Left 1169248751 20:4044595-4044617 CCTGAGTCCTCAGCACCCTGGTG No data
Right 1169248757 20:4044612-4044634 CTGGTGAGATTACCGGGAGTAGG No data
1169248750_1169248757 -5 Left 1169248750 20:4044594-4044616 CCCTGAGTCCTCAGCACCCTGGT No data
Right 1169248757 20:4044612-4044634 CTGGTGAGATTACCGGGAGTAGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1169248757 Original CRISPR CTGGTGAGATTACCGGGAGT AGG Intergenic
No off target data available for this crispr