ID: 1169252884

View in Genome Browser
Species Human (GRCh38)
Location 20:4073606-4073628
Sequence TCTTGGGGATGGAGGGAAGC AGG
Strand +
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 624
Summary {0: 1, 1: 0, 2: 5, 3: 52, 4: 566}

Found 4 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1169252875_1169252884 1 Left 1169252875 20:4073582-4073604 CCCTTTCCTATTTCTATGAGCTG 0: 1
1: 0
2: 1
3: 30
4: 363
Right 1169252884 20:4073606-4073628 TCTTGGGGATGGAGGGAAGCAGG 0: 1
1: 0
2: 5
3: 52
4: 566
1169252877_1169252884 -5 Left 1169252877 20:4073588-4073610 CCTATTTCTATGAGCTGTTCTTG 0: 1
1: 0
2: 1
3: 25
4: 211
Right 1169252884 20:4073606-4073628 TCTTGGGGATGGAGGGAAGCAGG 0: 1
1: 0
2: 5
3: 52
4: 566
1169252874_1169252884 2 Left 1169252874 20:4073581-4073603 CCCCTTTCCTATTTCTATGAGCT 0: 1
1: 0
2: 5
3: 36
4: 339
Right 1169252884 20:4073606-4073628 TCTTGGGGATGGAGGGAAGCAGG 0: 1
1: 0
2: 5
3: 52
4: 566
1169252876_1169252884 0 Left 1169252876 20:4073583-4073605 CCTTTCCTATTTCTATGAGCTGT 0: 1
1: 0
2: 2
3: 31
4: 550
Right 1169252884 20:4073606-4073628 TCTTGGGGATGGAGGGAAGCAGG 0: 1
1: 0
2: 5
3: 52
4: 566

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1169252884 Original CRISPR TCTTGGGGATGGAGGGAAGC AGG Intronic
900089129 1:911723-911745 TCGTGCAGAGGGAGGGAAGCAGG + Intergenic
900350077 1:2230136-2230158 TCTTGGGGTTGGGGTGAAGGTGG + Intronic
900432033 1:2607008-2607030 TCTTGGAGGTGGTGGGAGGCTGG - Exonic
900533687 1:3167012-3167034 TTCTGGGGATGGAGGGCAGTTGG - Intronic
901051802 1:6429090-6429112 TCTTGGGGAGGGAGGGAGGGAGG + Intronic
901253163 1:7797162-7797184 TCGTGGATGTGGAGGGAAGCTGG + Intronic
902811917 1:18892775-18892797 TTTTAGGGAGGGAGGGAAACTGG - Intronic
902834732 1:19039494-19039516 TCTTGGAGTTAGAAGGAAGCCGG + Intergenic
902980226 1:20117378-20117400 TCTAGGGGCTGGAGGTAAGAAGG - Intronic
903304650 1:22404233-22404255 TGAAGGGGATGGAGGGAGGCAGG + Intergenic
903350782 1:22715399-22715421 GCTGGGGGAGGGAGGGAGGCAGG - Intronic
903463404 1:23534922-23534944 ACATGGGGATGGAGGGGAGGAGG - Intergenic
903610611 1:24608989-24609011 GCTTGGAGTTGGAGGGAAGAAGG + Exonic
903976610 1:27154484-27154506 TTCTGGGGGTGGAGGGAGGCTGG + Exonic
904370798 1:30046248-30046270 TCCAGGGGAGGGAGGGCAGCTGG + Intergenic
904629429 1:31829984-31830006 GCTGTGGGAAGGAGGGAAGCAGG + Intergenic
905252900 1:36661071-36661093 GCTTGGTGAAGGAGGGCAGCAGG + Intergenic
905397123 1:37674018-37674040 TCTCTGGGAAGGAGGGAGGCGGG + Intergenic
905534437 1:38709166-38709188 TCTTGGGGTTGGAGGTGAGCTGG - Intergenic
905932526 1:41799793-41799815 GCTTGGGGTTGGGGGGAAGGGGG - Intronic
905953799 1:41975229-41975251 TGTGGGGGAATGAGGGAAGCAGG - Intronic
905998394 1:42402021-42402043 TCAGCGGGATGGCGGGAAGCTGG + Intronic
906125589 1:43425249-43425271 TCTAGGGGATGGTGGGGAGAAGG - Intronic
906147353 1:43567890-43567912 TCCTGGGGAAGGCGGGGAGCTGG - Intronic
907215034 1:52855568-52855590 GCTTAGGGCTGGAGGGATGCGGG - Intronic
907321150 1:53603162-53603184 GCTTTGGGAGGGAGGGAAGGGGG + Intronic
907332817 1:53682354-53682376 TCGCGGGGATGCAGGGATGCAGG - Intronic
907449954 1:54539530-54539552 GCTTGGGGATGTGGGGAAGTGGG + Intergenic
907455922 1:54575406-54575428 CCTTGGGGGTGGAGGGAGGCAGG + Intronic
907718621 1:56951028-56951050 TGTTGGGGAGGAAGGGAAGGAGG + Intronic
908798410 1:67853959-67853981 GCTTGGTGATGGCAGGAAGCAGG - Intergenic
909418541 1:75435194-75435216 TTTTGGGGATGGAGGTAGCCTGG - Intronic
913231444 1:116743690-116743712 TCTTGTGATTGGAGGGATGCAGG + Intergenic
913486563 1:119337092-119337114 GCTTGGGTGGGGAGGGAAGCTGG - Intergenic
913960653 1:143336122-143336144 TCTGGGGAAGGGAGAGAAGCCGG + Intergenic
914055007 1:144161694-144161716 TCTGGGGAAGGGAGAGAAGCCGG + Intergenic
914124139 1:144804667-144804689 TCTGGGGAAGGGAGAGAAGCCGG - Intergenic
914846986 1:151288869-151288891 CCATGGAGATGGGGGGAAGCAGG + Intronic
915012168 1:152697988-152698010 ACTTGGGGATGGGAAGAAGCTGG + Intergenic
915144861 1:153790465-153790487 TGTTGGAGAGGGAGGGAAGGAGG + Intergenic
915268241 1:154733818-154733840 TGTTGGGGATGAAGGGAGGGAGG - Intronic
915491218 1:156250995-156251017 TCCTGGGGATGGGGGGCAGAGGG + Exonic
916197984 1:162242869-162242891 TCTTCGGGAAGGAGGGGCGCGGG + Intronic
916784864 1:168079255-168079277 TCTTGGGCATGGTGAGAAGTAGG + Intergenic
917084214 1:171289732-171289754 TCTTGGGGAAGCAGGGAGACAGG - Intergenic
917485156 1:175448861-175448883 TTTTTGGCATGGAGGGAAGCAGG - Intronic
917788852 1:178486901-178486923 CCTTGGGGCTGGAGGGCCGCTGG + Intergenic
918162580 1:181915089-181915111 CCTGGGGGATGGAGGTAACCAGG + Intergenic
918820504 1:189249486-189249508 TCCTGGGGCTGGTGGGAACCAGG + Intergenic
919144283 1:193613787-193613809 GCTTGTGGAAGTAGGGAAGCTGG + Intergenic
919241603 1:194923094-194923116 TCTTGGGGAAGGATGGGAGAAGG - Intergenic
919310155 1:195896650-195896672 AGTTGGGGATGAAGGCAAGCAGG + Intergenic
920074628 1:203327322-203327344 TCGTGGGGATTGAGGGACGTGGG - Intergenic
920528229 1:206684509-206684531 TCGTGGGGGTGGGGGGGAGCTGG - Intergenic
920703295 1:208233856-208233878 TGCTGTGGATGGAGGAAAGCTGG + Intronic
921090441 1:211836854-211836876 ACGTGGGGAGGGAGGGGAGCAGG - Intergenic
921985129 1:221304603-221304625 TGTTGGGGATGGTGGGGAGGTGG + Intergenic
922551665 1:226498698-226498720 TCTTGGGGACAGAGGGATGGAGG - Intergenic
922574335 1:226652158-226652180 GCTGGGGGAAGGAGGGAAGGAGG + Intronic
923116896 1:230948784-230948806 TCTAGGGTATGAAGTGAAGCTGG - Intronic
923284499 1:232479638-232479660 TGTTGGGCATGTAGGGAAGCAGG + Exonic
923435729 1:233966077-233966099 TCTTGTGGGTGGAGGCAGGCTGG - Intronic
924536126 1:244937218-244937240 TGTGGGGGATGGAGGGATGGAGG + Intergenic
924546341 1:245031316-245031338 TCTTGCAGATAGAGGGGAGCTGG + Intronic
1062862048 10:817803-817825 TCCAGGTAATGGAGGGAAGCTGG + Exonic
1062951679 10:1508221-1508243 TCCTGGGGATGGATGGAGGTCGG - Intronic
1064137571 10:12764028-12764050 TCCTGGGGGAGGAGGGAAGACGG - Intronic
1064653912 10:17537543-17537565 TCCTGGGGGTGAAGGGAAACAGG + Intergenic
1064896212 10:20240075-20240097 ACTTGAGGATAGAGGGAGGCAGG - Intronic
1066462696 10:35625441-35625463 ACTTGAGGATGGAGGGTAGGAGG - Intergenic
1067673261 10:48346080-48346102 ACTTGGGGGTGAAGGGAAGACGG - Intronic
1067901976 10:50251354-50251376 TCTTGGGGAAGGAGGGAAGGAGG - Intergenic
1068120617 10:52779406-52779428 GCTTGAGGAGGGAGGGAAGGAGG - Intergenic
1068731827 10:60366630-60366652 GCTTGGGGAGGAAGGGAAGGAGG + Intronic
1069052290 10:63808851-63808873 ACTTGAGGATGGAGGGTGGCAGG - Intergenic
1069647055 10:70008066-70008088 TCTGGGGGGTGGAGGCAAGAAGG - Intergenic
1069907255 10:71739134-71739156 TCTAGGGGGTCGAGGGATGCTGG + Intronic
1069914030 10:71776203-71776225 TCTTGGGGGTGGAGGGCATTGGG - Intronic
1070161724 10:73870922-73870944 TCTTGGAGATGGAGGGAACAAGG - Intronic
1071252716 10:83837345-83837367 TATTTGGGGTGGAGGGGAGCAGG + Intergenic
1071603498 10:86970266-86970288 TGGTGGGGCTGGAGGGAGGCGGG + Intronic
1072343059 10:94474486-94474508 TTTTGGAGGTGGAGGGGAGCTGG - Intronic
1072718780 10:97768247-97768269 TCCTTGTGATGGAGGGAAGCTGG + Intronic
1072763855 10:98080523-98080545 TCTTGGTGATGGTGGGTAGTGGG + Intergenic
1072800992 10:98392352-98392374 TCGTGGGGATTGAGGGAGCCAGG - Intronic
1073240604 10:102055659-102055681 TCTCAGGGATAGAGGAAAGCGGG - Intronic
1073289258 10:102405294-102405316 TCTAGGGGATGGATGGGAGTGGG - Intronic
1073477851 10:103766064-103766086 TTTTGAGGATGGAGGAATGCAGG + Intronic
1073527223 10:104195270-104195292 TCTTGGGCAAGGAGGGATACAGG - Intronic
1073645319 10:105295717-105295739 TGTTGGGGGTGGAGGGAAGGGGG - Intergenic
1074107826 10:110401744-110401766 CCATGGGGAGGGAGGGAGGCAGG - Intergenic
1075399659 10:122151769-122151791 CCGTGGGGATGGAGGGGACCTGG + Intronic
1075445199 10:122508191-122508213 ACTTGGGGATGGAGTGGAGATGG + Intronic
1075656289 10:124163315-124163337 TAATGGGGATGGAGGGAGGGAGG + Intergenic
1075662459 10:124207519-124207541 TCCTGGGGGAGGAGGGGAGCCGG + Intergenic
1076102999 10:127797729-127797751 TGTTTGGGATGGAGGGAGGGTGG - Intergenic
1077007871 11:367464-367486 GCTGGGTGATGGAGGGAGGCCGG - Intergenic
1077301432 11:1848941-1848963 TCCGGGGGATGGAGCCAAGCAGG - Intergenic
1077337225 11:2010828-2010850 ACATGGGGAGGGAGGGAGGCAGG - Intergenic
1077457966 11:2692291-2692313 CAATAGGGATGGAGGGAAGCAGG - Intronic
1078131742 11:8619334-8619356 TCCTGGGGATGCAGGGAAATAGG + Intronic
1079109910 11:17599568-17599590 ACTTGGGGAAGAAGGGAGGCTGG + Intronic
1079251478 11:18791042-18791064 TCTAGGGGAGGGTGGGACGCGGG + Intronic
1079388848 11:20003573-20003595 ACTTAGAGATGGAGGGAAGTGGG - Intronic
1079565763 11:21880040-21880062 TTGTGGGGTTGGGGGGAAGCGGG + Intergenic
1081534557 11:43987549-43987571 GTCTGGGAATGGAGGGAAGCAGG + Intergenic
1081741604 11:45444830-45444852 TCCTGTGGAGGGAGGGATGCTGG + Intergenic
1081749547 11:45500118-45500140 TGTTGGGGATGTAGAGAAGATGG + Intergenic
1083041053 11:59687901-59687923 ACGTGGGGTTGGAGGGAAGGTGG + Intergenic
1083269643 11:61565346-61565368 TTGAGGGGAGGGAGGGAAGCAGG - Intronic
1083936748 11:65873361-65873383 TCCTGGGGGTGGAGGGCAGGAGG - Intronic
1084243393 11:67838199-67838221 TCTTGGAGAGGGAGGGAGGGAGG - Intergenic
1084399738 11:68936719-68936741 TCGTGGGAATTGAGGGAAGGAGG - Exonic
1084491500 11:69481108-69481130 TCTGACGGAAGGAGGGAAGCTGG - Intergenic
1084748605 11:71189186-71189208 GCTGGTGGATGGCGGGAAGCCGG - Intronic
1084829298 11:71756372-71756394 TCTTGGAGAGGGAGGGAGGGAGG + Intergenic
1085034656 11:73292716-73292738 TGTTGGGGATGGCAGGGAGCCGG + Intronic
1085261258 11:75205925-75205947 TGCTGGGGGTGGGGGGAAGCTGG + Exonic
1085907790 11:80785503-80785525 TGTTGGGGAGGGAGGGAACAAGG - Intergenic
1086453609 11:86940677-86940699 TCTTGGAGTGGGAGGGAAGGTGG - Intronic
1087111629 11:94475963-94475985 CCTTTGGGATAGGGGGAAGCAGG + Intronic
1088126168 11:106426353-106426375 TATGAGGGATTGAGGGAAGCTGG + Intergenic
1088409270 11:109515309-109515331 ACTTGAGGGTGGAGGGAAGTAGG - Intergenic
1088496763 11:110439207-110439229 TCTCGGGGTTGGGGGGAAGTGGG - Intronic
1088907832 11:114168255-114168277 TCCTGGGGCTGGAGGGAAGCAGG - Intronic
1088917513 11:114238753-114238775 CCCTGGGGATGGAGACAAGCTGG - Intronic
1089502385 11:118940245-118940267 TCTTGGAGATGAAGGGAACTGGG + Intronic
1089560725 11:119341833-119341855 TCTTCTGGGTGGAGGGAAGGAGG - Intronic
1090024572 11:123156732-123156754 TCTGTGGGATGGAGCAAAGCTGG - Intronic
1090748659 11:129727298-129727320 ACATGGGGATGGAGGGCAGGGGG + Intergenic
1091186238 11:133650230-133650252 TGTCTGGGAGGGAGGGAAGCAGG - Intergenic
1202820209 11_KI270721v1_random:66010-66032 ACATGGGGAGGGAGGGAGGCAGG - Intergenic
1091474621 12:760032-760054 TCTTGGAGGAGGAGGAAAGCAGG + Intronic
1091781042 12:3214884-3214906 TCAGGGGGATGGGGGGAAGGAGG - Intronic
1092042366 12:5395898-5395920 TCTGGGGGAGGGAGGGAGGGCGG - Intergenic
1092259746 12:6946470-6946492 CTTTGGGGCTGCAGGGAAGCTGG + Intronic
1092396203 12:8128967-8128989 TCTTGGGGGTGGGGGGATGCAGG - Intronic
1092413936 12:8275303-8275325 TCTTGGAGAGGGAGGGAGGGAGG - Intergenic
1092641084 12:10510561-10510583 TCTTGGGGATGGAGTGTGGGTGG - Intronic
1093225077 12:16473186-16473208 TCCTGGGGATGGGGGGAATGTGG - Intronic
1095223408 12:39647547-39647569 GCTGGAGGATGGAGAGAAGCAGG + Intronic
1096760295 12:53836137-53836159 AGTGGGGAATGGAGGGAAGCCGG + Intergenic
1097926936 12:65139276-65139298 TTTGGGGGATGGAGGGATGGGGG - Intergenic
1098033431 12:66278276-66278298 TCCAGGAGATGGAGGGAAGTGGG + Intergenic
1098308759 12:69127161-69127183 TCTTGGGGGTGGAGGGTGGGAGG - Intergenic
1099169554 12:79347510-79347532 TCTTTGGGAGTGAGGGAATCAGG - Intronic
1099351217 12:81571293-81571315 TCTTGGGAGTGGAAGGAAGAAGG + Intronic
1099941491 12:89194525-89194547 TGTTGGGGAAGGAGGGAGGAAGG - Intergenic
1100625504 12:96327397-96327419 TACTGAAGATGGAGGGAAGCAGG + Intronic
1101018277 12:100524941-100524963 TCTTGGGGATATGGGGAAGATGG + Intronic
1102152207 12:110696599-110696621 TCTTAGGGCTGGAGGGAGACAGG - Intronic
1102239133 12:111312935-111312957 TGGTGGGGGTGGAGGGAAGCGGG - Intronic
1102506897 12:113389412-113389434 TCTTGGGGTGGCAGGGAAGGTGG + Exonic
1102561115 12:113762878-113762900 TCCTGGGGCTGGAGGAAGGCTGG - Intergenic
1103110293 12:118271344-118271366 TCTTAGGAATGGAGGGAATGGGG - Intronic
1103288328 12:119822047-119822069 TTTTGGTGATGGAGGGAGGTTGG - Intronic
1103417458 12:120752593-120752615 TCATGGGGATGGAGGGAGAAGGG + Intergenic
1103775478 12:123364218-123364240 TCTGGGCGAGGGAGGGAGGCAGG - Intronic
1105424827 13:20285162-20285184 TTCTGGGGATCGAGGGAAGGAGG + Intergenic
1106749846 13:32751026-32751048 TCTTGAGGGTGGAGGGTAGGAGG - Intronic
1107128768 13:36872695-36872717 TCCTGGGGAGTGAGGGTAGCTGG + Exonic
1107193946 13:37624311-37624333 TCTTGGGGATGGAGGTGGGTGGG + Intergenic
1108179772 13:47829231-47829253 CCCTGGGAATGGAGGTAAGCTGG - Intergenic
1108529448 13:51315300-51315322 TGTAGGGGGTTGAGGGAAGCAGG - Intergenic
1109798280 13:67343820-67343842 TCTTGGGGATGTATGGGATCTGG + Intergenic
1110149591 13:72234763-72234785 ACTTGAGGATGGAGGGTAGGAGG - Intergenic
1110321368 13:74163582-74163604 TGTGGGGGTTGGAGGGAAGGTGG + Intergenic
1112508748 13:99990748-99990770 TCGTGGGGCAGGAGGGATGCTGG - Intergenic
1112924740 13:104660431-104660453 TCTGGGAGATGGAGGGAGGCTGG - Intergenic
1115177644 14:30582641-30582663 TATTGGGGATGGAGTTAAGGTGG + Intronic
1116183752 14:41569570-41569592 TTTTGGGGATGCAGGGAAATAGG + Intergenic
1116466482 14:45239252-45239274 GGTTGGGGGTGGAGGCAAGCAGG + Intronic
1118680432 14:68236053-68236075 ACTTGAGGGTGGAGGGAGGCAGG + Intronic
1118839792 14:69501713-69501735 TCCTGGGGAGGGAGGGCAGATGG - Exonic
1119769374 14:77210874-77210896 TCATGGGGTTGGAGAGAAGGTGG + Intronic
1119775008 14:77242882-77242904 TCCTGGGGAAGGATGGAAGAAGG - Exonic
1119950003 14:78735365-78735387 TCTTTGGGGTGGGAGGAAGCTGG + Intronic
1120884453 14:89441083-89441105 GGTTGGGGAGGAAGGGAAGCCGG - Intronic
1121334025 14:93065829-93065851 ACATAGGGATGGTGGGAAGCTGG + Intronic
1121575115 14:94978323-94978345 ACTGAGGGTTGGAGGGAAGCAGG - Intergenic
1122609208 14:102969707-102969729 TGGTGGGGCTGGAGGGTAGCAGG - Intronic
1122631052 14:103107930-103107952 GCTGGGGGGTGGAGGGAACCAGG + Intronic
1122855759 14:104559420-104559442 AGATGGGGATGGAGGGAGGCCGG - Intronic
1123476666 15:20595968-20595990 TCCTGGGGAAGGTGGGAAGTGGG + Intergenic
1123641345 15:22404396-22404418 TCCTGGGGAAGGTGGGAAGTGGG - Intergenic
1124208435 15:27742850-27742872 CCTTGGGGAGTGAAGGAAGCGGG + Intergenic
1124479761 15:30068225-30068247 TCTTGGGCCTGATGGGAAGCAGG - Intergenic
1125686142 15:41564504-41564526 TCCTTGGGAGGGAGGGAAGGAGG + Intronic
1125719946 15:41840445-41840467 TCTAGGTGATGGAAGGAAGTGGG + Intronic
1127022856 15:54769422-54769444 ACTTGAGGGTGGAGGGAAGGAGG + Intergenic
1127709638 15:61583536-61583558 ACTTGAGGGTGGAGGGAAGAAGG + Intergenic
1128161389 15:65424925-65424947 TCTTGAGGCTGGAGGGGAGGAGG - Intergenic
1128998399 15:72313603-72313625 ACGTGAGCATGGAGGGAAGCTGG - Intronic
1129521302 15:76187956-76187978 TCCTGGGGGTGGAGGGTGGCAGG + Intronic
1130094485 15:80845898-80845920 TCTAGAGGATGGAGGGAGGAGGG - Intronic
1130149507 15:81300362-81300384 CCTTGGGGATGCAGGGAGTCTGG - Exonic
1130995707 15:88902801-88902823 TCTGGGGAATTGAGGGAGGCAGG + Intronic
1131446577 15:92503090-92503112 TCTGTGGGATGGGGGGAAGATGG - Intergenic
1131994247 15:98119125-98119147 TCTTGGGGGTGGTGGGCAGAGGG + Intergenic
1132066096 15:98732498-98732520 GTCTGGGGAAGGAGGGAAGCTGG + Intronic
1133209946 16:4258007-4258029 TCTGGGGGCTGGAGGGAGCCGGG - Exonic
1133236916 16:4391826-4391848 TCTTGGGGCTGCAGGGTAGCAGG - Intronic
1134092215 16:11397732-11397754 TCCTTGGGATGGAGGGAGGGAGG + Intronic
1134384212 16:13756898-13756920 ACTTGAGGAGGGAGGGAAGCCGG - Intergenic
1135262948 16:20997237-20997259 TGCTGGGGATGGAGGGAAAGAGG + Intronic
1135323699 16:21512943-21512965 GGTTGGGGATGGAGGGGTGCAGG + Intergenic
1135609699 16:23855673-23855695 TATAAGGGATAGAGGGAAGCAGG + Intronic
1135620688 16:23952839-23952861 TCTGGATGATGGAGGGAAGCTGG + Intronic
1136335182 16:29606208-29606230 GGTTGGGGATGGAGGGGTGCAGG + Intergenic
1137765400 16:50973927-50973949 ACTTGGAGATGGAGGGCAGCAGG - Intergenic
1137828837 16:51524821-51524843 TCTGGGGGTTTTAGGGAAGCTGG - Intergenic
1137858123 16:51817345-51817367 ACTTGAGGATGGAGGGAAGGAGG - Intergenic
1138419358 16:56889267-56889289 TGTTGGAGCTGGAGGGAGGCTGG - Intronic
1139028403 16:62848381-62848403 TTTGGGGGATGGAGGGAAGAGGG - Intergenic
1139300841 16:65943938-65943960 TCTTCCTGGTGGAGGGAAGCCGG - Intergenic
1139347238 16:66311845-66311867 TCCTGGGGATGGAGGGTGGGAGG - Intergenic
1141501473 16:84447416-84447438 TGGTGGGGAGGGAGGGAAGAAGG - Intronic
1141745617 16:85924129-85924151 TCTGGGCCCTGGAGGGAAGCTGG + Intergenic
1141916619 16:87101866-87101888 TCTGGAGGATGGAGTGAAGGTGG - Intronic
1142399740 16:89852594-89852616 TCTGGGGGGTGGAGGGAGGATGG - Intronic
1143116972 17:4586671-4586693 TCTTCGGGGTGGATGGAAGGTGG + Intronic
1144567295 17:16370302-16370324 ACTTGAGGATGGAGGCAAGAAGG - Intergenic
1144577204 17:16436623-16436645 GCTTGTGGAGTGAGGGAAGCAGG + Intronic
1144674691 17:17154237-17154259 CTTTGGAGATGGAGGGCAGCAGG + Intronic
1144742353 17:17591050-17591072 CCTGGGGGATGGACGGGAGCAGG + Intronic
1145263542 17:21368625-21368647 TCTTGGGGATGCTGGGCAGGTGG + Intergenic
1145266209 17:21380732-21380754 CCTTGGACATGTAGGGAAGCAGG + Intronic
1146620110 17:34390616-34390638 GCTTTGGGATGGAGGGACGAAGG + Intergenic
1146631028 17:34469385-34469407 CATTAGGGTTGGAGGGAAGCTGG - Intergenic
1146727435 17:35167743-35167765 TCTTGGGAAGAGAAGGAAGCAGG - Intronic
1147190180 17:38733862-38733884 TCTTTGGGGTGGAGGGAAGAAGG - Exonic
1147362931 17:39942964-39942986 CCTTGGGGAGTGAGGGAAGATGG + Intronic
1147447612 17:40484313-40484335 CCTTGGGGCTGGAGGGCATCGGG + Intronic
1147571399 17:41573327-41573349 TCTTGAGGGTGGAGGGAAACTGG - Intergenic
1147760094 17:42792320-42792342 CCCTGGGGATAGGGGGAAGCTGG - Intronic
1147770801 17:42866700-42866722 TCTAGTGGATGGATGGAGGCAGG + Intergenic
1148157569 17:45432504-45432526 TCTGGGGGCTGGAGGGAAGCAGG - Intronic
1148865133 17:50624339-50624361 GCCTGTGGAGGGAGGGAAGCGGG - Exonic
1148896568 17:50842459-50842481 TTTGGGGGATGGAGAGATGCTGG + Intergenic
1150594668 17:66593550-66593572 ACTTGGGGGTGGAGGGAGGAGGG + Intronic
1150649438 17:67000372-67000394 GCCTGTGGAAGGAGGGAAGCTGG + Intronic
1151144761 17:72030581-72030603 GCTAGGGGAAGGAGGGAAGCAGG + Intergenic
1151147526 17:72054780-72054802 TCTTGGAGATTGAGGGAGGGGGG + Intergenic
1151549540 17:74814216-74814238 TGCTGGTGATGGCGGGAAGCCGG + Intronic
1151549990 17:74817012-74817034 TCTTGGGGAGGGACGGGGGCGGG - Intronic
1151708810 17:75787946-75787968 TTATGGGGGTGGAGGGAAGCAGG - Intronic
1151813506 17:76459225-76459247 TCTTCAGGAAGGAGGGAAACAGG - Exonic
1152110186 17:78353467-78353489 TCTGGGGGAGGGGGGGAAGGAGG - Intergenic
1152204546 17:78967556-78967578 CCGTGTGGATGGAGGGAAGCCGG + Intergenic
1152542248 17:80982227-80982249 TAGTGGGGAGGGAGGGAAGGTGG - Intergenic
1152755813 17:82086557-82086579 CCCTGGGGAGGGAGGGAGGCAGG + Exonic
1153319791 18:3761239-3761261 GCTGGGGGAGGGAGGGAAACGGG - Intronic
1154126778 18:11698729-11698751 TCCTGGGGATGAAGAGAAGAGGG + Intronic
1155102929 18:22630981-22631003 TCTTGGGGGTGGAGGGATGAGGG + Intergenic
1155150004 18:23115720-23115742 GCTTGGGGAAGGAGGGAATGAGG - Intergenic
1155595424 18:27480579-27480601 ATTTGGGAATGGAGGGAAACCGG + Intergenic
1156012605 18:32512329-32512351 TCTTAAGGATGGAGGGTGGCTGG - Intergenic
1156067868 18:33166925-33166947 ACTTGAGGGTGGAGGGAGGCAGG - Intronic
1156504749 18:37582717-37582739 TGATGGGGATGGAGGGAAAATGG - Intergenic
1156731442 18:40197981-40198003 GCTTGGGGACAGAGGGAGGCGGG - Intergenic
1157597733 18:48874175-48874197 ACTAGGGGATGGAGGGAATCTGG - Intergenic
1158131059 18:54153147-54153169 TCGTGGGGATGGAGGAGAGGTGG + Exonic
1158243691 18:55406733-55406755 TTGTGGGGATGGGGGGAGGCGGG - Intronic
1158987627 18:62834875-62834897 TCTTAGGGATGGAGAGGAGTGGG - Intronic
1159911838 18:74152791-74152813 TCTTGAGGGATGAGGGAAGCAGG + Intronic
1160668734 19:345703-345725 ACTCGCTGATGGAGGGAAGCTGG + Intergenic
1160710337 19:548521-548543 TCCTGGGGACAGAGGGAATCAGG - Exonic
1160782545 19:884290-884312 TCCTGGGGCTGGAGCGAAGCAGG - Intronic
1161022033 19:2015178-2015200 GCTCGGGGATGGAGGGGTGCGGG + Intronic
1161198485 19:3000723-3000745 CCTTGGGGAAGGAGAGCAGCAGG + Exonic
1161664260 19:5565354-5565376 TGTGGGGGATGCAGGGAAGGTGG - Intergenic
1161758903 19:6156290-6156312 AGTTGGGGAGGAAGGGAAGCTGG + Intronic
1162153874 19:8663831-8663853 TCTGGGGGATGTAGGGACTCAGG + Intergenic
1162159361 19:8699952-8699974 GGTTGGGGATGGAGAGAGGCAGG + Intergenic
1162292282 19:9789253-9789275 TCTTGGTGATGGAGAGATGGGGG - Intronic
1162495632 19:11021889-11021911 TCTTGAAGATGGTGGGCAGCAGG - Exonic
1163831826 19:19550668-19550690 TCTGGGGCAAGGAGGGAGGCTGG - Intergenic
1164017417 19:21265071-21265093 TCGGGGGGATGGTGGGCAGCCGG - Intronic
1164223623 19:23221594-23221616 TCTTTGAGATGGAGTGCAGCTGG + Exonic
1164596971 19:29536635-29536657 TCTGGGGGACGGACTGAAGCAGG - Intronic
1164609776 19:29624143-29624165 CCTTGGGGATGCACGGAAACAGG + Intergenic
1164940507 19:32249428-32249450 TCTTGGGGGTGGAGTGGAGGTGG - Intergenic
1165091151 19:33389015-33389037 TCCTGGGGAGGGAGTGCAGCCGG - Intronic
1165162032 19:33822111-33822133 TCCTGGGGAGGGTGGGAAGTGGG - Intergenic
1165955704 19:39500687-39500709 TCTTGGGACTGGTGGGGAGCTGG + Intronic
1166043250 19:40215405-40215427 TATTGGGGAAGGAGGGAGGGGGG + Exonic
1166616229 19:44249866-44249888 TCTAGGGGGTGGAGGGGAGGTGG - Intronic
1167287485 19:48606776-48606798 TCCTGGGGATGGAGGTGAGCGGG - Exonic
1167635610 19:50653438-50653460 TTTGAGGGATGGAGGGAGGCCGG + Intronic
1168057747 19:53872865-53872887 CCTTGGGGAGGGAGGGAAAGAGG + Intronic
1202694489 1_KI270712v1_random:114369-114391 TCTGGGGAAGGGAGAGAAGCCGG + Intergenic
925278267 2:2665702-2665724 CCTTGGGGAAGGAGGTGAGCCGG - Intergenic
925357185 2:3250120-3250142 TCTTGGGCCTGGAGGGCAGAAGG - Intronic
925474699 2:4200073-4200095 TTTTGGGTATGGAGGAAAGTGGG + Intergenic
925763586 2:7209841-7209863 TCTGAGGGATTCAGGGAAGCAGG - Intergenic
926664403 2:15504720-15504742 TGTTGAGGATGTAGGGAATCTGG + Intronic
927515956 2:23671808-23671830 GGCTGGGGATGGAGGGCAGCGGG + Intronic
927948991 2:27154897-27154919 TCCTGGGGATGAAGGGAAATTGG + Exonic
929224645 2:39500533-39500555 GCTTTGAGGTGGAGGGAAGCAGG - Intergenic
929434648 2:41919232-41919254 TTTGGGGGGTGGAGGGAAGATGG - Intergenic
929892468 2:45929712-45929734 TCCTGGGGGTGGGGGGAAGATGG - Intronic
930203779 2:48568476-48568498 TCTTGAGGTTGGAGGGGAGTAGG + Intronic
930365429 2:50433715-50433737 AGTTGGGGAGGGAGGGAAGGTGG + Intronic
930365617 2:50435798-50435820 TCTTGAGGGTGGAGGGAAGGAGG + Intronic
931014673 2:57962567-57962589 ACTTGAGGATGGAGGGAGGGAGG - Intronic
932333749 2:70917496-70917518 TGGTGAGGATGCAGGGAAGCTGG - Intronic
932400617 2:71478779-71478801 TCTGAGGGAGGGAGGGAGGCAGG - Intronic
932521375 2:72417002-72417024 TTTTGGGGATGGACAGAAGGTGG - Intronic
934752471 2:96802323-96802345 TCTTGGCCGTGGAGGGCAGCAGG - Intronic
934930587 2:98419337-98419359 CCTTGGGTGTGGAGGGAAGAGGG - Intergenic
935047916 2:99498480-99498502 TCTTAGGTATGGAGGGAAATGGG - Intergenic
935814374 2:106832792-106832814 TCTGGGGGAGGGAGAGAGGCAGG + Intronic
938137972 2:128774832-128774854 ACTTTGGGATGGAGGGAGGCTGG + Intergenic
938391886 2:130913197-130913219 TTGTGGAGTTGGAGGGAAGCAGG + Intronic
938917816 2:135961046-135961068 ACTGGGGGAGGGAGGGAAGGAGG + Intronic
938928884 2:136068380-136068402 TCTTGCAGCTGGAGGGAAGGAGG + Intergenic
939217771 2:139262017-139262039 TCTGGGGTGTGGAGGGAAGAAGG - Intergenic
939220534 2:139296000-139296022 TCTCTGGGATGGTGGGAGGCAGG + Intergenic
940955250 2:159720025-159720047 TCTTGGGGCTGGAGGGGGGAGGG - Intronic
942548914 2:177094002-177094024 TCTTGGGGAGGCAGGCAGGCAGG - Intergenic
942833786 2:180267682-180267704 GCTAGAAGATGGAGGGAAGCTGG - Intergenic
942980316 2:182072852-182072874 TCTGGGAGAGGGAGAGAAGCTGG - Intronic
943334782 2:186600307-186600329 TATTGAGGATGGAGGGGAGTGGG - Intronic
943662608 2:190575189-190575211 TGTTGGGGATGGTGGGAAACTGG - Intergenic
944087574 2:195867251-195867273 TGTTGGGGAGGGAGGAAAGCAGG - Intronic
944432131 2:199644995-199645017 ACTTGGGGAGGGCGTGAAGCCGG - Intergenic
944821998 2:203440860-203440882 GCTTGGGGAGGGAGGGGTGCAGG + Exonic
944996185 2:205296722-205296744 TTTTGGGAATGGAGGGTAGTAGG + Intronic
945008409 2:205434905-205434927 TCTTGGGGAGGGTGGGATGGGGG + Intronic
945160923 2:206889685-206889707 TCTTGAGAGTGGAGGGAAGGAGG - Intergenic
946080771 2:217116456-217116478 TGTTAGGGAGGGAGGTAAGCAGG - Intergenic
946121906 2:217523490-217523512 GCCTGGGAAGGGAGGGAAGCTGG + Intronic
946138960 2:217671786-217671808 GTTTGGGGATGGAGTGAAACTGG - Intronic
946141921 2:217698665-217698687 TTCTGGAGAGGGAGGGAAGCGGG + Intronic
946204666 2:218095329-218095351 TTTTGGTGATGCAGGGAAGAAGG - Intergenic
946230585 2:218288779-218288801 TCTTGGGGGTGGAAGGGAGTTGG + Intronic
946371765 2:219285585-219285607 TCTCGGGGAAGGAAGGAAGAAGG - Exonic
946444804 2:219728964-219728986 TCTTGGTGAGGGAGGGAAAGGGG - Intergenic
948127727 2:235576989-235577011 TTTGGGGTATGGAGGGAAGATGG - Intronic
1169252884 20:4073606-4073628 TCTTGGGGATGGAGGGAAGCAGG + Intronic
1169317188 20:4602472-4602494 TCTTGGGGATGAAGTGAGGGAGG - Intergenic
1169570836 20:6903487-6903509 TCTGGGGGGTCGAGGCAAGCAGG + Intergenic
1169867417 20:10217233-10217255 CATTGCGGAGGGAGGGAAGCGGG - Intergenic
1170431450 20:16280356-16280378 ACCAGGGGATGGAGGGAAGGAGG + Intronic
1170902125 20:20474401-20474423 TCCTGAGGATTTAGGGAAGCAGG + Intronic
1171188263 20:23138906-23138928 CCCTGGGTAAGGAGGGAAGCCGG + Intergenic
1172010706 20:31844358-31844380 ACTTGGGGGTGAGGGGAAGCAGG - Exonic
1172160591 20:32865349-32865371 GCTTGGGGATGGTGGGGAGCAGG + Intronic
1172310562 20:33915191-33915213 ACTGGGGGGTGGGGGGAAGCTGG - Intergenic
1172601446 20:36186374-36186396 TATTGAGGATGGAGGGAATTAGG + Intronic
1173876773 20:46377676-46377698 TCAGGGGGAGGGAGGGATGCAGG - Intronic
1174579745 20:51563082-51563104 TCTGGGAGAGGGAGCGAAGCGGG + Intergenic
1174894355 20:54433166-54433188 TGTTGGGGGAGGAGGGAAGAAGG - Intergenic
1175397262 20:58675059-58675081 CCTTGTGGCTGGAGGGAAGATGG - Intronic
1175552949 20:59828784-59828806 TCCTGAGGATGGTGGGAACCCGG + Intronic
1175889451 20:62309877-62309899 TTTTGGGGCTGGAGAGAGGCTGG - Intronic
1176968030 21:15233600-15233622 TCATGGGGGTGGAGGGGAGGGGG + Intergenic
1178956033 21:37022831-37022853 ACTTGAGGATGGAGGGAGGAGGG - Intergenic
1179187172 21:39093963-39093985 TCTTGGGGTTGTAGGGAAAGGGG - Intergenic
1179822102 21:43942941-43942963 TGTTGGGGATGGAGGAAGACAGG + Intronic
1180064962 21:45407745-45407767 TCTGGGGGCTGCAGGGAGGCAGG - Intronic
1181447259 22:22986833-22986855 TCTTGGTGATGGAGAGGCGCTGG - Intergenic
1182455281 22:30446451-30446473 TCTTGGGGAGGGAGCCAAGCAGG - Intergenic
1182757875 22:32695425-32695447 TCTCAGGGATGGAGTCAAGCTGG + Intronic
1182910748 22:33982120-33982142 TCTGGGGAATGGAAGGAGGCAGG - Intergenic
1183002839 22:34875921-34875943 TGATGAGGATGGAGGGAAGGGGG + Intergenic
1183265057 22:36819686-36819708 TTTGGGTGCTGGAGGGAAGCAGG - Intergenic
1183541598 22:38432358-38432380 TTTTGTGGATGCAGGGATGCAGG + Intronic
1183598371 22:38825788-38825810 ACCTGGGGATGGAGGGAGGAAGG - Intronic
1184096712 22:42320016-42320038 TGGTGGGAATGGAGGGAAGATGG - Intronic
1184654260 22:45933236-45933258 TGCTGGGGAGGGAGGGATGCTGG - Intronic
1184871620 22:47244140-47244162 TCCTGGGGATGGAGGCAGGGTGG - Intergenic
1184919381 22:47594911-47594933 ACTTGGGGATGCTGGGAAGAAGG - Intergenic
1185179459 22:49350682-49350704 TCTTAGGGAGGCAGGGAGGCCGG - Intergenic
950595427 3:13976444-13976466 TCTGGGGGAGGTAGGGAAGATGG - Intronic
951788542 3:26452615-26452637 TCATGGGTCTGGAGGGAAGAGGG + Intergenic
951932695 3:27986370-27986392 GCTTGGGCTGGGAGGGAAGCAGG + Intergenic
952342831 3:32459784-32459806 TCTTGGGGAGGTAGGGAGGAAGG + Intronic
952382437 3:32816096-32816118 TAATGGGGCTGGGGGGAAGCAGG - Intergenic
952388781 3:32862068-32862090 TTTTGGGGGAGGAGGGGAGCAGG + Intronic
953018768 3:39100719-39100741 TCGTGGGGTTGGAGGGCTGCAGG - Intronic
953662923 3:44904056-44904078 TCTTGGGTATGCAGCCAAGCAGG + Intronic
953668763 3:44945105-44945127 TGGCGGGGATGGAGGGAGGCAGG + Intronic
953783431 3:45892555-45892577 CCTTGAGGATGGAGGGAGGTAGG + Intronic
954303655 3:49714330-49714352 TCCTTGGGCTGGAAGGAAGCAGG - Intronic
954455063 3:50593284-50593306 ACTAGGGGATGGACGCAAGCTGG - Intergenic
954580533 3:51700690-51700712 TGTTTGGGAGGGAAGGAAGCTGG - Intronic
955138264 3:56242308-56242330 ACTTGGGGAAGGATGGAAGGCGG + Intronic
955278024 3:57566597-57566619 TAATGAGGATGGAGGGAAACTGG - Exonic
955380626 3:58435127-58435149 TCTTGGGGATGGGTGGAGACTGG - Intergenic
956426019 3:69135971-69135993 GCTTGGGCAGGGAGGGAATCGGG + Intergenic
958551494 3:95619518-95619540 ACTTGAGGATGGAGGGAGGGAGG + Intergenic
958822624 3:98993045-98993067 ACTTGAGGATGGAGGGTAGGAGG - Intergenic
959227347 3:103602959-103602981 TTTTGGGGATGGAGAGGTGCAGG - Intergenic
959893887 3:111585500-111585522 TAATAGGGATGAAGGGAAGCTGG + Intronic
959992138 3:112641542-112641564 TCCTCGGCATGGAAGGAAGCTGG + Intronic
961148048 3:124611785-124611807 TCTTGTGGCTGGAGCGCAGCTGG - Intronic
962366942 3:134793174-134793196 TTAAGGGGAGGGAGGGAAGCTGG + Intronic
962487037 3:135853738-135853760 TCTTGAGGAGGTAGGGAAGATGG + Intergenic
962630356 3:137269560-137269582 TGATGGGGGTGGAGGGAGGCAGG + Intergenic
962875952 3:139536194-139536216 ACTTGTGAATGGAGGGGAGCTGG - Intronic
963252830 3:143118818-143118840 TCTTGGGGAGGGAGGGAGTTGGG + Intergenic
963411170 3:144930061-144930083 ACTTGAGGATGGAGGGTAGGAGG + Intergenic
963925919 3:150951138-150951160 TCTTGAGGATGGAGGGTGGGAGG + Intronic
964438220 3:156675442-156675464 TCTCTGGGATGCAGGGAGGCCGG + Intronic
964580327 3:158227293-158227315 TCTTGGGGGCAGAGGGAAGAGGG - Intronic
965293355 3:166912394-166912416 TCTTGAGGTTGGATGGGAGCAGG - Intergenic
965535798 3:169822653-169822675 TCTTCGGGATGGAGTGGAGGAGG - Exonic
966339369 3:178908219-178908241 GCTTAGGAGTGGAGGGAAGCTGG - Intergenic
967130889 3:186469738-186469760 ATTTAGCGATGGAGGGAAGCTGG - Intergenic
967312687 3:188121122-188121144 GCTTTGGGATGCAGGGAGGCTGG - Intergenic
967386022 3:188911814-188911836 TCTTTGGGGTGGTGGGGAGCGGG - Intergenic
967955890 3:194876918-194876940 CTTGGGGGATGCAGGGAAGCTGG + Intergenic
969002877 4:3996362-3996384 TCTTGGAGAGGGAGGGAGGGAGG - Intergenic
969691261 4:8705407-8705429 GCCTGGGGAGAGAGGGAAGCTGG + Intergenic
969751146 4:9112162-9112184 TCTTGGAGAGGGAGGGAGGGAGG + Intergenic
970776452 4:19680036-19680058 TGTTGGGGGTGGGGGGAAGGGGG - Intergenic
970796114 4:19915587-19915609 TCTTTGGGATCGAGGAAATCTGG - Intergenic
971412754 4:26392650-26392672 TCCTGGGGATAGGGGGAGGCAGG + Intronic
972579682 4:40384240-40384262 TAATGGGGATAGAGGGAAGAGGG + Intergenic
973105132 4:46326241-46326263 TCTTGGGGAAGGAGGGTTGTAGG - Intronic
973135278 4:46699112-46699134 ACTTGGGCATGGAGGGCTGCAGG - Intergenic
973304729 4:48633145-48633167 TCTTTGGGCTGGAAGGAAGTGGG - Intronic
974142762 4:57908701-57908723 AAGTGGGGATGGAGAGAAGCAGG + Intergenic
974162813 4:58161864-58161886 TCTTGGGGAGAAAGGGAAGCAGG + Intergenic
974281588 4:59801930-59801952 GTTGGGGGATGGAGAGAAGCAGG + Intergenic
974678791 4:65134025-65134047 ACTTGAGGATGGAGGGCAGGAGG + Intergenic
975999105 4:80350778-80350800 TGTTGGGGGTGGAGGGAAAGGGG + Intronic
976162150 4:82213855-82213877 TGTGGGGCAGGGAGGGAAGCAGG - Intergenic
976203019 4:82598507-82598529 TCCTGGGGATGGGGAGAACCTGG + Intergenic
976555420 4:86445416-86445438 TCATGGGGAGGGAGAGTAGCAGG + Intronic
976626675 4:87191757-87191779 TATGGGGGAAGGAGGGAAGGCGG - Intronic
978313882 4:107414875-107414897 TCTTAGGTATGGAGGGAAATGGG - Intergenic
978588833 4:110302286-110302308 TCTTAGGGCTGGAGGCAAGGAGG - Intergenic
978815888 4:112905017-112905039 TCAAGGGGAAGGAGGGAAGAAGG + Intronic
979809914 4:125024404-125024426 TCTTGGTGATGCAGGGTAGATGG + Intergenic
980152496 4:129063953-129063975 TCTTGGGGCAGGAGTGATGCAGG + Intronic
980991971 4:139745858-139745880 TCCTGGGGATGGAGGAAAGATGG + Intronic
981347518 4:143693992-143694014 TCTTGAGGGTGGAGGGTAGGAGG + Intronic
982274818 4:153628116-153628138 AGTTGGGGAGGAAGGGAAGCAGG - Intronic
983143895 4:164188623-164188645 TCTTGGGATTGGAGGTGAGCTGG - Intronic
983155641 4:164344219-164344241 ACTTGAGGGTGGAGGGAAGGAGG + Intronic
983979240 4:173973688-173973710 GCTAGGGGATGGAGTGAGGCAGG + Intergenic
984056319 4:174933623-174933645 CCTTGAGGATGGAGGAAAGGAGG - Intronic
985010111 4:185573614-185573636 TCCTGGGGATGGCAGGAAGATGG + Intergenic
985542147 5:492200-492222 TGTTGGGGAGGGAGGTCAGCGGG + Intronic
985787315 5:1903975-1903997 TCTTGGGGATGGTGAGGAGCTGG + Intergenic
987520839 5:18981400-18981422 ACTTGAGGATGGAGGGTAGTGGG - Intergenic
987734219 5:21818519-21818541 TCTGGGGGAAGGAGGGAAGAAGG - Intronic
989151411 5:38303391-38303413 GCTTGGGGATGGAGTGAATGGGG + Intronic
989177678 5:38544563-38544585 TTTGGGGGAGGGAGGCAAGCAGG - Intronic
989188460 5:38646844-38646866 TTTAGGGAATTGAGGGAAGCAGG + Intergenic
990073722 5:51816845-51816867 GCTTGGAGATGGTGGGTAGCGGG - Intergenic
990122798 5:52476075-52476097 ACTTGGGCATGGAGGGACACTGG + Intergenic
990580016 5:57159145-57159167 TCTTGGGGATAGTTGGAAGATGG + Intergenic
991450318 5:66744145-66744167 TCTGGGGGATGGAGGGGCACTGG - Intronic
991595830 5:68304309-68304331 TCTGGGGCATGGTGGGAGGCAGG + Intergenic
992882890 5:81128128-81128150 TGGTGGGGAGGAAGGGAAGCGGG + Intronic
993330158 5:86589618-86589640 TCTGAGGAATGGAGGCAAGCAGG - Intergenic
993845383 5:92935984-92936006 TCCTGGGTATGGAGGGAGGTAGG + Intergenic
994536899 5:101042634-101042656 TCCAGGGGAAGGAGGGCAGCAGG + Intergenic
996000962 5:118363019-118363041 TCCTGGAGATGTTGGGAAGCTGG - Intergenic
996191392 5:120547077-120547099 TCATGGTGCTGGAGGGAAGTGGG + Intronic
997664659 5:135620315-135620337 TCATGGGGATGGAGCTGAGCTGG + Intergenic
997872792 5:137520045-137520067 TCATGAGGATGGTGGTAAGCGGG + Intronic
997999163 5:138610529-138610551 TCTTGGGGAGGGAGGAGGGCAGG + Intergenic
998116716 5:139543433-139543455 ACGTGGGTATAGAGGGAAGCTGG - Intronic
998364605 5:141621150-141621172 TCTCTGGGTTCGAGGGAAGCAGG + Exonic
998471328 5:142386228-142386250 CCATGGGGATGAAGGGAAGGAGG + Intergenic
998471865 5:142389874-142389896 TGTGGGGAATGCAGGGAAGCAGG + Intergenic
998604739 5:143622104-143622126 ACTTGGGGGTGGAGGGTAGGAGG + Intergenic
999322015 5:150621366-150621388 TCTTGGAGATGGAGGCAGGAAGG + Intronic
999856621 5:155601623-155601645 TCTTTTGGATGGAGGGAAGCAGG - Intergenic
1000252198 5:159506346-159506368 TTTTGTGGAGGGAGGGAAGGGGG + Intergenic
1000275510 5:159731236-159731258 CCTAGGGGAAGGAGGGAAGGAGG + Intergenic
1000304423 5:159982769-159982791 TGTTGCGGAGGGAGGGAAGCAGG - Intergenic
1001085844 5:168699510-168699532 TGCTGGGGAAGGTGGGAAGCAGG + Intronic
1001584374 5:172823443-172823465 TGTTGGGGATGGTGGGAATCAGG - Intergenic
1001931651 5:175677584-175677606 TTTTGGGGTTGCAAGGAAGCAGG - Intronic
1002576850 5:180178901-180178923 TCTTGGGGGGGGAGGGGCGCAGG + Intronic
1003094056 6:3128621-3128643 TCTGCTGGATGGAGTGAAGCAGG - Intronic
1003286051 6:4734681-4734703 GGATGGGGATGGAGGGAAGATGG + Intronic
1003860680 6:10319418-10319440 CCGTGGGGATGGAGGGATGTGGG + Intergenic
1003860725 6:10319569-10319591 CCTTGGGGATGGCGGGACGTGGG + Intergenic
1003860777 6:10319750-10319772 CCGTGGGGATGGAGGGACGTGGG + Intergenic
1003860787 6:10319780-10319802 CCGTGGGGATGGAGGGACGTGGG + Intergenic
1004126818 6:12882121-12882143 ACAGGGGGATGGAGGGAAGCAGG + Intronic
1004351359 6:14893071-14893093 GGTTGGGGATGGAGGGAAGGAGG + Intergenic
1004472281 6:15940049-15940071 TCTTGGAAATGCAGGGAAGGAGG + Intergenic
1005005717 6:21285555-21285577 GGCTGGGGATGGAAGGAAGCAGG - Intergenic
1005277136 6:24231279-24231301 TCTTGGTGATGGGGGTGAGCAGG - Intronic
1005283873 6:24303390-24303412 TTTTGGGAATGGAGGGGAGCAGG - Intronic
1006968503 6:38014795-38014817 TCTTGAGGATACAGGGAAGATGG + Intronic
1010263452 6:73842211-73842233 TCATGGGGATGGGGGGAAGTGGG - Intergenic
1011921566 6:92583453-92583475 ACTTGGGGGTGGAGGCAGGCAGG + Intergenic
1012078853 6:94729285-94729307 TCATGAGGATGGAGAGAAACTGG + Intergenic
1012131316 6:95497198-95497220 GCTTGGGCATGGCGGGATGCAGG - Intergenic
1013369202 6:109455389-109455411 TCTTGGGGGTGGAGGGTGGAAGG + Intronic
1014097745 6:117479011-117479033 TCTGGGGGGTAGTGGGAAGCAGG - Intronic
1015159791 6:130140013-130140035 TCTGGGGGGTGGGGGGAAGGGGG + Exonic
1015856580 6:137631454-137631476 CCTTAGGGCTGGAAGGAAGCTGG + Intergenic
1016774561 6:147891179-147891201 TCTTGGGGAGGAAGGGAAAAGGG + Intergenic
1017009267 6:150052372-150052394 TCATTGAGCTGGAGGGAAGCTGG - Intergenic
1017064601 6:150517745-150517767 ACTTGGTGATAGAGGGAAGGGGG - Intergenic
1017388203 6:153909926-153909948 TCATGGAGATGGAGGGTAGAAGG + Intergenic
1017441284 6:154466539-154466561 TGTTGGGGATGGGGGGATGTGGG + Intronic
1019103571 6:169650737-169650759 TGGTGGGGATGGAGGGATGGAGG - Intronic
1019609384 7:1929244-1929266 TCTTTGGGGAGGAGGGAGGCAGG - Intronic
1019703802 7:2487997-2488019 TCTGGGGGAAGGAGGGGAGAGGG + Intergenic
1020263894 7:6547644-6547666 CTTTGGTGATGTAGGGAAGCTGG + Intronic
1020764834 7:12306556-12306578 TCTTGGGGTTGGTGGGGGGCTGG - Intergenic
1021209754 7:17834043-17834065 TGATGGGGATGGAGGTAAGGTGG - Exonic
1021808599 7:24380641-24380663 TCTTGGGGGTGGGGGGCGGCGGG - Intergenic
1022384549 7:29889097-29889119 TGGTTGGGATGGAGGGAAGCAGG - Intronic
1022458298 7:30578924-30578946 TCTTGGTAATTGAGGGAAACTGG - Intergenic
1022482835 7:30755158-30755180 TCCTGGGGATTAAGGGAAGGGGG + Intronic
1022525595 7:31035094-31035116 TCTTTGGGGTCGAGGGGAGCAGG - Intergenic
1022598978 7:31738694-31738716 TCTTGGAGATGGTGGCCAGCTGG + Intergenic
1022832958 7:34086663-34086685 GCTTGAGGATGGAGGGAGGAAGG + Intronic
1023852137 7:44156530-44156552 TCTGTGGGCTGCAGGGAAGCAGG + Intronic
1023852436 7:44157904-44157926 TCTTGGGGCAGGGTGGAAGCAGG + Intronic
1024028133 7:45431654-45431676 GCTTGGGGATGGTGGGGAGAGGG + Intergenic
1025035562 7:55590882-55590904 CCCTGGGGAAGGAGAGAAGCAGG - Intergenic
1026102716 7:67396188-67396210 CCTGGGGGAAGGAGGGAAGCTGG - Intergenic
1026442791 7:70458612-70458634 TTTTTAGGGTGGAGGGAAGCGGG + Intronic
1026602923 7:71791546-71791568 ACTTGAGGATGGAGGGTAGGAGG + Intronic
1027345770 7:77258024-77258046 TATAGGAGATGGAGGGAAGCAGG + Intronic
1028531264 7:91841275-91841297 TGCTGGGGATGGAGGGAGGTGGG - Intronic
1028716419 7:93976274-93976296 TGAAGGGGTTGGAGGGAAGCAGG - Intronic
1029092188 7:98057009-98057031 TCTTGGGGAGGGCTGGGAGCGGG + Intergenic
1029485325 7:100836569-100836591 TCCTGGGGAGGGAGGGTATCTGG - Intronic
1030668681 7:112310127-112310149 TCCTGGGAAGGGAGGGGAGCTGG - Intronic
1031278918 7:119770056-119770078 GCTAGGGGATGGAGGGAATGGGG + Intergenic
1032792084 7:135249880-135249902 TGTTGGGTATTAAGGGAAGCTGG + Intronic
1033459580 7:141533225-141533247 ACTTGGGGACTGAGGGAAGGTGG + Intergenic
1033931698 7:146531215-146531237 ACTTGAGGATGGAGGGAGGGAGG + Intronic
1034278298 7:149834002-149834024 TCCTGGGGCTCGAGGGAAGAGGG + Intergenic
1035673707 8:1439701-1439723 CCTAGGGGATGGCGGGAAGAAGG - Intergenic
1035673719 8:1439751-1439773 TCTGGGGGATGGTGGGGAGAGGG - Intergenic
1036374353 8:8187573-8187595 TCTTGGAGAGGGAGGGAGGGAGG + Intergenic
1036876551 8:12478062-12478084 TCTTGGAGAGGGAGGGAGGGAGG - Intergenic
1037587564 8:20288513-20288535 TCTTGGGGTTGGGGTGAGGCAGG - Intronic
1038356371 8:26832763-26832785 TGTGGGGGAGGGAGGCAAGCAGG + Intronic
1039393709 8:37204524-37204546 TCTCAGGGAATGAGGGAAGCAGG - Intergenic
1039465639 8:37783400-37783422 TCTGGAGGAGTGAGGGAAGCAGG + Intergenic
1039661661 8:39474751-39474773 TCTTGGTAATGGAGGCAAACTGG - Intergenic
1039981943 8:42415484-42415506 TCTTGGGGTGAGAGGGAAACAGG - Intergenic
1040407615 8:47121803-47121825 ACTTGAGGGTGGAGGGCAGCAGG + Intergenic
1043506980 8:80911813-80911835 ACTTGAGGATGGAGGGCAGGAGG - Intergenic
1043676576 8:82963464-82963486 AATTGGGGATGCAGGGCAGCAGG + Intergenic
1045610104 8:103829701-103829723 ACTTGAGGATGGAGGGTAGGAGG + Intronic
1048259123 8:132930743-132930765 TCTTAGGGAGTGAGGCAAGCAGG + Intronic
1048332483 8:133480104-133480126 GGATGGGGAAGGAGGGAAGCTGG + Intronic
1048522622 8:135170980-135171002 GCATGGGGATGTAGGGATGCTGG - Intergenic
1048560474 8:135530802-135530824 TCTGAAGGATGGAGGCAAGCAGG - Intronic
1048852453 8:138657981-138658003 TTACGAGGATGGAGGGAAGCAGG - Intronic
1049193482 8:141302388-141302410 TCGGGGGGAGGGAGGGCAGCGGG - Intronic
1049237889 8:141521700-141521722 TCTGTGTGATGGAGGGAAGCAGG - Intergenic
1049408068 8:142460486-142460508 TCTAGGGGATGCTGGGGAGCCGG + Intronic
1049680143 8:143914574-143914596 ACTTAGGGGAGGAGGGAAGCGGG - Intergenic
1049776476 8:144408184-144408206 TGGTGGGGATGGAGGGAGGTAGG - Intronic
1050696613 9:8286273-8286295 TGTTGGGGAAGGAGGGAATAAGG - Intergenic
1050982267 9:12035640-12035662 GCTTGGGGATGGAGCCAAGATGG + Intergenic
1051679117 9:19589395-19589417 TCTAGGGAATGGATGGAATCTGG + Intronic
1051847982 9:21474367-21474389 TGGTGGGGAGGGAGGGAAGGTGG - Intergenic
1052819728 9:33129176-33129198 TCTGGGGGATGGGGGGAGGTGGG + Intronic
1054138671 9:61456131-61456153 ACTTGAGGATGGAGGGTAGGAGG - Intergenic
1055323558 9:75105186-75105208 TTTTGGGGTTGGGGAGAAGCAGG + Intronic
1056486244 9:87060877-87060899 TCATGGGGAAGGAGGAAAGTTGG - Intergenic
1056580601 9:87886270-87886292 TCTTGGGGAAGGTGGGCAGTGGG - Exonic
1056628540 9:88274032-88274054 GGGTGGGGATGGAGGGAGGCTGG + Intergenic
1057945723 9:99326326-99326348 TCTTGGGGAAGGAGATTAGCAGG + Intergenic
1058136576 9:101314297-101314319 TATTGGGGAGGGAAGGAAGAGGG - Intronic
1058466727 9:105236352-105236374 TTTGGGGGATGGAGAGAAGACGG + Intergenic
1058922788 9:109633216-109633238 TATTGAGGATGGAGGGATCCTGG - Intergenic
1059008939 9:110435467-110435489 AGATGGGGGTGGAGGGAAGCAGG + Intronic
1059380009 9:113915711-113915733 TCTGGGGGAAGGAGGAAAGGAGG + Intronic
1059678192 9:116560549-116560571 ACTTGAGGCTGGAGGGAAGCTGG - Intronic
1060638684 9:125220569-125220591 TCTTGGGGATGGTGGGGGGCTGG - Exonic
1060641186 9:125240762-125240784 TCTCGGGGTTGGAGGTGAGCTGG + Exonic
1060670775 9:125467564-125467586 CCTGTGAGATGGAGGGAAGCTGG - Intronic
1060750509 9:126165470-126165492 CCTTGGTGACAGAGGGAAGCGGG + Intergenic
1060786766 9:126457224-126457246 TGTTGGTGATGGAGGGAAGAAGG - Intronic
1060913104 9:127366464-127366486 ACCTGGGGATGCAGGGCAGCAGG - Intronic
1061887935 9:133602138-133602160 TCTTGGGCATGGCTGGAGGCAGG - Intergenic
1061911049 9:133724518-133724540 TGGTGAGGATGGAGGGGAGCTGG + Intronic
1185863867 X:3605165-3605187 TGTTGCTGATGGAGGCAAGCAGG - Exonic
1186080145 X:5922234-5922256 TCGTGGGGAGGGGGGGAAACAGG + Intronic
1186192726 X:7082247-7082269 TCTCTAGGATGGAGGAAAGCAGG - Intronic
1186365366 X:8887068-8887090 TCTTGGGGAAGGAGAGAATGAGG + Intergenic
1186449804 X:9662547-9662569 GCTGGGGGATGGGGAGAAGCAGG + Intronic
1187399181 X:18944467-18944489 TCTGGAGGAGGGAGGGAAGGAGG + Intronic
1187557080 X:20362359-20362381 CCTGGGGGAAGCAGGGAAGCGGG - Intergenic
1188658218 X:32725696-32725718 ACTAGGGGGTGGAGGTAAGCTGG + Intronic
1189406321 X:40728319-40728341 TCTGGGGTATGAAGGGAAACTGG - Intronic
1189539092 X:41967531-41967553 AGTTGGGGATGCAGGAAAGCTGG + Intergenic
1189700825 X:43715388-43715410 GCTAGGGGATGCAGGGAAGATGG + Intronic
1189809521 X:44768344-44768366 CCTAGAGGATGGAGGGAAGTGGG + Intergenic
1189834311 X:45005071-45005093 TCTTAGGTATGGAGGGAAATGGG + Intronic
1190442874 X:50493516-50493538 TCTTGAAGGTGGAGGGGAGCTGG - Intergenic
1190625367 X:52332253-52332275 GCTAGGGGTTGGAGGGAGGCAGG - Intergenic
1190732759 X:53235824-53235846 GCTTGTGGGTGCAGGGAAGCGGG - Exonic
1191704199 X:64076484-64076506 TCATGGAGATGGAGGGTAGAAGG + Intergenic
1192075785 X:67994716-67994738 ACTTGAGGGTGGAGGGAGGCAGG - Intergenic
1192181124 X:68916455-68916477 TCCTGGGGAGGGAAGGAAGCCGG - Intergenic
1192706976 X:73536906-73536928 TGTTTGGGGTGGAGGGAAGGGGG - Intergenic
1193160582 X:78224603-78224625 ACTTGAGGATGGAGAGTAGCAGG + Intergenic
1195000592 X:100639614-100639636 TGGTAGGGATGGAGGGAGGCTGG - Intronic
1195126385 X:101813319-101813341 TCTTGGGCATGGAAGCAGGCGGG + Intergenic
1195516572 X:105783404-105783426 GCCTGGGGAAGGAGGGAAGTAGG - Intergenic
1196154551 X:112413660-112413682 TCATGGGGATAGAGGGTAGAAGG + Intergenic
1197186988 X:123598644-123598666 TTTTGGGGATGGTGAGAAGGTGG - Intergenic
1197254318 X:124246660-124246682 TGTTGGGGATGTAGGGAAATGGG - Intronic
1197383125 X:125769886-125769908 TCATGGGGAGGGAGGGAAGCAGG - Intergenic
1197452163 X:126632785-126632807 TCATGGAGATGGAGAGAAGAAGG - Intergenic
1197708516 X:129650503-129650525 TCTTGGGGAAAGAGGGAAGGAGG - Intronic
1199102184 X:143815496-143815518 TCATGGGGATAGAGGGTAGAAGG + Intergenic
1199411778 X:147532434-147532456 TATTGGGGATGTATGGGAGCAGG - Intergenic
1199942654 X:152640224-152640246 CCATGGGGAGGGAGGGGAGCAGG + Intronic
1200114331 X:153763531-153763553 TCATGGGCATGGAGAGAGGCGGG - Intergenic
1200409757 Y:2849561-2849583 TCTTGGGGCTGGAGGACAGAAGG + Intronic
1200519679 Y:4195555-4195577 GCTTGGGCATGGTGGGATGCAGG + Intergenic
1201564567 Y:15352987-15353009 TCTCTAGGATGGAGGAAAGCAGG - Intergenic
1201933565 Y:19380957-19380979 TGTTGGGGTTGGAGGGAAGATGG - Intergenic