ID: 1169248759

View in Genome Browser
Species Human (GRCh38)
Location 20:4044621-4044643
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 10 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1169248745_1169248759 22 Left 1169248745 20:4044576-4044598 CCTGTTCCCCTGAGATGGCCCTG No data
Right 1169248759 20:4044621-4044643 TTACCGGGAGTAGGCAGGAGTGG No data
1169248743_1169248759 24 Left 1169248743 20:4044574-4044596 CCCCTGTTCCCCTGAGATGGCCC No data
Right 1169248759 20:4044621-4044643 TTACCGGGAGTAGGCAGGAGTGG No data
1169248750_1169248759 4 Left 1169248750 20:4044594-4044616 CCCTGAGTCCTCAGCACCCTGGT No data
Right 1169248759 20:4044621-4044643 TTACCGGGAGTAGGCAGGAGTGG No data
1169248748_1169248759 14 Left 1169248748 20:4044584-4044606 CCTGAGATGGCCCTGAGTCCTCA No data
Right 1169248759 20:4044621-4044643 TTACCGGGAGTAGGCAGGAGTGG No data
1169248744_1169248759 23 Left 1169248744 20:4044575-4044597 CCCTGTTCCCCTGAGATGGCCCT No data
Right 1169248759 20:4044621-4044643 TTACCGGGAGTAGGCAGGAGTGG No data
1169248746_1169248759 16 Left 1169248746 20:4044582-4044604 CCCCTGAGATGGCCCTGAGTCCT No data
Right 1169248759 20:4044621-4044643 TTACCGGGAGTAGGCAGGAGTGG No data
1169248751_1169248759 3 Left 1169248751 20:4044595-4044617 CCTGAGTCCTCAGCACCCTGGTG No data
Right 1169248759 20:4044621-4044643 TTACCGGGAGTAGGCAGGAGTGG No data
1169248752_1169248759 -4 Left 1169248752 20:4044602-4044624 CCTCAGCACCCTGGTGAGATTAC No data
Right 1169248759 20:4044621-4044643 TTACCGGGAGTAGGCAGGAGTGG No data
1169248742_1169248759 25 Left 1169248742 20:4044573-4044595 CCCCCTGTTCCCCTGAGATGGCC No data
Right 1169248759 20:4044621-4044643 TTACCGGGAGTAGGCAGGAGTGG No data
1169248747_1169248759 15 Left 1169248747 20:4044583-4044605 CCCTGAGATGGCCCTGAGTCCTC No data
Right 1169248759 20:4044621-4044643 TTACCGGGAGTAGGCAGGAGTGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1169248759 Original CRISPR TTACCGGGAGTAGGCAGGAG TGG Intergenic
No off target data available for this crispr