ID: 1169256635

View in Genome Browser
Species Human (GRCh38)
Location 20:4104905-4104927
Sequence ACAAATATGGCAAAGATGGA GGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 5 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1169256635_1169256639 -4 Left 1169256635 20:4104905-4104927 CCCTCCATCTTTGCCATATTTGT No data
Right 1169256639 20:4104924-4104946 TTGTAAGCTTCATCCTTCAGAGG No data
1169256635_1169256643 18 Left 1169256635 20:4104905-4104927 CCCTCCATCTTTGCCATATTTGT No data
Right 1169256643 20:4104946-4104968 GGTCTCACATTAGCATGGTCAGG No data
1169256635_1169256644 19 Left 1169256635 20:4104905-4104927 CCCTCCATCTTTGCCATATTTGT No data
Right 1169256644 20:4104947-4104969 GTCTCACATTAGCATGGTCAGGG No data
1169256635_1169256640 -3 Left 1169256635 20:4104905-4104927 CCCTCCATCTTTGCCATATTTGT No data
Right 1169256640 20:4104925-4104947 TGTAAGCTTCATCCTTCAGAGGG No data
1169256635_1169256642 13 Left 1169256635 20:4104905-4104927 CCCTCCATCTTTGCCATATTTGT No data
Right 1169256642 20:4104941-4104963 CAGAGGGTCTCACATTAGCATGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1169256635 Original CRISPR ACAAATATGGCAAAGATGGA GGG (reversed) Intergenic
No off target data available for this crispr