ID: 1169264691

View in Genome Browser
Species Human (GRCh38)
Location 20:4160773-4160795
Sequence GTCTCCACCTTCAGGGAGGA AGG
Strand +
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 300
Summary {0: 1, 1: 0, 2: 0, 3: 31, 4: 268}

Found 1 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1169264679_1169264691 28 Left 1169264679 20:4160722-4160744 CCATAAGAGAGGTATTTGTGCTG 0: 1
1: 0
2: 0
3: 6
4: 116
Right 1169264691 20:4160773-4160795 GTCTCCACCTTCAGGGAGGAAGG 0: 1
1: 0
2: 0
3: 31
4: 268

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1169264691 Original CRISPR GTCTCCACCTTCAGGGAGGA AGG Intronic
900400128 1:2469622-2469644 GGCTCCACCTTCATTGAGGGTGG + Intronic
900503866 1:3019533-3019555 GTCTCCTAGTTCAGCGAGGAGGG + Intergenic
901253297 1:7798057-7798079 GTCTCCAGCTTCAGTGATGAGGG - Intronic
901449303 1:9326308-9326330 GTCTCCACCTCCAGTGCGCAGGG - Intronic
901922773 1:12548431-12548453 AGCTCCACCTTCAGGGAAGAAGG - Intergenic
902034442 1:13446693-13446715 ATCTCCTCCTGCAGGGAGGAGGG + Intergenic
902375306 1:16027564-16027586 CCCACCTCCTTCAGGGAGGATGG + Intronic
903028172 1:20444318-20444340 TTGTTCACCTCCAGGGAGGAGGG - Intergenic
903812842 1:26044437-26044459 GTACCCACCTGCAGGGTGGAGGG + Exonic
905227740 1:36490610-36490632 GCCTCCACCTTCTTGGTGGATGG + Intergenic
905277020 1:36824902-36824924 GTCTCCTCTTTAAGGGAGGCTGG + Intronic
905422562 1:37858499-37858521 GTTTCAACCTTCTGGGTGGAAGG + Intronic
905932217 1:41797137-41797159 GTGTCCACCATCAAGGAAGATGG + Intronic
905942302 1:41873856-41873878 TTCTCCACCTTCTGGGAGAGGGG - Intronic
906568497 1:46817168-46817190 GTCTCTACCTGCAGGTGGGATGG + Exonic
909010961 1:70334510-70334532 GTCTCAGCCTTCAGGGTGGCTGG - Intronic
910109572 1:83668243-83668265 GTCTCCACCTTTTTGGTGGAGGG - Intergenic
911365473 1:96932566-96932588 ATCTCCTCCTTTAGGAAGGAAGG + Intergenic
916788606 1:168104948-168104970 GTCTCCACCTTAGGGAAGAAAGG + Intronic
920409633 1:205749536-205749558 CTCCCCACCTTCAGCGAGGAGGG - Intronic
920413232 1:205779024-205779046 GACACCAGCTTCAGGGAGGTTGG - Intergenic
921285711 1:213607510-213607532 TTCTCCACCTTTAAGGAGGAAGG - Intergenic
921738277 1:218653731-218653753 GTTTTCACCTTCTGGGAGGTAGG - Intergenic
921823148 1:219640710-219640732 GTCTCTCCCTTCAGGGATGTGGG - Intergenic
924387978 1:243518231-243518253 GTCTTCACCTTCAGGGACAGGGG - Intronic
1063198763 10:3767603-3767625 GACTCATCCTCCAGGGAGGAAGG + Intergenic
1063449897 10:6144554-6144576 GTCTCGTCCTTCGGGAAGGATGG + Intergenic
1064133266 10:12729245-12729267 ATCTCCACCTCCATGGAGCAGGG + Intronic
1064227532 10:13500672-13500694 GACATCACCTTCAGAGAGGACGG + Exonic
1064296203 10:14080963-14080985 GTCTCCACTTACAGAGATGACGG - Intronic
1067187360 10:44042492-44042514 GTCTCCACCTTCACGCATCAGGG - Intergenic
1067199725 10:44156790-44156812 GTCTCCTCCTACAGGGATAAAGG - Intergenic
1067462705 10:46469367-46469389 CTCTCCATTTTCAGGGAGTATGG + Intergenic
1067624490 10:47915270-47915292 CTCTCCATTTTCAGGGAGTATGG - Intergenic
1068687934 10:59888525-59888547 GTCAACAGCTTTAGGGAGGAAGG + Intronic
1069041233 10:63697623-63697645 GTCTCCGCACTCAGGGAGCATGG - Intergenic
1069430795 10:68332372-68332394 ATCTCCCACTTCAGGGAGGGCGG + Intronic
1069544733 10:69319930-69319952 GTCACCACGTTCAGGGTGGGTGG - Intronic
1070315922 10:75312122-75312144 GCCTCCACCTTCTGGGTAGATGG - Intergenic
1070674656 10:78404249-78404271 GTCTGCATCTTCATGGGGGAGGG - Intergenic
1070830546 10:79415532-79415554 TTCTCCACCTTCACCCAGGAAGG - Intronic
1071824267 10:89309158-89309180 GTCTCCACCTTGATGGTGGGTGG + Exonic
1074079168 10:110153736-110153758 TTCTCATCCTCCAGGGAGGAAGG + Intergenic
1074500805 10:114022536-114022558 GTCTTCACTTCCAGGGAGGGAGG - Intergenic
1075394265 10:122115242-122115264 GCCCCCACCTTCAAGGAGGTAGG + Intronic
1075556049 10:123433553-123433575 GTCCCTACCTTCAGAGAGCAGGG + Intergenic
1076615161 10:131750106-131750128 GTGTCCACTTTCAAGGAGGGTGG - Intergenic
1078105372 11:8355012-8355034 GCCTCCAGCTTCCGGGAGGAGGG + Intergenic
1078717947 11:13857640-13857662 GCCTCCACCCTCAGGCAGCATGG + Intergenic
1081671006 11:44942745-44942767 ATCTTGACCTCCAGGGAGGAGGG + Intronic
1081796210 11:45821793-45821815 CTCTCCACTTCCTGGGAGGAGGG + Intergenic
1081851628 11:46278405-46278427 GCCTCCACCTTCTAGGGGGAAGG + Intronic
1081866085 11:46361537-46361559 GTCTCAGGCTGCAGGGAGGAGGG + Intronic
1083627024 11:64077137-64077159 TTCTCCATCATCAGGGAGAAGGG - Intronic
1083852603 11:65376940-65376962 GCCTCCATCTTCCGGGAGGAGGG - Exonic
1085507766 11:77069886-77069908 GTCTCCACCAGCCTGGAGGAGGG - Intronic
1088206030 11:107393868-107393890 GTCTCCAAAAGCAGGGAGGATGG + Intronic
1088994975 11:114988242-114988264 TTCTCCCCCTTCAGGGTGGTTGG - Intergenic
1090804794 11:130196277-130196299 GTCCTCAGGTTCAGGGAGGAGGG + Intronic
1091355195 11:134932393-134932415 GTCTCCAGGATCTGGGAGGAGGG + Intergenic
1091809328 12:3381865-3381887 GTCTCCTCTTTTAGGGAGGTGGG - Intronic
1092009825 12:5100086-5100108 CCCTCTGCCTTCAGGGAGGATGG + Intergenic
1096106878 12:49001219-49001241 TTCTCAACCTTGGGGGAGGAAGG - Intergenic
1096977154 12:55706070-55706092 GGGGCCACCTTCAGAGAGGAGGG + Intronic
1097426018 12:59445776-59445798 GACTCTCCCTTCAGGGAGGTGGG + Intergenic
1097708662 12:62895025-62895047 ATCTCCATCTTCAGAAAGGAAGG + Intronic
1097764158 12:63504778-63504800 GGCTCCACATTCATGGTGGATGG + Intergenic
1098042589 12:66367445-66367467 GTCAGCACTTTCAGGGAGCATGG - Intronic
1098820389 12:75220580-75220602 GACTCCAGCTTCAGGTAAGAAGG - Intergenic
1098861129 12:75711470-75711492 GTTTCCACATTCCAGGAGGAGGG - Intergenic
1099151271 12:79116883-79116905 CTCTCCCCCTCCAGTGAGGAGGG + Intronic
1101052391 12:100876421-100876443 GTTTCCCCCTGCAGGGAGCAGGG + Intronic
1103738081 12:123073064-123073086 GTCTCCAGCTTCCATGAGGATGG + Intronic
1103998668 12:124846303-124846325 GTCTTCACCTGCATGGAGAAGGG - Intronic
1104088135 12:125494015-125494037 GCATCCATTTTCAGGGAGGAGGG - Intronic
1104951002 12:132440058-132440080 GCCTCCACCATGGGGGAGGATGG - Intergenic
1106168239 13:27267999-27268021 TTTTCCCCCATCAGGGAGGAAGG + Intergenic
1108148545 13:47505571-47505593 GTCTCCAGGATCAGGCAGGATGG + Intergenic
1109516140 13:63444295-63444317 GTCCACACCCTCAGGAAGGAAGG + Intergenic
1113007821 13:105727216-105727238 CTCTCCCCCTTGATGGAGGAGGG - Intergenic
1113625077 13:111789122-111789144 GGCAGCATCTTCAGGGAGGATGG - Intergenic
1114139199 14:19892392-19892414 GTCTCACCCTGCAGGGAGGTGGG - Intergenic
1117809809 14:59534359-59534381 CGCTCCACCTTCAGGGAGATGGG - Intronic
1118704482 14:68468214-68468236 GTCTACACCATCAAGGAGGAAGG + Exonic
1119261528 14:73240792-73240814 GGCCCCACCTTTGGGGAGGAGGG + Intronic
1119662656 14:76462828-76462850 CTCTCCTCCTTTAGGGAGGTGGG + Intronic
1120838204 14:89059971-89059993 GTCTCCACTTTCAGAGGGCATGG + Intergenic
1121586624 14:95067419-95067441 GTCTCCACTGTCAGGCAGGCGGG + Intergenic
1202863304 14_GL000225v1_random:98656-98678 GGCTCCACCTCCAGGGGGTATGG + Intergenic
1124250537 15:28104091-28104113 GTCTGCAGCTTGAGGGACGAAGG + Intergenic
1124254894 15:28132254-28132276 GCCTCCACCTTCAGAGAAAAGGG + Exonic
1125281017 15:38042816-38042838 GGCCCCACCTTCAGGGATGCTGG + Intergenic
1127170925 15:56300135-56300157 ATCTCTACCTTCAGGGAAGTAGG - Intronic
1129181870 15:73882826-73882848 GCCTCCGGCTTCAGGGAGGGAGG - Intronic
1130373392 15:83306239-83306261 GTCTCTACCTTAAGGCAGGCGGG - Intergenic
1130838420 15:87674346-87674368 GTCTCCAACTGCAGAGAGTAAGG - Intergenic
1131527412 15:93163670-93163692 GTCTCCACATCCAGGGAGTGAGG + Intergenic
1131919853 15:97313435-97313457 GTCTCCAACTAAAGGAAGGATGG - Intergenic
1132463202 16:65739-65761 GTCACCACATTCAGGAAAGAGGG + Intronic
1132797444 16:1732170-1732192 GTCTCCAGCAGCGGGGAGGAAGG + Intronic
1132939972 16:2501647-2501669 GGCTCCACCCCCAGGGAGGGTGG + Exonic
1133727667 16:8552781-8552803 GGTTTCACCTTCAGGGCGGAAGG - Intergenic
1134098575 16:11435872-11435894 GCCTGCACCTGCAGGGAGGCAGG + Exonic
1135653309 16:24225904-24225926 GACTTCACCTCTAGGGAGGAGGG - Intergenic
1136109247 16:28054278-28054300 GTCCCCACCATCGGGGAAGAAGG + Intronic
1136463653 16:30427613-30427635 GTTTCCACCTTCACAGTGGAAGG - Intronic
1138684093 16:58709490-58709512 GTCTCCAACCTCAAGAAGGAGGG - Exonic
1139529448 16:67535877-67535899 GGCTTCGCCTTCAAGGAGGAGGG + Intronic
1140039094 16:71393639-71393661 GACTCCACCTTCAGGGAAAGAGG + Intergenic
1140282335 16:73566146-73566168 GTCTCCACATGCGGGCAGGAAGG + Intergenic
1140965750 16:79964439-79964461 GTCACCACCTCCAGGGATGAAGG + Intergenic
1142561340 17:811269-811291 GGCCCAACCTTCAGGGAGGGCGG - Intronic
1143162378 17:4880009-4880031 TTCTCCACCCTAACGGAGGATGG - Intronic
1144460047 17:15451264-15451286 GTCTCCACATTCATGGCGGAAGG - Intronic
1144589438 17:16511741-16511763 GTCCCCACAGTCAGGCAGGAAGG - Intergenic
1145749505 17:27345125-27345147 GGCTCCACCTGAAGGGAGGAGGG + Intergenic
1146572108 17:33961779-33961801 GGCTGCCCCTTCAGGCAGGAAGG + Intronic
1147045145 17:37745900-37745922 GCCTCCGCCTTGGGGGAGGATGG + Intergenic
1147204240 17:38825173-38825195 GTCTCCACCGTCATGGGGGGCGG - Exonic
1148044593 17:44735269-44735291 GTTCACACTTTCAGGGAGGAAGG - Intronic
1148327257 17:46790452-46790474 TTCTCAACCTTGAGGGAGGGAGG - Intronic
1148441297 17:47712995-47713017 TTCTCCACCTCCATGGAGGAAGG + Intergenic
1150284907 17:63949126-63949148 CCCTCCATCTTCAGGGAGCAAGG - Intronic
1151137937 17:71965652-71965674 GTCCCCACCTTCAGTCTGGAGGG - Intergenic
1152028676 17:77827792-77827814 GTCTCCACCTGCAGTGATGCCGG - Intergenic
1152596094 17:81238597-81238619 AACGCCACCGTCAGGGAGGACGG + Intronic
1152677823 17:81650776-81650798 GTCTCCACTCCCAGGGAGAACGG - Exonic
1153347145 18:4039200-4039222 GTCTCCACCCTCAAGGACGTTGG - Intronic
1153512494 18:5870639-5870661 GTGTCCACATTCAGTGATGAGGG - Intergenic
1153559526 18:6358054-6358076 TTCTCCACCTTGATGGGGGAAGG - Intronic
1155212987 18:23619146-23619168 GTCTGCAGCTCCAGGGAGGAGGG + Intronic
1156298796 18:35817772-35817794 GGCCCCACCTTCAGGCAGGGAGG - Intergenic
1159941301 18:74410980-74411002 GCCTCCACCTGCCTGGAGGAAGG - Intergenic
1160153023 18:76409694-76409716 ATCTCCAGCTACAGGGAGGGTGG - Intronic
1160755848 19:756901-756923 GTCTCCACCCCACGGGAGGAAGG + Exonic
1161503845 19:4633305-4633327 GTCTTGACCTTGAGGGAGGTGGG + Intergenic
1161788919 19:6346878-6346900 GTCTCAGCCTTCAAGAAGGAAGG - Intergenic
1162808777 19:13152169-13152191 GTCTCCGCGTTCGGGGAGGCGGG - Exonic
1164502226 19:28829552-28829574 GACTGCACTTTCAGGGAAGAGGG + Intergenic
1165174877 19:33921433-33921455 ATCTCCACATTCAGGGATGGAGG - Intergenic
1165299406 19:34959208-34959230 CTTTCCACCTGCAGGGAGGGTGG - Exonic
1166917850 19:46207920-46207942 GACTCCCACTGCAGGGAGGATGG + Intergenic
1166920158 19:46223734-46223756 GACTCCCACTGCAGGGAGGATGG + Intergenic
1167878153 19:52431307-52431329 GACTTCACCTTCTGGAAGGATGG - Intronic
924988955 2:294925-294947 GTCTGCACCTCCAGGAAGGAAGG + Intergenic
925022851 2:585475-585497 GGCTCCAGCTCCAGGGAGGCCGG + Intergenic
925091830 2:1162598-1162620 CTCTGCACCTCCAGGGACGAGGG + Intronic
925912043 2:8580442-8580464 GTCTCAACATTCAGGGAAGTGGG + Intergenic
929268906 2:39950969-39950991 GACTCCATCTCCAGGGAGGGAGG + Intergenic
932480637 2:72037027-72037049 CTCCCCACCTTCAGGGAGCCAGG + Intergenic
932569818 2:72932717-72932739 GCCTCCTCCATCATGGAGGATGG + Intronic
932747715 2:74347925-74347947 GTCTGCCCCTTTGGGGAGGAGGG - Intronic
933820434 2:86106190-86106212 GCCTCGACCTTCAGGAAGGTGGG - Exonic
937419089 2:121739679-121739701 GATTCCACCTTCAGGAAGGAGGG - Intronic
939869416 2:147510474-147510496 GTCTCCTCCTTCTGGGTGGTGGG + Intergenic
941882548 2:170496132-170496154 GTTTCCACCTTTGGGGAGGAGGG - Intronic
943709722 2:191077484-191077506 CACACCAGCTTCAGGGAGGAGGG - Intronic
944389161 2:199199526-199199548 GTCCCCACCAGCAGGGGGGAGGG + Intergenic
944629262 2:201606814-201606836 ATCTCCACCTTCCGGGTTGAAGG - Intronic
944945860 2:204684121-204684143 GTTTCCACCTCTAGGCAGGAAGG + Intronic
946065853 2:216986520-216986542 GTGTCCACTTTCAGGGAGTGAGG + Intergenic
946189783 2:218002195-218002217 GGCTCCAGGTTCAGGGAGGTGGG - Intronic
946642435 2:221799193-221799215 ATGTACACTTTCAGGGAGGAGGG - Intergenic
948124437 2:235554540-235554562 GGCTCCAGCTTTAGGGAGGATGG + Intronic
948310547 2:236982446-236982468 GTCTCCACATTCACTGAAGAAGG - Intergenic
948496051 2:238350666-238350688 GTCTCCACCACAAAGGAGGATGG + Intronic
1169264691 20:4160773-4160795 GTCTCCACCTTCAGGGAGGAAGG + Intronic
1170938037 20:20826614-20826636 GTAGCCACCTTCATGGGGGACGG - Intergenic
1172941077 20:38655178-38655200 GCCTCCATCTTCTGAGAGGAAGG + Intergenic
1174402161 20:50282032-50282054 GCCTCCAGCATGAGGGAGGAAGG - Intergenic
1175835048 20:61988281-61988303 CTGTGCACCTGCAGGGAGGAGGG + Intronic
1175926875 20:62475535-62475557 GTCTTGACCTGCAGGGAAGAGGG + Exonic
1178485304 21:33015733-33015755 GCCTCCACCATCACGGAGGTTGG + Intergenic
1180980645 22:19876585-19876607 GTCTCCACCTTCTGGGAGATAGG + Intronic
1181896357 22:26111326-26111348 GTCTCCACCTTTTGCCAGGAAGG - Intergenic
1182349591 22:29691885-29691907 TTCTTCACCTGCTGGGAGGAGGG + Intronic
1183650413 22:39150402-39150424 GTCTCCACCTTCAGAAGGGGTGG + Intronic
1184285494 22:43468792-43468814 GGGTCCAGCTTCAGGGAAGAAGG + Intronic
1184768170 22:46582894-46582916 GTCACCACAGGCAGGGAGGAAGG - Intronic
949819799 3:8103745-8103767 GTCTGCAAATTCATGGAGGAAGG - Intergenic
950210884 3:11122154-11122176 GTCAGCCCCTTCAGGGAAGAAGG + Intergenic
952269997 3:31821122-31821144 GTCTCAACCTGCTGGGAGCACGG - Intronic
952731333 3:36639562-36639584 ATCTCCAACTTCAGGCAGGTGGG - Intergenic
954363069 3:50132709-50132731 GACTCCACCACCAGGGAGAAGGG + Intergenic
954671657 3:52294348-52294370 CTCCACACCCTCAGGGAGGAGGG - Intergenic
955774021 3:62414805-62414827 TTCTTGACCTCCAGGGAGGACGG + Intronic
955804465 3:62719793-62719815 CTCTCCACCTTCTGGGAGCACGG + Intronic
956129290 3:66038955-66038977 ATCTCTCCCTTCGGGGAGGAGGG - Intergenic
957705047 3:83770133-83770155 GGCTGCACCTTCACGCAGGAGGG - Intergenic
958424965 3:93969256-93969278 GGCACCACATTCAGAGAGGAAGG - Intronic
958937428 3:100272028-100272050 GTCTCCATCCACAGGGAGTATGG + Intronic
959689577 3:109183955-109183977 GTCTACACCTTCATAGATGAGGG + Intergenic
960322879 3:116258709-116258731 GTGTTCACCTTCAGGAAGCAGGG - Intronic
960533560 3:118792528-118792550 GTGTTTTCCTTCAGGGAGGAAGG + Intergenic
961754510 3:129120185-129120207 TTCTCCACCTTGGGGCAGGAGGG + Intronic
962391547 3:134976848-134976870 GTCTCCACCTACTGGGAGGCTGG - Intronic
962852350 3:139317461-139317483 GTATGCACCTTCAGGGAGAACGG + Intronic
964383592 3:156123713-156123735 CCCTGCACCTTGAGGGAGGATGG + Intronic
964476606 3:157103238-157103260 GTCTCAAACTTCTGGGATGAAGG - Intergenic
965181117 3:165404794-165404816 GTCTCCACCTTCAGGACAGCTGG - Intergenic
966105862 3:176333075-176333097 GATACCACCTTCAGGGAGGAAGG - Intergenic
968333342 3:197890873-197890895 GCCTCGACCTTCAGAGAGAAGGG + Intronic
968811840 4:2803542-2803564 GTCTCCAGCTTAAGGGACCAAGG + Intronic
969475612 4:7421018-7421040 GTCTCCATCTCCAAGGAGGAGGG - Intronic
970044090 4:11830273-11830295 GTCTCCAGCTTGAGGGCAGAGGG + Intergenic
971669351 4:29536292-29536314 GTCTCCAGTTTCAGGGAAGAAGG + Intergenic
971768995 4:30871830-30871852 GTCACCACCATCAGCAAGGATGG - Intronic
974819479 4:67047304-67047326 GTACGCACCTTCAGGGAGTATGG - Intergenic
975183845 4:71378213-71378235 ATCTCCACCTTCAGGGCACATGG - Intronic
975293276 4:72702397-72702419 AGCTCCACCTACTGGGAGGATGG - Intergenic
975490617 4:74984401-74984423 TCCTCCACCTTCAGGGCAGATGG - Intronic
975747096 4:77485440-77485462 GTTTACTCTTTCAGGGAGGAGGG + Intergenic
978482140 4:109205374-109205396 GCATCCAGCTTCAGGGAGGCTGG - Intronic
978987477 4:115031413-115031435 GTCTGCACTTTCAGAGTGGATGG - Intronic
980278537 4:130687290-130687312 GACTCCACCTCCAAGGGGGATGG + Intergenic
981298089 4:143156151-143156173 GACTCCACCTTCAGGGTAGTGGG + Intergenic
982920907 4:161273835-161273857 GTGACAACCTTCAGGGAGTAAGG + Intergenic
984720762 4:182970744-182970766 GTCTCCCCCTGAAGGAAGGAAGG + Intergenic
986668923 5:10126572-10126594 GTTTCCACATTCAGAGAGCAGGG + Intergenic
988117870 5:26920144-26920166 GTCTCTCCCTTCAGGGAAGTGGG - Intronic
989657694 5:43761949-43761971 GTCTCTACCTTCAGGGAAGTAGG + Intergenic
990680420 5:58236839-58236861 GACTCCACCTTAAAGGACGACGG + Intergenic
991597336 5:68319145-68319167 CTCACCACCTTCAGGGGGCATGG - Intergenic
992878258 5:81079178-81079200 CTCTCCACCTAGAAGGAGGATGG + Intronic
995538126 5:113157714-113157736 GTCTCCCCCTTAATGGAGGGAGG + Intronic
997394844 5:133550998-133551020 CTCTCCTCCTTTAGGGAGGGAGG + Intronic
998058663 5:139101664-139101686 GTCTCTACTCTCAGGGAGCATGG - Intronic
999467416 5:151820956-151820978 ATCTCCAACTTAAGGCAGGATGG - Intergenic
999710445 5:154313822-154313844 GTCTGCAGCTCGAGGGAGGATGG + Intronic
1000418431 5:161009384-161009406 GTCACCACCACCAGGGATGAGGG - Intergenic
1000955494 5:167537958-167537980 GCTTACACCTTAAGGGAGGAAGG + Intronic
1001013011 5:168115506-168115528 TCCTCCACCTTTTGGGAGGAAGG + Intronic
1001783882 5:174394763-174394785 GTCACCACCTTCAGAGAAGGTGG - Intergenic
1002565592 5:180111456-180111478 GCCCCCATCTTCAGTGAGGATGG - Exonic
1002679405 5:180949368-180949390 TTCTCCATCTGCAGGCAGGATGG - Intronic
1002854737 6:1026854-1026876 CTCTCCACTTCCAGGGAGTATGG + Intergenic
1004285748 6:14318919-14318941 GGATCCACCTTGAAGGAGGAGGG - Intergenic
1005365218 6:25069803-25069825 GTCTCCATTTTTAGGAAGGAAGG - Intergenic
1005401255 6:25436750-25436772 GACTTAAGCTTCAGGGAGGAAGG - Intronic
1006051357 6:31347335-31347357 GTGTCCACATGCTGGGAGGATGG + Intronic
1006793893 6:36720348-36720370 GCCTCCAGCTGCAGGGTGGAGGG - Exonic
1006992255 6:38225388-38225410 GTCTTCACCTTCAGGGTCTATGG - Intronic
1007232115 6:40355676-40355698 GTCTCCAACTTCAGTGGAGAGGG + Intergenic
1012169559 6:96002010-96002032 GGCTCCACCTTCAGCCAGGGAGG - Intergenic
1012512758 6:100023116-100023138 GTCTACCCCATCAGGGAGGAAGG + Intergenic
1015152776 6:130057202-130057224 GTTTGCACCTACAGTGAGGAGGG - Intronic
1015346345 6:132164021-132164043 GATTCCCCCTTCAGGAAGGAAGG + Intergenic
1017820826 6:158048139-158048161 GTCCCTACCTTCAGGGAGCAGGG + Intronic
1018858109 6:167689788-167689810 GTCTCCTCCCTCAGGGACAATGG - Intergenic
1019476191 7:1245595-1245617 TTCTCCACCTTCAAGGATGGAGG - Intergenic
1019500594 7:1362574-1362596 GCCTCCACCCTCAGGGAGTTGGG + Intergenic
1021575662 7:22103421-22103443 GCCTCCAGCTTCTTGGAGGATGG + Intergenic
1027930267 7:84523440-84523462 ATATTCACCTTCAGGGAGGATGG - Intergenic
1030205584 7:106949580-106949602 GACTTCATCCTCAGGGAGGATGG + Intergenic
1031288343 7:119900716-119900738 GTCTCCCCGTTCAGGGAAGTGGG + Intergenic
1032159797 7:129501940-129501962 GACTTCACCTGCAGGGAGGGAGG + Intergenic
1033663500 7:143420066-143420088 GGCCAGACCTTCAGGGAGGACGG - Intergenic
1034473823 7:151271143-151271165 GCCTCCTCCCACAGGGAGGAAGG - Intronic
1035416177 7:158688929-158688951 TCCACCTCCTTCAGGGAGGAGGG + Intronic
1035618710 8:1022145-1022167 CTGTCCACCCCCAGGGAGGATGG - Intergenic
1035618738 8:1022255-1022277 GTGTCCACTCCCAGGGAGGATGG - Intergenic
1035618826 8:1022585-1022607 GTGTCCACTCCCAGGGAGGATGG - Intergenic
1035912632 8:3584483-3584505 GTCTCCACCTTCAGCCTGGATGG + Intronic
1037886992 8:22600485-22600507 GTATCCAGCTTCAGGGAGAGGGG - Intronic
1038691395 8:29766681-29766703 GTCTCCCCCATCATTGAGGATGG - Intergenic
1039914319 8:41848635-41848657 TTCTTCACCTTCAAGGTGGAAGG - Intronic
1040387592 8:46924075-46924097 CTCTCCTCCTTTAGGGAAGATGG - Intergenic
1041018575 8:53615727-53615749 GTTTCCATCTTCAGGGAGAGTGG - Intergenic
1041201684 8:55455523-55455545 GTTTCCACTTTTAGCGAGGAAGG - Intronic
1043198859 8:77337473-77337495 GTCTCAACCTTCAAGTAGGTGGG - Intergenic
1047485910 8:125330536-125330558 ATCCCCAACCTCAGGGAGGAAGG + Intronic
1047989065 8:130266336-130266358 GTCTAGACATTCAGGGATGAGGG + Intronic
1048617385 8:136092191-136092213 GTCTCCACCTTCTGGGCTCAAGG + Intergenic
1048791715 8:138110427-138110449 TTCTCCGCCTGCATGGAGGATGG - Intergenic
1049547791 8:143242156-143242178 GTCTCCACCTCCAGGGTTCAAGG - Intergenic
1049548556 8:143246177-143246199 GTCTCCGCCTTCAGCGCGGAAGG - Intergenic
1049765101 8:144351518-144351540 ATCACCAGCTCCAGGGAGGAGGG + Intergenic
1050799950 9:9598214-9598236 GTGTCCACCTTGAGGAAGGAGGG - Intronic
1051346033 9:16152043-16152065 GTCCCCACATTGAGAGAGGATGG - Intergenic
1056790023 9:89619217-89619239 GACTGCACCAGCAGGGAGGAGGG + Intergenic
1057171153 9:92963975-92963997 GTGTAGATCTTCAGGGAGGAGGG - Intronic
1057304603 9:93904871-93904893 GCCCCCACCTGCTGGGAGGATGG + Intergenic
1058072139 9:100612149-100612171 GTCTCCACCTTCAGCATGGCAGG + Intergenic
1058922744 9:109632726-109632748 TTCTCCATCTTCATGCAGGATGG + Intergenic
1059459341 9:114420011-114420033 GTCCCCACCGGCAGGAAGGACGG + Intronic
1060785797 9:126450909-126450931 GTCTGCACCTGCAGGGCTGAAGG - Intronic
1062657929 9:137613800-137613822 GTCCCCACCCTCATGGAGGCTGG + Intronic
1186151470 X:6678979-6679001 CTATCCTCCTTCAGGGAGCATGG - Intergenic
1189710982 X:43811573-43811595 GTCTTTCCCATCAGGGAGGAGGG + Intronic
1192069655 X:67923473-67923495 GTCTCTCCCTTCAGGGCAGAGGG - Intergenic
1192809746 X:74537423-74537445 GACTCCACCTTAAGGGACGGAGG - Intergenic
1193555752 X:82951773-82951795 GACTCATCCTTCAGGGAAGAAGG + Intergenic
1194526504 X:94983774-94983796 GTCTCACCCTTCAGGGAAGTGGG - Intergenic
1195777164 X:108420128-108420150 CTCTCCACCTTCAGGGCACATGG + Intronic
1196504366 X:116424153-116424175 GGCTGCAACTTCAGGTAGGAAGG - Intergenic
1198248863 X:134859950-134859972 GTCTCCCTCTTCTGAGAGGAAGG + Intergenic
1199574254 X:149298107-149298129 GTCTCCACTGGCAGGGAGTAGGG + Intergenic
1199652331 X:149958748-149958770 GTCTCCAACTCCATGGAGGTTGG + Intergenic
1199859257 X:151785283-151785305 TTCTCCACCTTAAAGGAAGAGGG - Intergenic
1201886537 Y:18890036-18890058 ATCTCCACCTTCGTGGAGAAAGG + Intergenic