ID: 1169254186

View in Genome Browser
Species Human (GRCh38)
Location 20:4084829-4084851
Sequence CTCTGGGTCTGATGGTCAGG AGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 3 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1169254180_1169254186 11 Left 1169254180 20:4084795-4084817 CCTAGACTCAGATGTCCTCAGTC No data
Right 1169254186 20:4084829-4084851 CTCTGGGTCTGATGGTCAGGAGG No data
1169254179_1169254186 30 Left 1169254179 20:4084776-4084798 CCAAAAAGTTGAAGTCTCTCCTA No data
Right 1169254186 20:4084829-4084851 CTCTGGGTCTGATGGTCAGGAGG No data
1169254181_1169254186 -4 Left 1169254181 20:4084810-4084832 CCTCAGTCTTCATCACTCTCTCT No data
Right 1169254186 20:4084829-4084851 CTCTGGGTCTGATGGTCAGGAGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1169254186 Original CRISPR CTCTGGGTCTGATGGTCAGG AGG Intergenic
No off target data available for this crispr