ID: 1169260497

View in Genome Browser
Species Human (GRCh38)
Location 20:4134829-4134851
Sequence GAGGGAGAACTGAAGGAGGA GGG
Strand +
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 2203
Summary {0: 1, 1: 1, 2: 9, 3: 181, 4: 2011}

Found 1 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1169260489_1169260497 12 Left 1169260489 20:4134794-4134816 CCATGAGACAGGGAGAGATGGAA 0: 1
1: 0
2: 8
3: 48
4: 428
Right 1169260497 20:4134829-4134851 GAGGGAGAACTGAAGGAGGAGGG 0: 1
1: 1
2: 9
3: 181
4: 2011

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1169260497 Original CRISPR GAGGGAGAACTGAAGGAGGA GGG Intronic
Too many off-targets to display for this crispr