ID: 1169248761

View in Genome Browser
Species Human (GRCh38)
Location 20:4044631-4044653
Sequence TAGGCAGGAGTGGTGAGCTC TGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 8 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1169248746_1169248761 26 Left 1169248746 20:4044582-4044604 CCCCTGAGATGGCCCTGAGTCCT No data
Right 1169248761 20:4044631-4044653 TAGGCAGGAGTGGTGAGCTCTGG No data
1169248756_1169248761 -3 Left 1169248756 20:4044611-4044633 CCTGGTGAGATTACCGGGAGTAG No data
Right 1169248761 20:4044631-4044653 TAGGCAGGAGTGGTGAGCTCTGG No data
1169248747_1169248761 25 Left 1169248747 20:4044583-4044605 CCCTGAGATGGCCCTGAGTCCTC No data
Right 1169248761 20:4044631-4044653 TAGGCAGGAGTGGTGAGCTCTGG No data
1169248748_1169248761 24 Left 1169248748 20:4044584-4044606 CCTGAGATGGCCCTGAGTCCTCA No data
Right 1169248761 20:4044631-4044653 TAGGCAGGAGTGGTGAGCTCTGG No data
1169248750_1169248761 14 Left 1169248750 20:4044594-4044616 CCCTGAGTCCTCAGCACCCTGGT No data
Right 1169248761 20:4044631-4044653 TAGGCAGGAGTGGTGAGCTCTGG No data
1169248751_1169248761 13 Left 1169248751 20:4044595-4044617 CCTGAGTCCTCAGCACCCTGGTG No data
Right 1169248761 20:4044631-4044653 TAGGCAGGAGTGGTGAGCTCTGG No data
1169248755_1169248761 -2 Left 1169248755 20:4044610-4044632 CCCTGGTGAGATTACCGGGAGTA No data
Right 1169248761 20:4044631-4044653 TAGGCAGGAGTGGTGAGCTCTGG No data
1169248752_1169248761 6 Left 1169248752 20:4044602-4044624 CCTCAGCACCCTGGTGAGATTAC No data
Right 1169248761 20:4044631-4044653 TAGGCAGGAGTGGTGAGCTCTGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1169248761 Original CRISPR TAGGCAGGAGTGGTGAGCTC TGG Intergenic
No off target data available for this crispr