ID: 1169262185

View in Genome Browser
Species Human (GRCh38)
Location 20:4147356-4147378
Sequence GTTTATCTTTAGAAGGTGAA CGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 344
Summary {0: 1, 1: 0, 2: 0, 3: 15, 4: 328}

Found 1 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1169262185_1169262193 23 Left 1169262185 20:4147356-4147378 CCGTTCACCTTCTAAAGATAAAC 0: 1
1: 0
2: 0
3: 15
4: 328
Right 1169262193 20:4147402-4147424 CACTCTCCACCACATGAATTAGG 0: 1
1: 0
2: 0
3: 13
4: 120

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1169262185 Original CRISPR GTTTATCTTTAGAAGGTGAA CGG (reversed) Intronic
900359344 1:2280536-2280558 GTTTCTCTTTAAAAGGTGTGTGG - Intronic
904610591 1:31724154-31724176 GTGAATCTTTAGCGGGTGAAGGG - Intergenic
905707567 1:40073057-40073079 GTTGATCTCCAGAAGGAGAAAGG + Exonic
907007192 1:50927083-50927105 GTTAATGTTTAGAAGCAGAAAGG + Intronic
908928293 1:69284154-69284176 GTTTATCTTAAGAATAAGAATGG - Intergenic
911391597 1:97251446-97251468 GCTTATATTTTAAAGGTGAATGG + Intronic
916378330 1:164180750-164180772 GATTGGATTTAGAAGGTGAAAGG + Intergenic
916648224 1:166810123-166810145 GTTTTTTTTTATATGGTGAAAGG - Intergenic
917299394 1:173557167-173557189 ATTTATGTTGAGAATGTGAAAGG - Intronic
917470195 1:175319925-175319947 GGTTATTTCTGGAAGGTGAAGGG - Exonic
920537863 1:206751824-206751846 GTTTATCTTGAGAACGTGTATGG - Intergenic
921254965 1:213330770-213330792 TCTTTTCTTGAGAAGGTGAACGG + Intergenic
921376901 1:214483962-214483984 GCTTATCTTTTGGAGATGAAAGG - Intronic
922212252 1:223495342-223495364 GTTTCTCTTTAGAAGCCAAATGG - Intergenic
922333812 1:224602059-224602081 GTTGATCTTATGAAGGTGGAAGG - Intronic
923235323 1:232027317-232027339 GTATATGGTTAGAAGTTGAAAGG - Intronic
923424213 1:233852825-233852847 GATTTTCTTCAGTAGGTGAACGG + Intergenic
923537113 1:234861494-234861516 GTTTTTCTTTAGATGGGCAAAGG + Intergenic
924112130 1:240710694-240710716 ATTTATGTTTAGAAGGTATACGG - Intergenic
924158641 1:241207269-241207291 CTTGATCTTTAGAAGGGAAAGGG - Intronic
1063926189 10:10979936-10979958 GTTTATTTTAAGAAAGTCAAGGG + Intergenic
1066762300 10:38767066-38767088 GGTAATCTTCAGAGGGTGAAAGG + Intergenic
1066959291 10:42205404-42205426 GTTAATCTTCAGAGGGTGAAAGG - Intergenic
1067306032 10:45064935-45064957 CTTTGTGTTTAGAAAGTGAAGGG + Intergenic
1070951886 10:80437590-80437612 GTTTATGTTTGGGAGGGGAAGGG + Intergenic
1071036179 10:81248668-81248690 GTTTACCTTTAGAAAATAAAGGG - Intergenic
1071081132 10:81812748-81812770 GATGTTCTTTAGTAGGTGAATGG + Intergenic
1071812132 10:89194456-89194478 TTTAATCTTTGGAAGGTAAAGGG - Intergenic
1072412048 10:95211866-95211888 CTTTCTCTTTAGACGGTGGATGG + Exonic
1072765662 10:98093254-98093276 GTTTTGCTTTTCAAGGTGAATGG + Intergenic
1072962203 10:99939606-99939628 GTTTAGTTTTAGAAAGTGGAAGG - Intronic
1074328638 10:112479676-112479698 GATTATTTTCAGAAGTTGAATGG - Intronic
1076100494 10:127773983-127774005 GTTCATCTTTGGAAGGTCCAGGG + Intergenic
1076322080 10:129590632-129590654 GTTTCTCATTAGACTGTGAATGG - Intronic
1078173115 11:8944975-8944997 GATTTCCTTTAGTAGGTGAACGG - Intergenic
1079614769 11:22478664-22478686 GTTTTTCTTTATAAAATGAAGGG + Intergenic
1081092782 11:38893756-38893778 GTTTATCAGGAGAAGGTGACTGG + Intergenic
1081291977 11:41337513-41337535 GTTAATTTTTATAAGGTGTAAGG - Intronic
1081686406 11:45046320-45046342 GTTTATATTTGGAAAGAGAAAGG + Intergenic
1081920391 11:46769936-46769958 CTCTATCTTAAGAAGGTTAAAGG - Intronic
1082581116 11:54870662-54870684 GTTTAACTTTGCAAGATGAATGG + Intergenic
1082582299 11:54886983-54887005 TTTTATCTATACAAGATGAATGG - Intergenic
1084522121 11:69669989-69670011 GTTTTTTTTTAAATGGTGAAGGG - Intronic
1085179249 11:74519818-74519840 GTTTATGGCTAGAAGTTGAAAGG + Intronic
1086238768 11:84663664-84663686 ATTTATTTTTTGAAAGTGAAAGG - Intronic
1086418420 11:86613074-86613096 GTTAATTTTTGTAAGGTGAAAGG + Intronic
1087477800 11:98659304-98659326 ATTTATTTTTAGAAAGTGAGAGG + Intergenic
1088077293 11:105866136-105866158 GTTTATTTTTAAAACGTAAATGG + Intronic
1088416808 11:109598229-109598251 GTTTATTTTTAAATGTTGAAAGG + Intergenic
1088649951 11:111948718-111948740 GTTTATCTGCTGAGGGTGAAAGG - Intronic
1088675377 11:112187557-112187579 GTTTATCTGCTGAGGGTGAAAGG - Intronic
1089056609 11:115590742-115590764 TTTTCTCTTAGGAAGGTGAATGG + Intergenic
1090233100 11:125124256-125124278 GCTTTTCTTTGGAAGGAGAAAGG + Intergenic
1090617537 11:128529222-128529244 ATTAAACTTGAGAAGGTGAAAGG - Intronic
1092276094 12:7061958-7061980 GCTTTTCTTGAGAAGATGAAGGG - Intronic
1092699414 12:11210802-11210824 GATGTTCTTTAGTAGGTGAATGG + Intergenic
1093351760 12:18111468-18111490 ATTTATCTATAGTTGGTGAATGG + Intronic
1095916239 12:47482104-47482126 TTTAATTTTTACAAGGTGAATGG - Intergenic
1096200981 12:49682778-49682800 TTTTATCTTTTGAAGGGGCAAGG - Intronic
1096426557 12:51508862-51508884 GTTTTTCTTTCTTAGGTGAAGGG + Exonic
1097871135 12:64603194-64603216 CTTTATCTTTCAAAGGAGAAAGG + Intergenic
1098681686 12:73364215-73364237 TTTTATCTTGAGAAAGTGAATGG - Intergenic
1098763029 12:74448773-74448795 GTCTGTCTTTAGAGGATGAATGG - Intergenic
1100176730 12:92039054-92039076 GTGTATCTGTAGAAGTTGGAAGG - Intronic
1103248958 12:119483421-119483443 CTTTATCTTTAAAAAGGGAAGGG + Intronic
1103289694 12:119835147-119835169 GTTTATCATCAAAAGGAGAAAGG - Intronic
1104296166 12:127515890-127515912 CTTTATCTTTAAAAAGTGAGAGG - Intergenic
1105165531 13:17504484-17504506 GTTCATCTCTATGAGGTGAATGG - Intergenic
1105176657 13:17678371-17678393 GTTCATCTCTATAAGTTGAATGG - Intergenic
1105177936 13:17698269-17698291 GTTCATCTTTATGAGTTGAATGG - Intergenic
1105181849 13:17758945-17758967 GTTCATCTCTATGAGGTGAATGG - Intergenic
1105196758 13:17990935-17990957 GTTCATCTCTATGAGGTGAATGG - Intergenic
1105198962 13:18025619-18025641 GTTCATCTCTATAAGTTGAATGG - Intergenic
1105770726 13:23609362-23609384 GTTTATTTTTGGGAGCTGAAAGG - Intronic
1106004097 13:25752469-25752491 ATTTATCTTAAGAAAGTAAATGG + Intronic
1106037812 13:26060660-26060682 CTTTAGCTTTAGAAGGAGAGGGG + Intergenic
1106489696 13:30208659-30208681 GTTCCTCTTTAGAAAGTGCACGG + Exonic
1108772080 13:53715893-53715915 ATTTATCTTTGAAGGGTGAAGGG - Intergenic
1108959644 13:56208774-56208796 GTCAATATTTAGAAGGTAAAGGG - Intergenic
1110113658 13:71783305-71783327 GTTTATGTTCAGAATGAGAATGG - Intronic
1110636919 13:77777053-77777075 GTTTATATTGGGAAAGTGAAGGG - Intergenic
1110708128 13:78618687-78618709 GTGTTTTTTTAGAAGTTGAAGGG - Intronic
1116765203 14:49062168-49062190 GTGTCTCTTTATAAAGTGAAGGG - Intergenic
1117268548 14:54116665-54116687 GTTTCTCATTAGTAGGTGTAGGG - Intergenic
1118261039 14:64246833-64246855 GTTATTCTGTAAAAGGTGAATGG + Intronic
1202933634 14_KI270725v1_random:63319-63341 GGTAATCTTCAGAGGGTGAAAGG + Intergenic
1123508997 15:20977140-20977162 GGTTACTTTTAGAAGGTGATTGG - Intergenic
1123566220 15:21550887-21550909 GGTTACTTTTAGAAGGTGATTGG - Intergenic
1123602482 15:21988174-21988196 GGTTACTTTTAGAAGGTGATTGG - Intergenic
1124146908 15:27136442-27136464 TTTTAACTTTAGAGGGTGGAAGG + Intronic
1124224865 15:27884569-27884591 GTTTATTTTTAGAACGAGAGTGG - Intronic
1127126371 15:55816350-55816372 GTTTATCTTAAGAAGTTTTATGG - Intergenic
1127886975 15:63210039-63210061 TTTTATCTTTAAAAGATAAATGG - Intronic
1128398409 15:67253118-67253140 TTTTATAGATAGAAGGTGAAGGG + Intronic
1128822264 15:70669235-70669257 CTTTAGCATTAGAATGTGAAAGG - Exonic
1130154881 15:81341673-81341695 TCTTATCTTTAGAAGGTGGAGGG - Intronic
1131085787 15:89574942-89574964 GTTTATCTGCAGAAGGTAATCGG - Intergenic
1131698958 15:94911415-94911437 TTTTCTCTTTTGAAGATGAAGGG - Intergenic
1131917787 15:97289673-97289695 GATGTTCTTTAGTAGGTGAATGG - Intergenic
1202974587 15_KI270727v1_random:277976-277998 GGTTACTTTTAGAAGGTGATTGG - Intergenic
1138817101 16:60215177-60215199 GTGAAACTTCAGAAGGTGAAGGG - Intergenic
1139385731 16:66568432-66568454 GTTTATTTTTACAATGTCAATGG - Intronic
1139416069 16:66811728-66811750 GATGATTTTTAGAGGGTGAAAGG - Intronic
1139721266 16:68857417-68857439 GATGATCTTCAAAAGGTGAAAGG - Intronic
1140461891 16:75146576-75146598 ATGTATCTTCAGTAGGTGAATGG + Intergenic
1142503647 17:348898-348920 GTTAATCTCTGGAAGGTGCACGG + Intronic
1143840793 17:9730216-9730238 TTTTCTCTTAAGAAGGAGAATGG + Intergenic
1146711295 17:35043970-35043992 CTTTATCTTTAGAAGGTTGGGGG - Intronic
1149270821 17:54975590-54975612 TTTAACCTTTAGAAGGTTAAAGG + Intronic
1150115446 17:62544723-62544745 GTTTATTTATAGAAACTGAAAGG - Intronic
1151108736 17:71650235-71650257 GTTGAGCTTAAGATGGTGAATGG + Intergenic
1152712318 17:81878472-81878494 GTTTACCTTTGGAAGTTGTAAGG - Intergenic
1153120314 18:1716697-1716719 GAGTACCTTTAGAAAGTGAATGG + Intergenic
1153412591 18:4810407-4810429 CTCCATCTTTAGGAGGTGAAAGG - Intergenic
1153510675 18:5848350-5848372 TTCTATCTTTGGAGGGTGAAAGG - Intergenic
1156280851 18:35636554-35636576 ATTTCTCTTTGGAATGTGAATGG + Intronic
1157445189 18:47739128-47739150 GTATATCTTTAGATGATAAAGGG - Intergenic
1159121628 18:64177869-64177891 ATTTATCTTTAGAAAATGAAGGG - Intergenic
1159766268 18:72492443-72492465 GATTACCTTTATAACGTGAATGG - Intergenic
1164359077 19:27480803-27480825 GTTTAACTTTGAAAGATGAACGG - Intergenic
1164505454 19:28856989-28857011 TATTATCTTTATAAGGTGGACGG - Intergenic
1164629085 19:29749398-29749420 GTTTATTTTTAGACATTGAAGGG - Intergenic
1166625868 19:44355639-44355661 GCTTATCTTTAAAATGGGAATGG + Intronic
925160365 2:1679047-1679069 GTTTATTTTGGTAAGGTGAAAGG - Intronic
928050124 2:27984164-27984186 ATTTATTTTTAGAATGTCAAGGG + Intronic
928173619 2:29019639-29019661 GTTTATGTTTGGCAGGTGAGCGG + Intronic
928738082 2:34315924-34315946 GTGAACCTTTAGAAGGTGAAAGG + Intergenic
929861362 2:45680743-45680765 ATTTATCTTCACAAGTTGAAAGG - Intronic
931267875 2:60676373-60676395 GTTCATCTTTAAAAAGAGAAAGG - Intergenic
931316417 2:61136795-61136817 TTTTATTTTTAGTAGGTGCAGGG - Intronic
932058748 2:68473392-68473414 GATGACCTTTAGTAGGTGAATGG - Intronic
933283797 2:80361936-80361958 GTTTATCTTAAGAACATGTATGG - Intronic
933359683 2:81265040-81265062 GATATTCTTTAGTAGGTGAATGG - Intergenic
933360658 2:81279452-81279474 TTTTATGTATAGAAAGTGAAAGG + Intergenic
933607406 2:84397978-84398000 GATTTTCTTTTGAAGATGAAAGG - Intergenic
934325613 2:92011681-92011703 GGTAATCTTCAGAGGGTGAAAGG + Intergenic
934463968 2:94242311-94242333 GGTAATCTTCAGAGGGTGAAAGG + Intergenic
936791332 2:116157018-116157040 GTGAACCTTTAGAAGGTAAAAGG - Intergenic
939050973 2:137307498-137307520 GTGTGTCTTCAGAAGGTAAATGG - Intronic
939225445 2:139358271-139358293 GTTTAAGATTAGAAGGTAAAAGG + Intergenic
939234386 2:139472149-139472171 GTTTATTATCAAAAGGTGAAAGG + Intergenic
939928946 2:148208054-148208076 CTTATTCTTTAGAAGGAGAATGG - Intronic
941278566 2:163521367-163521389 ATTTATATTTAGAAGGAAAATGG + Intergenic
941300559 2:163795801-163795823 GTTAACCTTCAGAGGGTGAAGGG + Intergenic
942452771 2:176118420-176118442 ATTTATCTTTTGAAAGAGAATGG + Intronic
942895480 2:181048075-181048097 GTTTATCAGTAGAAGCTGAAAGG - Intronic
942990689 2:182197922-182197944 GCTTATTTGTAGAAGTTGAAAGG - Intronic
943071719 2:183148965-183148987 GATTATCTATAGAAGGTGGGGGG - Intronic
943224725 2:185156675-185156697 GTTTAACTTTGGAATGTTAAAGG + Intergenic
943881696 2:193153654-193153676 GTTAATCTTTACAATGTAAAAGG + Intergenic
944052951 2:195491928-195491950 TTTTACCATTATAAGGTGAAGGG - Intergenic
944514833 2:200502406-200502428 GTTAGTCAGTAGAAGGTGAATGG - Intronic
945616133 2:212069574-212069596 GTTTATTTTTAAAAGGTGTTCGG + Intronic
946391583 2:219419561-219419583 GTGTCTTTTTACAAGGTGAATGG + Intronic
947314336 2:228839168-228839190 GTTTCTGTTTAGAAGTTTAAGGG + Intergenic
1169262185 20:4147356-4147378 GTTTATCTTTAGAAGGTGAACGG - Intronic
1170051126 20:12146626-12146648 ATTAATTTTTAGAAGGTGTAAGG + Intergenic
1170055171 20:12194212-12194234 GTTTTATTTTAGAAGGTCAAAGG + Intergenic
1170771080 20:19332974-19332996 GTTTTTCTTTAGCAGGCTAAAGG + Intronic
1170971286 20:21118949-21118971 ATTTATGTTTACAAGGTGACAGG - Intergenic
1170993335 20:21326087-21326109 TTTTATCTGTAGAAAGTGGATGG - Intronic
1171571987 20:26261179-26261201 GTTAATTTTTATAAGGTGTAAGG + Intergenic
1172321845 20:34000976-34000998 ATTTATCTCTGGAAGGAGAAAGG + Intronic
1173052528 20:39577505-39577527 GGTCATCATTAAAAGGTGAATGG - Intergenic
1175633910 20:60564780-60564802 GTTTATCCATAGAAAGGGAAGGG - Intergenic
1176595034 21:8685475-8685497 GGTAATCTTCAGAGGGTGAAAGG + Intergenic
1177320838 21:19518237-19518259 TTTTATTTTTAGAAGATAAATGG - Intergenic
1179574051 21:42295991-42296013 GTTTGTCTTAAGAAGGTGGTGGG + Intronic
1180277887 22:10662633-10662655 GGTAATCTTCAGAGGGTGAAAGG + Intergenic
1180585121 22:16881466-16881488 GGTAATCTTCAGAGGGTGAAAGG + Intergenic
1182036819 22:27205314-27205336 AGTTATGTTTAGAAGGTGAGGGG + Intergenic
1183783419 22:40014470-40014492 GTTTATCCTAAGAATGTTAAGGG - Intronic
1185353021 22:50347974-50347996 GTTAATCTTTGGAATGTGAGAGG + Intronic
949764507 3:7511358-7511380 GTTTATCTTTGAAGGGAGAAGGG - Intronic
952270038 3:31821437-31821459 GATTTACTTTAGAAGGTAAAAGG - Intronic
954859851 3:53678507-53678529 ATTTATCTTTAGAAGTTTAAGGG + Intronic
957832860 3:85545782-85545804 TTTTTTCCCTAGAAGGTGAATGG - Intronic
958502560 3:94933241-94933263 GATTGTCATTAGAAGGTGGATGG + Intergenic
959679135 3:109072705-109072727 GGATATCTTCAGAAGATGAAAGG + Intronic
959891914 3:111566254-111566276 ATTTATCTTAAGTAGCTGAATGG + Intronic
960210173 3:114955124-114955146 GTTTATCCTGAGTTGGTGAAGGG - Intronic
963330767 3:143912602-143912624 GTATATCTTTATATGGTGAAGGG - Intergenic
965178223 3:165364314-165364336 GTTTATTTTTAAAAGATGACAGG - Intergenic
965423360 3:168490258-168490280 GCTTATCTTCATAGGGTGAATGG - Intergenic
967722544 3:192830625-192830647 GTACATCTTGAGAAGGAGAAAGG + Intronic
968798853 4:2728723-2728745 GTTTATATTTAGAATATGATAGG + Intronic
969440656 4:7214931-7214953 GGTAATCTTTAGAAAGTGAGAGG + Intronic
969944077 4:10764893-10764915 GGTCATTTTTAGAATGTGAAAGG - Intergenic
970737203 4:19186622-19186644 TTTTAAATTTAGCAGGTGAAAGG - Intergenic
971125966 4:23755175-23755197 GATTATCTTCTGAAAGTGAAGGG - Intronic
971770938 4:30896127-30896149 GTTGTTCATTAGAAAGTGAAAGG - Intronic
972780627 4:42283916-42283938 GTTTGTTCTTAGAAGCTGAAAGG + Intergenic
974599285 4:64055590-64055612 GTTAATTTTTATATGGTGAAAGG + Intergenic
975859767 4:78664224-78664246 GTATTTCTTTATAATGTGAAAGG + Intergenic
976120938 4:81780585-81780607 TATTATTTTAAGAAGGTGAAGGG - Intronic
977262334 4:94812790-94812812 GTTTGTCATTAGAAATTGAAAGG + Intronic
978158642 4:105518511-105518533 GATTATTTTGAGATGGTGAATGG - Intergenic
978415567 4:108472278-108472300 AATTTTCTTTAGCAGGTGAATGG + Intergenic
978815778 4:112903164-112903186 GTTTCTCATTGGAAGGTGGAGGG + Intronic
979044338 4:115842599-115842621 GTACATATTTAGGAGGTGAAAGG + Intergenic
979744082 4:124188077-124188099 TTTTAACTTTAGAAGTAGAATGG - Intergenic
981333100 4:143535541-143535563 GGTTATCTGTAGAAGGTGGTTGG + Intronic
981467408 4:145089275-145089297 GTTAATTCTTAGAAGGTTAATGG - Intronic
981496226 4:145396817-145396839 GATTCTCTTTGGAAGCTGAATGG - Intergenic
981507414 4:145518072-145518094 GTTTCTCTTCAGAAGGTACAGGG - Intronic
982675917 4:158375597-158375619 GTTTATCTTTAAAAAATGGATGG - Intronic
983054863 4:163089917-163089939 GTTTGTGTTTAGCAGGAGAATGG - Intergenic
983074817 4:163313294-163313316 GATGTTCTTCAGAAGGTGAATGG - Intergenic
984003126 4:174274985-174275007 GTCTATATTTGGAAGATGAAAGG + Intronic
986185577 5:5433353-5433375 GATTCTTTTGAGAAGGTGAAGGG - Intronic
987885941 5:23812273-23812295 TTTTATTTTTAGGGGGTGAAAGG + Intergenic
987911749 5:24155488-24155510 GTTTGACTTTAGAAAGTGGAAGG + Intronic
988659139 5:33245774-33245796 TTTCAGCTATAGAAGGTGAAAGG + Intergenic
988977253 5:36527453-36527475 ATTTGTCTTTAAAAGATGAAGGG + Intergenic
989849195 5:46187162-46187184 GTTTAAGTTTAGGAGATGAATGG - Intergenic
989850280 5:46199825-46199847 GTTTAACTCTAGGAGGTAAAAGG + Intergenic
990350935 5:54915375-54915397 GTTTATATGCAGAAGGTTAAAGG - Intergenic
991262397 5:64681003-64681025 GTATATCATTAGAAGGAGATGGG - Intergenic
992213352 5:74502450-74502472 GTTTTTCTTTAAAGGCTGAAGGG + Intergenic
992600833 5:78397807-78397829 GTTTCTCCTTAGAAGATAAATGG + Intronic
993208261 5:84914081-84914103 CTTTATCTTCAAAAGGTGAGGGG + Intergenic
993247454 5:85468746-85468768 GCAAATCTTCAGAAGGTGAAGGG - Intergenic
993528828 5:89000680-89000702 ATTTATCCTTAGAAGGCAAAAGG - Intergenic
993855067 5:93064170-93064192 ATGTGTCTTTAGAAGGAGAAAGG - Intergenic
994238906 5:97397068-97397090 GATTCTCTTTAGAAATTGAATGG + Intergenic
994439690 5:99786761-99786783 GATGTTCTTTAGTAGGTGAATGG - Intergenic
995397204 5:111699547-111699569 ATTTTTCTTGAGAGGGTGAAGGG - Intronic
995623170 5:114050239-114050261 GTATATCTTTAAAAGGAGAATGG - Intergenic
995856933 5:116602723-116602745 GTTTATCTTAGAAAGGTGAAAGG + Intergenic
997374591 5:133388214-133388236 ATTTCTCTGTAGAATGTGAAGGG + Intronic
997506963 5:134425319-134425341 GTGAATCTTCAGAGGGTGAAGGG + Intergenic
999566345 5:152866803-152866825 GATTTTCTTTAGCAGGTGAGAGG - Intergenic
999793634 5:154966933-154966955 GTTTATTTTTAGAAAATAAATGG - Exonic
999848128 5:155507653-155507675 GTTTGTGTTAAGAAGGTGGATGG - Intergenic
1003880939 6:10479096-10479118 GTTTAATTATGGAAGGTGAAGGG + Intergenic
1004711337 6:18173574-18173596 GAGTATGTTTACAAGGTGAAAGG - Intronic
1005631757 6:27714744-27714766 GTTTATCTTTGGAATGTGGGGGG - Intergenic
1005764946 6:29002081-29002103 CTTTAGCTTTAGAAATTGAAAGG + Intronic
1006095771 6:31655840-31655862 GTTACTCATTAGCAGGTGAAAGG + Exonic
1006704501 6:36007164-36007186 GTTTATCTTTTTAATATGAATGG - Intronic
1008257884 6:49326616-49326638 GTTTGTCCTTAAAAGGAGAAAGG + Intergenic
1008819450 6:55612775-55612797 GTTAATTTTTATAAGGTGTAAGG - Intergenic
1008888744 6:56460353-56460375 ATTCCTCTTTAGGAGGTGAAGGG + Intronic
1008890283 6:56480569-56480591 GTTTTTCTTTGAATGGTGAATGG + Intronic
1009031965 6:58070076-58070098 GTGAATCTTCAGAGGGTGAAGGG - Intergenic
1009207792 6:60824528-60824550 GTGAATCTTCAGAGGGTGAAGGG - Intergenic
1009761912 6:68018035-68018057 GTTGATATTTTGAAGGTAAAAGG + Intergenic
1010275256 6:73961700-73961722 GTTTATCTTGAGAACATGTACGG + Intergenic
1010430578 6:75773971-75773993 TTTCATCTTTATAAGGTGACTGG + Intronic
1010808635 6:80269808-80269830 ATTTATCTTAAAAAGGTAAATGG + Intronic
1011799839 6:90999931-90999953 GTTTATCATTAAAAGCAGAAGGG + Intergenic
1012107150 6:95177398-95177420 GTTTATTTTGAAAAGATGAAAGG + Intergenic
1012163439 6:95917767-95917789 GATTAACTTTAGTCGGTGAACGG + Intergenic
1012856689 6:104510113-104510135 ATTTACTTTTAGAAGATGAAAGG + Intergenic
1014916338 6:127153557-127153579 GTTTATAGTCAGAAGATGAAAGG - Intronic
1015788421 6:136941989-136942011 GTTTCTCTTTGGAAGCTGGATGG + Intergenic
1016591079 6:145743913-145743935 GTTTATCTGTTAAAGGTGCAAGG - Intergenic
1017380886 6:153827880-153827902 GTTTATTGTTTGAAGCTGAAAGG + Intergenic
1018516653 6:164587496-164587518 TTTTATTTTTAAATGGTGAATGG + Intergenic
1018559252 6:165084564-165084586 GATTATCTATGGAAGGTGTAAGG - Intergenic
1020680082 7:11226050-11226072 GTTTATCTATTGATGGTGAGTGG + Intergenic
1020799551 7:12717042-12717064 GTTTTTATTTAGATGGTGTAGGG + Intergenic
1022693440 7:32681142-32681164 GTTTACCTTAAGAAAGTAAAGGG - Intergenic
1022921117 7:35015737-35015759 GTTTACCTTAAGAAAGTAAAGGG - Intronic
1023540432 7:41258972-41258994 GTTATTCTTCAGCAGGTGAATGG - Intergenic
1025753743 7:64314538-64314560 TTTTATTTTTAAAAGGAGAAAGG - Intronic
1028749994 7:94372388-94372410 GTATGTCTTTAGAAGGGGCAGGG - Intergenic
1029663054 7:101976206-101976228 GTTTATGTTTACAAAATGAATGG - Intronic
1032045169 7:128600414-128600436 GTTTATTTATAGAAACTGAAAGG - Intergenic
1033121425 7:138669868-138669890 GTAAACCTTTGGAAGGTGAAGGG + Intronic
1033920037 7:146379429-146379451 GTTAATCTTAAGAAAGTAAAGGG + Intronic
1034047619 7:147946799-147946821 GCTAACCTTTAGAGGGTGAAGGG - Intronic
1034503876 7:151469906-151469928 GTGTATCTTTAGAAAATTAAGGG + Intronic
1035277458 7:157756574-157756596 GCTGAGCTTTAGAAGGTTAAAGG - Intronic
1035973138 8:4275102-4275124 GGTTATCTTTATAAGGCCAAGGG - Intronic
1036392859 8:8339617-8339639 GTTCATTTTTAGAAGGTGCCTGG + Exonic
1037034180 8:14144889-14144911 GTTTGTCTTTGGAAAGGGAAGGG + Intronic
1037923550 8:22826858-22826880 GTTTATTTTTAGCAGGTAATAGG - Intronic
1038060489 8:23907024-23907046 GATTATCCATAGAAGGTGATGGG - Intergenic
1038923370 8:32110927-32110949 TCTTATCATTAGAAAGTGAAAGG + Intronic
1039062490 8:33582651-33582673 GTTTCTCTTAAAAAGCTGAAAGG - Intergenic
1039069855 8:33639986-33640008 GTTTGTTTTTAACAGGTGAAAGG - Intergenic
1039662497 8:39482525-39482547 GTTTATCTTTAGAATCTTTATGG - Intergenic
1040577168 8:48662929-48662951 GATGTTCTTTAGCAGGTGAATGG - Intergenic
1042010368 8:64238250-64238272 TTTTATGTTTACAAGGTAAATGG - Intergenic
1042510651 8:69607896-69607918 GTTCCTCTTAACAAGGTGAATGG + Intronic
1043107629 8:76135060-76135082 GTTTAGCTTTTGAATATGAAAGG + Intergenic
1043765708 8:84129594-84129616 GTTTATTTTCAGATGCTGAAAGG + Intergenic
1044658815 8:94575456-94575478 GATTTTCTTTAGTAGGTGAATGG + Intergenic
1044706913 8:95017795-95017817 GTTCATTTTTAGGAGGTGACTGG - Intronic
1044794854 8:95886351-95886373 GTTTTTCTGTAAAAGGTAAAAGG + Intergenic
1044875492 8:96661679-96661701 GATGATCTTCAGTAGGTGAACGG - Intronic
1046355483 8:113079105-113079127 ATTACTCTTTAAAAGGTGAATGG - Intronic
1046867456 8:119166644-119166666 GTTTACCTTTAAAGGGAGAATGG - Intronic
1047705256 8:127492813-127492835 TTTTGGCTTTTGAAGGTGAAAGG - Intergenic
1048200031 8:132364914-132364936 GTTTGTCTGTAAAAGGAGAAAGG - Intronic
1048751157 8:137677760-137677782 GTTTATCTTGATAGTGTGAATGG + Intergenic
1050638743 9:7642311-7642333 ATTTTTCTTTAGAAGGCCAAAGG - Intergenic
1050889861 9:10810588-10810610 GTTGATCTTTAGAAACTGAGAGG - Intergenic
1051209880 9:14730124-14730146 GTCTACATTTAGGAGGTGAATGG + Intergenic
1053694059 9:40619109-40619131 GGTAATCTTCAGAGGGTGAAAGG + Intergenic
1053941049 9:43249528-43249550 GGTAATCTTCAGAGGGTGAAAGG + Intergenic
1054270776 9:63021018-63021040 GGTAATCTTCAGAGGGTGAAAGG - Intergenic
1054305304 9:63418333-63418355 GGTAATCTTCAGAGGGTGAAAGG + Intergenic
1054404051 9:64742322-64742344 GGTAATCTTCAGAGGGTGAAAGG + Intergenic
1054437672 9:65227822-65227844 GGTAATCTTCAGAGGGTGAAAGG + Intergenic
1054492731 9:65794145-65794167 GGTAATCTTCAGAGGGTGAAAGG - Intergenic
1054838785 9:69712127-69712149 ATTTATCATTATAAGGTGATAGG - Intronic
1055062789 9:72088021-72088043 ATTCACCTTTAGTAGGTGAATGG - Intergenic
1055518701 9:77059354-77059376 GATTTTCTTCAGCAGGTGAATGG - Intergenic
1056023938 9:82472161-82472183 GTTTCTCTGTACATGGTGAATGG + Intergenic
1057036116 9:91812713-91812735 ATTTTTCTTTACAAGGAGAAAGG - Intronic
1057083427 9:92189188-92189210 TTCTATTTTTAGAAGGTGAGAGG + Intergenic
1059089719 9:111342869-111342891 GATGACCTTTAGTAGGTGAATGG + Intergenic
1059477720 9:114561270-114561292 GTTTGTCTTTGGAAGGTGCAGGG + Intergenic
1059921378 9:119164144-119164166 GTTAATATTTTCAAGGTGAAGGG + Intronic
1060659814 9:125398299-125398321 GTCTATTTTTAGGAGATGAAAGG + Intergenic
1185857799 X:3552040-3552062 GTTCATCTGTAGAATGTGGATGG - Intergenic
1187433528 X:19246557-19246579 GTTTATCTGTAGAAGGAGACAGG - Intergenic
1187823285 X:23310860-23310882 GTTTATCTATAGAACAAGAAAGG + Intergenic
1188682305 X:33025944-33025966 ATGTATCTTTAAAAGGGGAAGGG + Intronic
1191241820 X:58195954-58195976 GTTTATTTTTAGAATGTGTGAGG - Intergenic
1191249337 X:58252841-58252863 CTTTATCTTTAGAATGCCAAGGG - Intergenic
1191588529 X:62855190-62855212 GATCATCCTTAAAAGGTGAATGG - Intergenic
1192276959 X:69642192-69642214 TTTTAGCTTTAGAGGCTGAAAGG + Intronic
1193701597 X:84769328-84769350 GGGTATCTTTAGAAGGGGATTGG - Intergenic
1193866416 X:86737113-86737135 GTCTATTTTTAAAAAGTGAAAGG + Intronic
1194022084 X:88703320-88703342 GTTAATTTTTATAAGGTGTAAGG - Intergenic
1194617972 X:96130864-96130886 GCTTATGTTTAGAAACTGAAGGG - Intergenic
1194821698 X:98515345-98515367 GTTTAAATTGAGAAGGGGAAGGG + Intergenic
1194844744 X:98791076-98791098 GTTAATTTTTATATGGTGAAAGG - Intergenic
1196055174 X:111347958-111347980 GTTTATCTTTGAATGGTGAAGGG + Intronic
1196286725 X:113890845-113890867 GTATGTCTTTAGAGGGTAAAAGG + Intergenic
1196313337 X:114195320-114195342 GATGTTCTTTAGTAGGTGAATGG + Intergenic
1196350002 X:114717702-114717724 GGTTAGCTTTAGAAGTTGCAAGG + Intronic
1196847823 X:119910582-119910604 TTTCATCTTTTGAAGGAGAAAGG - Intronic
1197241136 X:124124440-124124462 GATGTTCTTCAGAAGGTGAATGG + Intronic
1197697076 X:129561753-129561775 GTTTGTCTTTAGAAGGTATGTGG + Intronic
1199254770 X:145706632-145706654 GTTGATCTTCAATAGGTGAATGG + Intergenic
1199629310 X:149765251-149765273 GTTGTTCTTCAGTAGGTGAATGG - Intergenic
1199994569 X:153013321-153013343 GATTTTTTTTAGAAGGTTAAAGG - Intergenic
1201191830 Y:11450662-11450684 GGTAATCTTCAGAGGGTGAAAGG + Intergenic
1201571388 Y:15418939-15418961 GTGTATCTTAACATGGTGAAGGG + Intergenic
1202189777 Y:22229657-22229679 GTTTATCTTGGGAGGGTGTATGG + Intergenic