ID: 1169250941

View in Genome Browser
Species Human (GRCh38)
Location 20:4060832-4060854
Sequence GGTAACAAGGCACCCAGGGT TGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 1 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1169250932_1169250941 23 Left 1169250932 20:4060786-4060808 CCACTTCAAAGGGACACTGCAAG No data
Right 1169250941 20:4060832-4060854 GGTAACAAGGCACCCAGGGTTGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1169250941 Original CRISPR GGTAACAAGGCACCCAGGGT TGG Intergenic
No off target data available for this crispr