ID: 1169264717

View in Genome Browser
Species Human (GRCh38)
Location 20:4160895-4160917
Sequence CTGTGGCTCAGGAGGCAGGA TGG
Strand +
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 725
Summary {0: 1, 1: 0, 2: 5, 3: 59, 4: 660}

Found 2 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1169264709_1169264717 0 Left 1169264709 20:4160872-4160894 CCCAGGCTGGGCAGAGTGGGACC 0: 1
1: 0
2: 6
3: 39
4: 592
Right 1169264717 20:4160895-4160917 CTGTGGCTCAGGAGGCAGGATGG 0: 1
1: 0
2: 5
3: 59
4: 660
1169264710_1169264717 -1 Left 1169264710 20:4160873-4160895 CCAGGCTGGGCAGAGTGGGACCC 0: 1
1: 1
2: 14
3: 122
4: 1035
Right 1169264717 20:4160895-4160917 CTGTGGCTCAGGAGGCAGGATGG 0: 1
1: 0
2: 5
3: 59
4: 660

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1169264717 Original CRISPR CTGTGGCTCAGGAGGCAGGA TGG Intronic
900215047 1:1477112-1477134 CTGAGGCTCAGGTGGGAGGATGG - Intronic
900222213 1:1515180-1515202 CTGAGGCTGAGGTGGGAGGATGG - Intronic
900536171 1:3178876-3178898 CTGTGGCTCAGGAGTCTGAGTGG - Intronic
900782898 1:4629386-4629408 CTGGGGGTCAGGAGCCAGGCTGG - Intergenic
900969200 1:5980186-5980208 GGGTTGGTCAGGAGGCAGGAGGG - Intronic
901196843 1:7445077-7445099 CTGTGCCTCAGGTGGGAGGTGGG + Intronic
902280582 1:15371435-15371457 CTCTGGCTTAGAAAGCAGGAAGG - Intronic
902337914 1:15764567-15764589 GTGTGGCCCAGCAGGCAGGCGGG + Exonic
902359707 1:15935729-15935751 CTGTGGCTCGAGCGACAGGAAGG - Exonic
902639238 1:17756010-17756032 CTCTGTCACAGGTGGCAGGAGGG + Intronic
902730466 1:18365529-18365551 CTGTGGCGCAGGAAGTAGGTGGG - Exonic
904417299 1:30371194-30371216 CTGAGGCTCAGGAGACAGAGGGG + Intergenic
904445590 1:30570929-30570951 ACGTGGCTAAGGAGGCAGCAGGG - Intergenic
904446125 1:30574252-30574274 CTGGGCCAAAGGAGGCAGGAAGG - Intergenic
904499391 1:30905413-30905435 CTGTGGTTGGGAAGGCAGGAGGG - Intronic
904617929 1:31760043-31760065 CTGTACCTCAGCAGGCAAGAGGG - Intronic
904954136 1:34268805-34268827 CTGAGGCACTGGAGGCAGGCAGG + Intergenic
904972162 1:34427577-34427599 CTCTGGCTGAGGTGGCAGCAGGG - Intergenic
905733774 1:40312819-40312841 CTGTGGGTCAGGGAGCAGGTTGG - Intronic
905852433 1:41283924-41283946 CAGTGGCTCAGGAGCCAGCTCGG - Intergenic
905882282 1:41472007-41472029 CTTTGACTGAGGAGGCAGTATGG + Intergenic
905972555 1:42153084-42153106 GTGAGGCTCAGGAGGGAGGGTGG - Intergenic
906129582 1:43448162-43448184 CTCTGGCTCAGGGGGCAGTCTGG - Exonic
906690728 1:47791228-47791250 CTGTGGTTCTGGAGTCTGGATGG - Intronic
906967011 1:50467661-50467683 ATTTGGCTCAGGAAGCATGATGG + Intronic
907480178 1:54740337-54740359 CTTTGGCTTGGTAGGCAGGAAGG + Intronic
907490119 1:54803919-54803941 CAGTGGCTCTGGAGTCTGGACGG + Intergenic
907949621 1:59169791-59169813 CTGTCCCTCTGGAGCCAGGATGG - Intergenic
908029328 1:59983124-59983146 CAGTGGCAGATGAGGCAGGAGGG + Intergenic
908248639 1:62247668-62247690 CTGTGGCTCTGCATGCAGGGAGG - Exonic
909482406 1:76140324-76140346 CTGTGCCTCTGAAGGAAGGAAGG + Intronic
909929376 1:81477925-81477947 GTGTGGCTCAGGAAGGAAGAGGG + Intronic
911747976 1:101461999-101462021 AAGTGGCTCAAGGGGCAGGAGGG + Intergenic
913124451 1:115772259-115772281 CTGGTGCAGAGGAGGCAGGAAGG - Intergenic
914830853 1:151169872-151169894 CTGGGGATCAGCAGGCAGGGAGG - Exonic
914876213 1:151514147-151514169 ATGTGGATCAGGGGCCAGGAGGG - Intronic
917312992 1:173696116-173696138 TTATGGCTCAGGGGGCATGAAGG + Intergenic
917510488 1:175665402-175665424 CTGGGGCCCAGAAGGCAGGTGGG + Intronic
917515327 1:175702424-175702446 CTGTGGGTCTGGAAGCTGGAAGG - Intronic
917923716 1:179771626-179771648 ATGAGGCTCATGGGGCAGGAAGG - Intronic
918441853 1:184575894-184575916 CTGTGGCCCAACAGGCAAGAGGG - Intronic
919025635 1:192165504-192165526 TTGTGGCTCAGGGGGCATCACGG + Intronic
919836146 1:201574818-201574840 CAGTGTCTCAGGTGGAAGGAAGG + Intergenic
920563880 1:206958660-206958682 CTGCAGCTCAGGAGGCAGAAAGG - Exonic
920647487 1:207814179-207814201 CTGGGAGTCAGGAGGCAGCATGG - Intergenic
920710463 1:208289618-208289640 CTGTGGCTGATGGTGCAGGATGG - Intergenic
921893182 1:220372873-220372895 CTGTGGCTCTGGCCACAGGAAGG + Intergenic
922333046 1:224594562-224594584 GTGTAGGTCAGGAGGCAGAAAGG + Intronic
922731469 1:227950614-227950636 CTGTGGCTGAGGCAGCAGGTAGG - Intergenic
923018344 1:230144157-230144179 ATGTGGCCCAGAAGGCAGCACGG - Intronic
923852542 1:237813129-237813151 CTGTGACCCTGAAGGCAGGAGGG + Intronic
924825201 1:247531560-247531582 CTGTGGCTCTGCAGGCAAGCTGG - Exonic
924947137 1:248854153-248854175 CTGGGGCACAGGGGCCAGGAAGG - Intronic
1063110970 10:3037270-3037292 CGGTAGGTCAGGAGGCAGAAGGG + Intergenic
1063646601 10:7889966-7889988 CTGTTGCTCTGGCAGCAGGATGG - Intronic
1064276812 10:13913897-13913919 CTGTAGCTCAGGATAGAGGACGG + Intronic
1064645348 10:17454245-17454267 CTGTGGCTCAGGATGCGGCCGGG - Exonic
1065324748 10:24540800-24540822 CTGTCGCCCGGGAGGCTGGAGGG + Intronic
1067287493 10:44917395-44917417 ATGTGACTCATGAGGCTGGAAGG + Intronic
1067438104 10:46292889-46292911 CTGAGGGTCAGCCGGCAGGAAGG + Intronic
1067514663 10:46927920-46927942 CTGAGGTTCAGGAGGTTGGAGGG + Intronic
1067647596 10:48123893-48123915 CTGAGGTTCAGGAGGTTGGAGGG - Intergenic
1067696930 10:48542537-48542559 CTGGGAATCAGGAGGCAGGAGGG - Intronic
1067712949 10:48664878-48664900 CTGTGGGACAGGAAGCAGGCAGG - Intergenic
1067743575 10:48915304-48915326 CTGAGGCTCAGAAGTGAGGAAGG + Intronic
1068491654 10:57732030-57732052 GTTTGGCTCAGGAGGCAGGAGGG - Intergenic
1068715927 10:60188270-60188292 CTGTGCCTCAGGAGCCATCAGGG + Intronic
1068788382 10:61001539-61001561 CTGTGGCCCGGGATGCAGGCGGG - Intergenic
1068950831 10:62775467-62775489 CTGAGGCTGAGGAGGCAGCATGG - Intergenic
1069605904 10:69738396-69738418 CTGTGGCTGAGCAGGAAGGGAGG + Intergenic
1070321947 10:75361004-75361026 CTGTGGTGCAGGAGACAGCAGGG + Intergenic
1070363950 10:75717583-75717605 CTGTGGGCCAGGAGGCAAGGAGG + Intronic
1070847964 10:79539287-79539309 CTGTGGTTGGGGAGGAAGGAGGG + Intergenic
1072066877 10:91879921-91879943 CTATGGCTCAGTGGGCAGGGGGG - Intergenic
1072296728 10:94015648-94015670 ACGTGGCTCAGGAGAAAGGAAGG + Intronic
1073516710 10:104082444-104082466 CTGTGGATCAGGAGGCATTTGGG + Intronic
1073858025 10:107699841-107699863 CTGTGGGTGAGGTGGGAGGATGG + Intergenic
1074104199 10:110376473-110376495 AGGTGGCGCCGGAGGCAGGAGGG - Intergenic
1074288811 10:112122851-112122873 CTGTGTCTAAGGAGGTAGGAAGG + Intergenic
1075389885 10:122084503-122084525 ATCTGGCACAGGGGGCAGGACGG - Exonic
1075721599 10:124590727-124590749 CGGTGGCAGAGGAGGCAGGCAGG - Intronic
1076298080 10:129403059-129403081 CTCAAGCCCAGGAGGCAGGAGGG - Intergenic
1076478443 10:130768371-130768393 TTGTGGCTCAGGGGGCATCACGG - Intergenic
1076794214 10:132790866-132790888 CTGGGGCTCAGGATTCAGGGAGG - Intergenic
1076849857 10:133087426-133087448 CTGTGGCCCAGGATGCAGGAGGG + Intronic
1076995649 11:296345-296367 CTGTGGGTCAGGGGGCAGCCCGG + Intergenic
1077030156 11:461869-461891 CTGTGGCTCTGGAGGCAGTGAGG + Intronic
1077185081 11:1232214-1232236 CCGTGGCCCAGGGGACAGGAAGG - Intronic
1077327852 11:1971425-1971447 CTGTGGAGCAGGACGCTGGAGGG - Intronic
1077328137 11:1972445-1972467 CTGTGGCGCAGTGTGCAGGAGGG - Intronic
1077365413 11:2159572-2159594 CTGTGGCTCAGGGTCCAGTATGG - Intronic
1077454553 11:2670700-2670722 CTGTGGCCCATGGAGCAGGAGGG + Intronic
1077517505 11:3010715-3010737 CAGTGGAGCAGGAGGCAGGAGGG - Intronic
1077532203 11:3102659-3102681 CTGAGGCTCAGGTGAAAGGATGG - Intronic
1077672096 11:4166464-4166486 TTGTGGCTGAGGTGGCAGCAGGG + Intergenic
1077881093 11:6350966-6350988 CAGTTGATCAGGAAGCAGGATGG + Intergenic
1077920688 11:6639924-6639946 CTGTGGCAGAGGAGGCTAGAGGG + Exonic
1078170627 11:8926490-8926512 CTGTAGTCCAGGAGGCAGGGAGG - Intronic
1078412824 11:11141695-11141717 CTGTGGAGCAGGAGGCAATAAGG - Intergenic
1079376795 11:19900206-19900228 TTGAGGCTAAGTAGGCAGGATGG + Intronic
1079969323 11:27017180-27017202 ACATGGGTCAGGAGGCAGGAAGG - Intergenic
1080252059 11:30244524-30244546 CTGTTGCTAAGGAGGCAAGGTGG - Intergenic
1080407252 11:31990537-31990559 GTGTAGCTGGGGAGGCAGGATGG - Intronic
1080924706 11:36744264-36744286 CTATAGTTCAGGAGGCAGGCTGG + Intergenic
1081291459 11:41330674-41330696 CTGAGGCTGAGGTGGGAGGATGG - Intronic
1081502655 11:43681311-43681333 GTGTGACTGAGGAGGCAGCAGGG - Intronic
1081881360 11:46455647-46455669 CTGAGGCTCACCAGGCCGGATGG - Intronic
1082207454 11:49455155-49455177 CTGTAGCTAAGGAGGGAGGCAGG + Intergenic
1083262167 11:61529080-61529102 CTGGGGCTCAGGCGGCTGGGGGG - Intronic
1083618419 11:64037236-64037258 AGGTGGCTCAGGAGTTAGGAAGG + Intronic
1083641814 11:64149750-64149772 CTGTGGCTGAGGGGGCAGTCAGG - Intronic
1083755169 11:64788345-64788367 CTGCAGCCCAGGAGGCAGGATGG - Intergenic
1084164711 11:67370182-67370204 CCGTGTCTCAGGCAGCAGGAGGG + Intronic
1084225147 11:67711058-67711080 CGGGGCCTCAGGAGGGAGGAAGG + Intergenic
1084262967 11:67990901-67990923 CGGGGCCTCAGGAGGGAGGAAGG + Intergenic
1084272189 11:68035030-68035052 CTGTGGCCCAGGATGGAGTATGG - Intronic
1084431765 11:69115314-69115336 CTGTGGGTCAGGGGGATGGAGGG + Intergenic
1084487243 11:69455767-69455789 CTGTGGCTTGGGAGTCAGGCAGG + Intergenic
1084803367 11:71561864-71561886 CAGTGACTCAGGAGGCTGGAAGG + Intronic
1084810426 11:71608215-71608237 CGGGGCCTCAGGAGGGAGGAAGG - Intergenic
1084965681 11:72743396-72743418 CTGTGGCTCAGGAGGCTCCCTGG - Intronic
1085046249 11:73355510-73355532 CTGTGGAGGAGGAGGCAGGTTGG - Intronic
1085122158 11:73974162-73974184 CTGTGGCTGTGGAGGGTGGAAGG + Intergenic
1085462176 11:76700792-76700814 GGGTGGCTCTGGAGGCAAGAGGG + Intergenic
1086051919 11:82602472-82602494 CTGTAGCTCAGGCAGAAGGAAGG - Intergenic
1086647820 11:89246602-89246624 CTGTAGCTAAGGAGGGAGGCAGG - Intronic
1086730717 11:90245623-90245645 CTCTGGCTTGGGAGGCTGGATGG - Intergenic
1086892194 11:92271110-92271132 CTCTGGCTCAGTATGCAGAATGG - Intergenic
1087015263 11:93548597-93548619 CTGTGGGTCAGGAGGGAGCTGGG + Intergenic
1087629285 11:100631564-100631586 CTGTGGAGCAGAAGACAGGAAGG + Intergenic
1088008733 11:104973444-104973466 TTGTGGCTCAGGGGGCATCATGG + Intergenic
1088072777 11:105810670-105810692 CTGTATCTCAGGAGGAAGGTCGG - Intronic
1088391459 11:109319478-109319500 CTGAGGCACTGCAGGCAGGAAGG - Intergenic
1088408982 11:109512714-109512736 CTGTGGCTCAGGTGTCCTGAGGG - Intergenic
1088439661 11:109855706-109855728 CTGTGTCTCAGGAAGTAGGGAGG - Intergenic
1088706849 11:112471567-112471589 CTGTGGTCAAGGAGGCAGTATGG - Intergenic
1089289059 11:117426863-117426885 CTGTGGATCAGGAACCTGGAAGG - Intergenic
1089647478 11:119889706-119889728 CTGAGGCTCTGGAGCCTGGAAGG - Intergenic
1089678314 11:120105385-120105407 CTGTGGGGCAGGGGGCTGGAAGG + Intergenic
1089687170 11:120160618-120160640 TAGTGACTCAGAAGGCAGGAAGG + Intronic
1089701885 11:120249702-120249724 CAGAGGGTCAGGAGGAAGGAGGG + Intronic
1089808526 11:121113265-121113287 CTGTGGCTCAGCATCCTGGAGGG + Intronic
1090026367 11:123170824-123170846 CTGTGACCAAGGAGGCAGCAGGG - Intronic
1090057917 11:123439154-123439176 CTGTGACTCTGGAGCCTGGAAGG + Intergenic
1202810832 11_KI270721v1_random:26605-26627 CTGTGGAGCAGGACGCTGGAGGG - Intergenic
1202811116 11_KI270721v1_random:27625-27647 CTGTGGCGCAGTGTGCAGGAGGG - Intergenic
1091691817 12:2602243-2602265 CCGTGGTGGAGGAGGCAGGAAGG - Intronic
1091699485 12:2650663-2650685 CCAGGGCTCAGGGGGCAGGACGG - Intronic
1091838823 12:3604826-3604848 CTGTGGCCCAGGCAGGAGGAGGG - Intergenic
1092489135 12:8929377-8929399 CTGTGGATAAGGAGGTAGGAAGG - Intronic
1093034215 12:14317877-14317899 CAGTGGCTCTGGAGGGAGCATGG - Intergenic
1095403111 12:41838239-41838261 CCTTGGCTCAGGAAGCTGGAAGG - Intergenic
1096428601 12:51524679-51524701 CTCAGGCTAAGGAGACAGGAAGG - Intergenic
1096555677 12:52402094-52402116 CTGTGCATCATGAGGCAGAAAGG - Intronic
1096620040 12:52858753-52858775 CTGCAGCCCAGCAGGCAGGAGGG - Intergenic
1097050716 12:56221642-56221664 CTGGGGTTCAGGAGGAGGGATGG - Intronic
1097188671 12:57209248-57209270 CTTTGGCTCAGTAGGGAGGATGG - Intronic
1097194423 12:57235810-57235832 CTGTGGAGCAGGAGGGGGGAGGG + Intronic
1098880308 12:75910441-75910463 CTGTGGAACAGCAGGCAGCAGGG - Intergenic
1100468501 12:94870695-94870717 CTGTCACCCAGGTGGCAGGACGG - Intergenic
1101627521 12:106460142-106460164 CGCTGGCACAAGAGGCAGGATGG - Intronic
1101760682 12:107656262-107656284 CTGTGGCTCAGGCTGGAGTACGG - Intronic
1101897912 12:108769790-108769812 CTTGGGCTGAGGGGGCAGGAAGG - Intergenic
1102245331 12:111352409-111352431 CTGTGCATCAGGCTGCAGGAGGG + Intergenic
1102580126 12:113881103-113881125 ATGGGTCTGAGGAGGCAGGAGGG + Intronic
1102594704 12:113983595-113983617 CAGTGGTTCAGGAACCAGGATGG - Intergenic
1102988878 12:117300538-117300560 CGATGGCTCAGGTGGAAGGAAGG + Intronic
1103200159 12:119081654-119081676 CTGGGGAACAGGATGCAGGAAGG + Intronic
1103984903 12:124760667-124760689 CTGGGGCTCAGGGGCCAGAACGG + Intergenic
1104426775 12:128684460-128684482 CTTTGGCTGAGGAGACAGGCAGG - Intronic
1104489427 12:129181205-129181227 GCCTGGCTCAGGAGACAGGATGG - Intronic
1104537084 12:129628353-129628375 CAATGTCACAGGAGGCAGGAGGG + Intronic
1104645281 12:130493030-130493052 CTGGGGCTCAGGCAGGAGGATGG + Intronic
1104890799 12:132139248-132139270 CTGGGGCTCAGAGGGCCGGAGGG - Exonic
1105521522 13:21135450-21135472 TTGTGGCTCAGGAGGCATCACGG - Intergenic
1105699780 13:22927054-22927076 GGGTGGCTCAGGAGCCTGGAGGG - Intergenic
1106670795 13:31903046-31903068 ATGTGGCTCTAGAGGGAGGAAGG + Intergenic
1106710117 13:32322148-32322170 CAGGGGCTCAGGAGGAGGGATGG - Intronic
1107232726 13:38129930-38129952 CTGTTGCCCAGTAGGCTGGATGG - Intergenic
1107988863 13:45799584-45799606 CTGGAGCTCAGGATGGAGGATGG + Intronic
1109226963 13:59708612-59708634 TTGGGGCTCAGGAGGAAGGGCGG - Intronic
1109307935 13:60661557-60661579 CTGAAGCCCAGGAGGCTGGATGG - Intergenic
1109394343 13:61736123-61736145 CTGTGGATCAGGAGTCTGAAAGG + Intergenic
1109786438 13:67181863-67181885 ATGTTGCTGAGGAGGCACGAGGG - Intronic
1111842351 13:93465931-93465953 CTGTGTTTCAGGAAACAGGAAGG + Intronic
1112556420 13:100472563-100472585 GTGTGGGTCAGGAGGCAGAAAGG + Intronic
1112899051 13:104337370-104337392 CTGTAGCTCAGGAAGCACCATGG + Intergenic
1113132479 13:107053429-107053451 CTTTGTCTCAGGTGGCAGCAAGG - Intergenic
1113172156 13:107516971-107516993 CTGTGGATGAAGAGGTAGGATGG + Intronic
1113294015 13:108938390-108938412 CTGGGGGTCAGGAGCCAGGAAGG + Intronic
1113541886 13:111115502-111115524 CTGCGGCCCGGGAGGCAGGCGGG - Exonic
1113916939 13:113879843-113879865 CGGAGGCTGAGGAGGCAGGGAGG - Intergenic
1114276364 14:21149081-21149103 CTGTGGGTCAGGAGGCTGCAAGG + Intergenic
1114673493 14:24427215-24427237 CTGTGGCTGGTGAGGAAGGAAGG - Exonic
1114992304 14:28301457-28301479 CTGTGCTGCAGGTGGCAGGAAGG + Intergenic
1115851948 14:37595775-37595797 CTTTGGGTCAGGAATCAGGAGGG - Intronic
1117066733 14:52019026-52019048 CTGGGGCTCAAGAAGCAGAATGG - Intronic
1117804284 14:59474342-59474364 CTTAGAGTCAGGAGGCAGGATGG + Intronic
1117951709 14:61089524-61089546 CAGTGGCTTAGGTGGGAGGAGGG + Intergenic
1118603701 14:67488158-67488180 CTGTGGATGACCAGGCAGGATGG + Intronic
1118803184 14:69209712-69209734 CGGTGTCTCAGGAGGCAGAGTGG + Exonic
1118837238 14:69485606-69485628 CTCAGGCTAAGGAGGGAGGAAGG + Intronic
1119007849 14:70948270-70948292 TTGTGGCTCAGGGGGCATCACGG + Intronic
1119316128 14:73696382-73696404 CTTTAGCTCAGAAGGCAGCATGG + Exonic
1119679869 14:76584361-76584383 CACTGGCCCAGCAGGCAGGAGGG + Intergenic
1120911313 14:89669396-89669418 CTCTTGCTCAGGAGGCAGGCTGG - Intergenic
1121755098 14:96395592-96395614 CAGCTGCTCAGGAGGCAGAATGG + Intronic
1121864911 14:97353719-97353741 ATGTGGCTGAGGAGGAAGAAAGG - Intergenic
1122061106 14:99137247-99137269 CTGTAGCCCAGGAGGAAAGACGG - Intergenic
1122301150 14:100731861-100731883 CTGAGGCTCAGGAAGCTGAAGGG - Intronic
1122510689 14:102264825-102264847 CTGTGGCTCCGGAGGGAGCCTGG - Intronic
1122786662 14:104167190-104167212 CTGAGGCCCAGGTGGCAGCAGGG + Intronic
1122859090 14:104574207-104574229 CTGGGGCTCAGGAGGCGGTGGGG + Intronic
1123413889 15:20081351-20081373 CCTTGGGTCAGGAGGCAAGAAGG + Intergenic
1123523231 15:21088462-21088484 CCTTGGGTCAGGAGGCAAGAAGG + Intergenic
1123907271 15:24933314-24933336 CTGTGGCTCTGGAGGGCGGCTGG + Intronic
1123965314 15:25449950-25449972 TTTTGGCTCAGGAGCCAGCAGGG + Intergenic
1124012405 15:25849330-25849352 CTGTCCCTCCGGAGGCAGCAAGG + Intronic
1124612138 15:31215985-31216007 CTCGGGCTGAGGAGGCAGGAGGG - Intergenic
1124650894 15:31473184-31473206 CTGTGCCTCAGGAAGCCAGAGGG - Intergenic
1125444243 15:39736606-39736628 CTGTGGCCCACGGGGGAGGAGGG - Intronic
1125490944 15:40147901-40147923 ATGCGGCTGAGGAGGCAGCAAGG + Intergenic
1125796788 15:42409286-42409308 CTGTGGCTGTGGAGGCACAAAGG - Exonic
1125919816 15:43518674-43518696 CAGAGGCTGAGCAGGCAGGAGGG - Intronic
1126706081 15:51406354-51406376 CTGGGGCTCTGCAGCCAGGAAGG + Exonic
1127331825 15:57947370-57947392 CTTCTGCTGAGGAGGCAGGAAGG - Intergenic
1127369882 15:58329920-58329942 CTGTAGGCCAGGAGCCAGGATGG - Intronic
1128556936 15:68638182-68638204 CTGAGGGTCAGGAGGAGGGAGGG - Intronic
1128670106 15:69568258-69568280 CTGTGTCCCAGAAGGCAGGGGGG - Intergenic
1128705982 15:69837720-69837742 CTGGAGCTCAGCAGACAGGAAGG + Intergenic
1128744532 15:70104073-70104095 CTGTGGCTCAGAGGGGAGGAAGG + Intergenic
1128846424 15:70901105-70901127 CTGGGGAACAGGAGGAAGGAGGG - Intronic
1129525692 15:76212677-76212699 CTCAGGCTCTGGAGGCAGCAGGG + Intronic
1129763944 15:78149375-78149397 CTGTTGCTGCGGAGCCAGGAGGG + Exonic
1130151202 15:81313070-81313092 GAGTGGGGCAGGAGGCAGGAAGG + Exonic
1130956273 15:88629471-88629493 CTGTGGCTCAGGTGGCATGGAGG - Intronic
1131138677 15:89959438-89959460 CTGTGGCCCAGGCTGCAGGCTGG + Intergenic
1131142511 15:89988910-89988932 CTGTGGCTCAGGCTGGAGGGCGG - Intergenic
1131452887 15:92560888-92560910 CTGTGGACCTGGAGGCAGGCAGG + Intergenic
1131869357 15:96745607-96745629 CTGTGGCTGAGGATCCAGCATGG - Intergenic
1132176954 15:99723596-99723618 GTGTTGGTCAGGAGGCAGAAGGG - Intronic
1132291223 15:100705178-100705200 CTGGGGCTCTGGAGGCAGAGAGG + Intergenic
1132603098 16:782608-782630 CTGTGGCCCAGGAGGGAGACAGG + Intronic
1133055591 16:3144121-3144143 CTGGGGCTCAGCAGGGAGGCAGG - Intergenic
1133132739 16:3687741-3687763 CAGAGGCTGAGGAGGAAGGATGG + Intronic
1133838809 16:9389846-9389868 CTGTGGGTCAGGAATCAGGGTGG - Intergenic
1133955300 16:10438290-10438312 CTGTTGCTCAGGCTGCAGTACGG + Intronic
1133989680 16:10694870-10694892 GTGGGGCTCATGAGGGAGGATGG - Exonic
1134640306 16:15824689-15824711 CTGTGGTCCAGGAGGGAGGGAGG + Intronic
1135688811 16:24519932-24519954 CTGTTGCTCTGAAGACAGGAGGG - Intergenic
1136092149 16:27928242-27928264 CTGAGGCTCAGGAGGTTGAAAGG + Intronic
1136135634 16:28255404-28255426 GTCTGGCTCAGGGGCCAGGAGGG + Intergenic
1136575993 16:31125728-31125750 CTGTAGCTGAGAAGGGAGGAAGG - Intronic
1137070518 16:35900655-35900677 CTGCAGCCCAGGAGGCAGCACGG - Intergenic
1137612155 16:49825822-49825844 CTGTGTCTTAGGGGGCTGGATGG - Intronic
1137878098 16:52016974-52016996 GGGAGGCTAAGGAGGCAGGATGG - Intronic
1139997539 16:70995098-70995120 CTGTGGCTCAGGGGGCAAGCAGG - Intronic
1140145810 16:72307321-72307343 CTATGAGTCAGGAGGGAGGAAGG + Intergenic
1140223947 16:73064172-73064194 CTGGGGGGCAGGAGGCAGGTGGG + Intergenic
1140602437 16:76493320-76493342 CTGTGACTCAGCACACAGGAAGG + Intronic
1140704867 16:77618289-77618311 CTGTGGCTTAGTAGCCAGGTGGG - Intergenic
1141065532 16:80910861-80910883 AGGAGGCTCAGGAGGCAGGTGGG - Intergenic
1141458868 16:84164418-84164440 TTGGGGCTGAGGAGGTAGGAGGG - Intronic
1141479613 16:84297690-84297712 CTGTGGCTCAGAGGACAGGGAGG + Intronic
1141564322 16:84891270-84891292 CCGTGTCCCAGGAGGCAGGAAGG - Intronic
1141600024 16:85120024-85120046 CTGTTGCTCAGAAGGCTGCATGG - Intergenic
1141651435 16:85395119-85395141 CTGAGGATGAGGAGGAAGGATGG + Intergenic
1141790067 16:86228253-86228275 CTGTGGCTTATGAGGAGGGAAGG + Intergenic
1141821534 16:86449533-86449555 CTGTGGCCAAGGAGGAGGGACGG + Intergenic
1141954121 16:87358807-87358829 CTGGGGCTCAGGAGGTGGGAGGG + Intronic
1142023220 16:87797186-87797208 CTGTGGCTCAAATGCCAGGAGGG + Intergenic
1142231160 16:88900935-88900957 CCTTGGCACAGGAGGCCGGAAGG - Intronic
1142283815 16:89162896-89162918 CAGAGGCTCAGGAGGCCAGAGGG - Intergenic
1142479869 17:212656-212678 GTTTGGGGCAGGAGGCAGGAAGG + Exonic
1143310314 17:5982345-5982367 CCCTGGCCCAGGAGGGAGGAAGG + Intronic
1143310441 17:5983576-5983598 CCCTGGCCCAGGAGGGAGGAAGG - Intronic
1143515404 17:7417231-7417253 CTCGGGCTCGGGAGGCAGGGTGG - Exonic
1143986457 17:10918870-10918892 CTGTGTCTCAGGAAGCGGCAAGG - Intergenic
1144157310 17:12518412-12518434 GTGTAGCTCTGGAGGCTGGATGG - Intergenic
1144729909 17:17520259-17520281 CGGTGGCCCAAGAGGCAGCATGG + Intronic
1144957681 17:19027365-19027387 CTGTGGCTCAGGAGGCTGAGGGG - Intronic
1144977476 17:19147151-19147173 CTGTGGCTCAGGAGGCTGAGGGG + Intronic
1145242372 17:21247530-21247552 CCGAGGCCCAGGAGGGAGGAAGG + Intronic
1145242672 17:21248907-21248929 CTCAGGCCCAGGAGGGAGGAGGG - Intronic
1145749322 17:27343924-27343946 CTCTGGCTCGGAAGGAAGGAAGG + Intergenic
1145761325 17:27426769-27426791 CTGTGGCTGGGGAGGCAGCCTGG - Intergenic
1146761038 17:35479063-35479085 CTTTGGCTTGGGTGGCAGGAAGG - Intronic
1147228947 17:39003186-39003208 CTGTGGCTCGAGGGGGAGGAGGG - Intergenic
1147333152 17:39710627-39710649 CTGTGGAGCAGGTGGCAGTAAGG + Intronic
1147478734 17:40738721-40738743 ATGTGGGCCAGGAGGCAGAAAGG - Intergenic
1147587072 17:41658872-41658894 CTGTAACTCAGGTGGCAGGGAGG + Intergenic
1147786468 17:42981719-42981741 CTGAGGCTGAGGCGGGAGGATGG - Intronic
1147865211 17:43547274-43547296 CTGATGATCTGGAGGCAGGATGG + Intronic
1148146206 17:45366687-45366709 CTGGGGCTCAGCAGGCAGAGGGG - Intergenic
1148861382 17:50606049-50606071 CTGTGGTGAAGGAGGCTGGAGGG + Intronic
1149217399 17:54373608-54373630 ATGGGGCTGAGGAGGGAGGATGG + Intergenic
1149775447 17:59353452-59353474 CTGTAGGTCCGGTGGCAGGAGGG - Exonic
1150229407 17:63541922-63541944 CTTTGGCACAGTGGGCAGGAAGG - Intronic
1150291903 17:63987208-63987230 CTGTTGCTGATGAGGCAGAATGG + Intergenic
1150318317 17:64188361-64188383 CTGTGGGTCAGGTGCCCGGACGG + Exonic
1150385383 17:64755288-64755310 GGGAGGCTCAGGAGGGAGGATGG + Intergenic
1150770951 17:68040332-68040354 GGGAGGCTCAGGAGGGAGGATGG - Intronic
1151163604 17:72185903-72185925 TGGTGGCTGAGCAGGCAGGAGGG + Intergenic
1151349865 17:73525317-73525339 CAGGGGCACAGCAGGCAGGAGGG + Intronic
1152009227 17:77700675-77700697 CTGGGGCTGGGGAGGCAGGGAGG + Intergenic
1152156588 17:78637712-78637734 ATGTTGCTCAGGTGGCAGAAGGG - Intergenic
1152223588 17:79082433-79082455 CTGCGGCTCAGGGGCGAGGACGG + Intronic
1152272221 17:79331388-79331410 CAGAGGCTTTGGAGGCAGGAAGG - Intronic
1152676247 17:81642701-81642723 CTTTGGCTCAGGGTGCAGGAGGG + Intronic
1152780952 17:82227234-82227256 TTGTCCTTCAGGAGGCAGGAGGG + Intergenic
1152855569 17:82663306-82663328 GGGTGGCCCAGCAGGCAGGAAGG + Intronic
1153201895 18:2655707-2655729 CTGTGGCGCAGGAGGAAGAGCGG - Intergenic
1153954096 18:10081348-10081370 CTCTGGCACAGGAGGCTGGAGGG + Intergenic
1154131715 18:11742629-11742651 CTATCGCCCAGGAGGCAGGTTGG - Intronic
1156778470 18:40821947-40821969 CTGGAGCTGGGGAGGCAGGATGG + Intergenic
1157302463 18:46488934-46488956 CATTGGCTCAGGAGGGAGGCAGG - Intronic
1158517992 18:58146693-58146715 CAGTGGCTAGGGAGGCAGGCAGG + Intronic
1158594877 18:58807271-58807293 AGGTGGGTCAGGAGGCAGAAAGG - Intergenic
1159007638 18:63026627-63026649 CTGTGTCTCAGGTGGTAGAAGGG - Intergenic
1159341666 18:67141644-67141666 CTGTGCCTCTGGAGGCAGTCTGG + Intergenic
1159784689 18:72698814-72698836 CTGTGACTCTGGAGGCAAGAAGG + Intergenic
1160006697 18:75073657-75073679 GTGGGGTTCAGGAGGCAGTAGGG - Intergenic
1160420479 18:78740495-78740517 CTGTGGGTCAGGTGGCGTGAGGG + Intergenic
1160831348 19:1106125-1106147 CTGTGGCTGTGGAGGCAGCCGGG + Intronic
1160881579 19:1323266-1323288 CTGTGACCCCGGGGGCAGGATGG - Intergenic
1161106934 19:2448370-2448392 CTGCGGCTCACGAGGCAGAGGGG + Intronic
1161136520 19:2623056-2623078 CTGTGTCCCAGGAGGCAAAAAGG + Intronic
1161156032 19:2732326-2732348 CTGTGCCTCAGGAGCCAGCTGGG - Intronic
1161356765 19:3823387-3823409 CTGTGGCTCAGGAGGCCCTGAGG + Exonic
1162536020 19:11262960-11262982 CTGAAGCTCAGGAGGGAGGGAGG + Intergenic
1163535056 19:17872233-17872255 CAGGGGCCGAGGAGGCAGGACGG - Exonic
1163696893 19:18768678-18768700 CTGTGGCCCACGAGTCAGGCTGG - Exonic
1163827394 19:19531272-19531294 CTGTGGCTCTGGAGACACCAAGG + Intronic
1163862475 19:19749489-19749511 CTGTGGCTTAGGATTCAGGCTGG - Intergenic
1164580177 19:29429942-29429964 CTCTGCCTCAGGAGGCTGGGTGG + Intergenic
1164971108 19:32533265-32533287 GTGTGGCTCCGGAGGTAAGAGGG - Intergenic
1165037197 19:33042278-33042300 CTGTGGCCAAGGGGGCAGGTGGG - Intronic
1165258777 19:34596246-34596268 CTGTGGCTGAGCAGGGAGGATGG + Exonic
1165341658 19:35216731-35216753 CTCTGCCTCAGGGGGCTGGATGG - Intergenic
1165346486 19:35251736-35251758 CTGTGCCTCAGCTGTCAGGAGGG - Intronic
1165797401 19:38526932-38526954 TTGTGGGTCAGGAAGGAGGATGG + Intronic
1165829038 19:38721475-38721497 CTGTGGGGCAGGAGTCTGGAGGG - Intronic
1165924930 19:39320908-39320930 CTGCGGCTCGGGAGGGAGGGCGG - Intergenic
1166186268 19:41141140-41141162 CTGGGGCTCCAGAGGCAGGCGGG + Intergenic
1166218953 19:41353351-41353373 CGGGGGCTCAGGAGACAGGCCGG + Exonic
1166230368 19:41422931-41422953 GTGGGGGTCAGGAGGGAGGATGG - Intronic
1166390409 19:42406214-42406236 ATGAGGCTCAGCAGGCGGGAGGG + Exonic
1166390563 19:42406865-42406887 CTGTGGGCCAGGAGGCTGGTAGG + Intronic
1166816901 19:45551744-45551766 CGGGGGCTATGGAGGCAGGAGGG + Intronic
1167389984 19:49188708-49188730 CTGACGCTGAGGAGGCAGCACGG + Exonic
1167649675 19:50722489-50722511 GAGGGGCTCAGGAGGAAGGAGGG + Intergenic
925082165 2:1078843-1078865 CTGAGGGTCAGGAGGGAGGAAGG + Intronic
925165614 2:1713898-1713920 GAGTGCCTCAGCAGGCAGGAAGG + Intronic
925887293 2:8403938-8403960 ATGTTGCTCATGAGGCTGGAAGG - Intergenic
926197600 2:10773139-10773161 CTGTGTGTCAGGAGGGATGAAGG + Intronic
926992065 2:18690583-18690605 CTCTGGCTGAGGATGCAGAATGG - Intergenic
927476796 2:23419931-23419953 CTGTGGCTCAGTGGGGAGAAGGG - Intronic
928729099 2:34210237-34210259 TTGTGGCTCAGGGGGCATCACGG - Intergenic
929152932 2:38763742-38763764 CTGTGGCTCAAAAGTCAGGACGG - Intronic
929342139 2:40833271-40833293 GTGAGGCTAAGGTGGCAGGACGG - Intergenic
929576967 2:43058012-43058034 GGGTTGCTCAGGAAGCAGGAGGG - Intergenic
930202528 2:48558753-48558775 CCCTGGCTCAGGAGCAAGGAAGG - Intronic
930697796 2:54429886-54429908 CTGTGGATCAAGAGGCTGGGTGG - Intergenic
930807563 2:55506631-55506653 ATGAGGCTGAGGAGGAAGGAAGG - Intergenic
931428098 2:62189297-62189319 CTGTGGCTCTGTGGGCATGAAGG + Intergenic
931894584 2:66714751-66714773 CTGTAGCTGAGGAGTCAAGATGG + Intergenic
932503817 2:72209407-72209429 CTGAGGCTGAGGTGGGAGGATGG + Intronic
932571273 2:72939741-72939763 CTGGAGCTCAGGAGACAGGTAGG - Intergenic
933692955 2:85193987-85194009 CTGTGGCTGAGGTGGTAGGAGGG + Intronic
934527728 2:95062026-95062048 CCGTGGCTGGGGAGGAAGGAAGG - Intergenic
934695907 2:96400012-96400034 CTGTTGCTGAGGAGGGAAGAGGG - Intergenic
934717784 2:96553324-96553346 CCTTGGCTCAGGAGGAGGGAGGG + Intergenic
935573563 2:104687287-104687309 CTGGGGATCAGGGGGCAGAACGG - Intergenic
936569060 2:113600276-113600298 CTGAGGCTGAGGAGGGAGAAGGG - Intergenic
937231524 2:120400774-120400796 AGGTGTCTCAGGAGGCTGGATGG - Intergenic
937379675 2:121365368-121365390 CTCTGGGAGAGGAGGCAGGAAGG - Intronic
937451151 2:122003037-122003059 CAGTGGTTCAGGGGGCAGCAGGG + Intergenic
937469726 2:122164836-122164858 CTCTGGAGCAGGAAGCAGGAAGG + Intergenic
937922875 2:127144338-127144360 CTCTGCATCAGGAGCCAGGAAGG - Intergenic
937981929 2:127620703-127620725 CTTTGGCTCAGGTGTCAGGATGG + Intronic
938548942 2:132361711-132361733 CTCAGGCGCAGGAGGGAGGACGG - Intergenic
939097467 2:137851020-137851042 GTGTGTGTGAGGAGGCAGGACGG + Intergenic
940036890 2:149320722-149320744 CTGGGGCTCAGGAAGTAGAAGGG - Intergenic
940911855 2:159216395-159216417 CTGTTCCTCTGGAGGGAGGAAGG - Intronic
941023580 2:160436486-160436508 CTGTGGCTCAGGAATTTGGAGGG - Intronic
942535782 2:176961895-176961917 GGGTGGCCCAGGAGGGAGGAGGG + Intergenic
942876385 2:180804785-180804807 CTCTGGCTAAGGAGGAAGAAAGG + Intergenic
942942317 2:181632825-181632847 CTGCTCCTCAGGAGGCAGAAAGG + Intronic
943668435 2:190634942-190634964 ATGTGTCACAGGAGGCAGGGTGG - Intergenic
943784476 2:191861913-191861935 GTGTAGACCAGGAGGCAGGAGGG - Intergenic
943858687 2:192831995-192832017 CTGTTGTTCAGCAAGCAGGAGGG - Intergenic
944314848 2:198273177-198273199 CTGTGTCTGCGGAGGCGGGATGG + Intronic
944366665 2:198928954-198928976 CTGGAGCCCATGAGGCAGGAGGG - Intergenic
945996123 2:216437989-216438011 CAGGGGCTCAGGGTGCAGGAAGG - Intronic
946437426 2:219666691-219666713 CTGAGGCTGAGGTGGGAGGATGG + Intergenic
947733739 2:232444469-232444491 CTCTGGCCCAGGAAGGAGGAGGG - Intergenic
947878094 2:233480915-233480937 CTGCGGGTGAGGAGGAAGGAGGG + Intronic
948430134 2:237913555-237913577 GTGTGGCCCAGGGGGCAGGTCGG - Intergenic
948601615 2:239110908-239110930 CCACGGCTGAGGAGGCAGGAGGG - Intronic
948674479 2:239588940-239588962 CTGAGACTCAGGTGGGAGGAGGG - Intergenic
948741434 2:240049027-240049049 CTCTGGGTCAGCAGGGAGGAGGG + Intergenic
948770741 2:240250254-240250276 CAGTGTCTCAGGAGGTGGGAAGG - Intergenic
948832017 2:240602807-240602829 CTGTGCCGCAGGAGGCTGGCAGG - Intronic
948878211 2:240841381-240841403 ATGTGGCCCAGGAGGCTGCAAGG - Intergenic
1168754892 20:309660-309682 CTGTGGGTAAGGAGGCAGGAGGG - Intergenic
1169207640 20:3749209-3749231 CTGGGGGTCAGGAGACAGCAGGG - Intronic
1169234802 20:3922425-3922447 CTGTGTCTCAGGAGGGCTGAGGG + Intronic
1169264717 20:4160895-4160917 CTGTGGCTCAGGAGGCAGGATGG + Intronic
1169304617 20:4477679-4477701 CTGAGGCTGTGGAGGAAGGAGGG + Intergenic
1169367123 20:5001111-5001133 CTGTGGCTCCCGTGGCGGGAAGG + Intronic
1169410969 20:5370090-5370112 ATGAGGGGCAGGAGGCAGGAGGG - Intergenic
1169553725 20:6727607-6727629 CTGTGGCTGATGAGGAATGAGGG + Intergenic
1172015365 20:31869921-31869943 CTGGGGCTGGGGAGGCAGAAAGG + Intronic
1172027163 20:31956511-31956533 CTGTGGCTCTGGTGATAGGATGG + Intergenic
1172096152 20:32461457-32461479 CTGTTGCTCAGGATGGAGTACGG + Intronic
1172186604 20:33034923-33034945 CTGTGGCTGGGGAGGAAGGCCGG + Intronic
1172910508 20:38405890-38405912 GTGTGGCTGAGGTGGGAGGATGG + Intergenic
1173385471 20:42583319-42583341 GTGAGGCTTAGGAGGCAGGTAGG - Intronic
1173569286 20:44066348-44066370 CTAGGGCTGAGGATGCAGGAAGG - Intronic
1173595403 20:44255857-44255879 CTGAGACTCAGAAGGAAGGATGG - Intronic
1174103101 20:48142201-48142223 CTGTGTATGAGGAGGGAGGAGGG - Intergenic
1174791915 20:53486841-53486863 CTGGGGCTGGGGAGGGAGGAAGG - Intronic
1174917501 20:54668874-54668896 CAGAGGCTGAGGAGGCAGGATGG + Intergenic
1175312122 20:58019378-58019400 CTCGGGCTCAGGAGCCAGGCAGG + Intergenic
1175335213 20:58191468-58191490 CTGTGGCTCTGTAGGATGGAGGG - Intergenic
1175405222 20:58721762-58721784 CTGTGCCCCGGGAGGCAGGATGG + Intergenic
1175488228 20:59360774-59360796 CTGTGGCACAGGCTGCAGCAGGG + Intergenic
1175582797 20:60113430-60113452 CTGGTGCTCAGCAGGCAAGAAGG + Intergenic
1175623509 20:60470695-60470717 CTTTGGCTCAGGACTCAGGATGG - Intergenic
1175769199 20:61612601-61612623 CTGGGCCTCAGCAGGAAGGATGG - Intronic
1175971266 20:62687833-62687855 CTGAGGCTCGGAAGGCAGGTTGG - Intergenic
1176015434 20:62928759-62928781 ATGTGGCCCAGAAAGCAGGAAGG + Intronic
1176113547 20:63421498-63421520 CTGTGGCTGATGGGGCAGGAAGG - Intronic
1176120768 20:63453579-63453601 CAGAGGCTTGGGAGGCAGGAGGG + Intronic
1178240116 21:30889618-30889640 CTGTGGCTCAGGAGCATGCAGGG - Intergenic
1178991745 21:37362609-37362631 GGGAGGCTGAGGAGGCAGGATGG + Intergenic
1179085025 21:38208230-38208252 CTGGAGCCCAGGAAGCAGGAAGG - Intronic
1179090745 21:38263280-38263302 CTGCTGGTCAGAAGGCAGGAGGG + Intronic
1179124354 21:38578001-38578023 CTTGGTTTCAGGAGGCAGGAAGG - Intronic
1179324955 21:40333467-40333489 AGGTGGCTGAGGAGGGAGGATGG - Intronic
1179547586 21:42123067-42123089 CTGTGGCTCACGTTGCAGGAGGG - Exonic
1179873806 21:44257263-44257285 CAGGTACTCAGGAGGCAGGAAGG + Intronic
1181102455 22:20550549-20550571 CAGTGACTCAGGAGGAAGGTTGG + Intronic
1181681652 22:24499652-24499674 ATGGGGCTCAGGAGACAGGTTGG - Intronic
1181824376 22:25502598-25502620 CAGAGGCTCAGGTGGGAGGATGG - Intergenic
1181863501 22:25837341-25837363 GTGTGGCCAGGGAGGCAGGAGGG + Intronic
1182497303 22:30718646-30718668 CTGTGGCCCCAGGGGCAGGAAGG - Intronic
1182546230 22:31078217-31078239 CCTTGGGTCAGGAGGCAAGAAGG - Intronic
1182630058 22:31678199-31678221 CTGTGGATAAGGAAGGAGGAGGG + Intronic
1182825344 22:33260190-33260212 GGGTGGGTCAGGAGGCAGGGGGG - Intronic
1182847072 22:33440073-33440095 CTGTGGCTAGGTAGGCAGAATGG - Intronic
1183026361 22:35068407-35068429 CTGTGTGTCTGCAGGCAGGAAGG + Intronic
1183029791 22:35094869-35094891 CTAAGGCTGGGGAGGCAGGAGGG + Intergenic
1183194500 22:36344147-36344169 CTGAGGCTCAGGTGGGAGGAAGG + Intronic
1183467008 22:37984866-37984888 GTCTGCCTCAGGTGGCAGGATGG + Intronic
1184409908 22:44320404-44320426 CCGTGGATCAGGGGGCAGGGAGG + Intergenic
1184766593 22:46575752-46575774 CTGTGCCTCCGCAGGCAGCATGG - Intergenic
1184844257 22:47071443-47071465 CAGTGGCTCAGGTGGCTGGGAGG - Intronic
1184895283 22:47403069-47403091 GTGTGACAGAGGAGGCAGGAGGG + Intergenic
1185083491 22:48723048-48723070 CTGGGGCTCAGGGGACAGGCTGG - Intronic
949518651 3:4829860-4829882 CTGAGGCTCAGGGGGAGGGAGGG - Intronic
950258949 3:11529937-11529959 CTCTTGCCCAGGAGACAGGAGGG + Intronic
950474442 3:13206706-13206728 CTGTGGGAAAGGAGGCAGGTGGG + Intergenic
952051833 3:29393779-29393801 TTGTGGCTCAGGGGGCATCACGG - Intronic
952365494 3:32671274-32671296 CTGTGTCTCAGGGGATAGGAAGG + Intergenic
954183372 3:48898833-48898855 CTGGGGCTGAGAAGCCAGGACGG - Exonic
954194760 3:48990069-48990091 CTGGGGCTCAAGGCGCAGGAAGG + Exonic
954596761 3:51831474-51831496 CAGGTGCTGAGGAGGCAGGAGGG - Intergenic
955087413 3:55716746-55716768 CTGTGTCACAGGAGTCAGGGTGG - Intronic
955389790 3:58513118-58513140 CTGGGGGTCAGTAGGGAGGAGGG - Intronic
955400030 3:58585106-58585128 CTGCGGGTAAGGAGCCAGGAAGG - Intronic
956859217 3:73305917-73305939 CTGTGGCCCAGGAGGCTGCGGGG + Intergenic
957354183 3:79060426-79060448 TTGTGGCTCAGGGGGCATCATGG + Intronic
957524947 3:81367962-81367984 GTGTGGCTAAAGAGACAGGAAGG - Intergenic
957810077 3:85210644-85210666 CCGAGGCTCAGGTGGGAGGATGG - Intronic
958017933 3:87964451-87964473 TTGTGGCTCAGGGAGGAGGAGGG - Intergenic
959063873 3:101638393-101638415 CTGCAGCTCAGGAGGCAGCCCGG + Intergenic
959976460 3:112466262-112466284 CTTTGTTTCAGGATGCAGGAAGG - Exonic
960365530 3:116767009-116767031 GTGAGGCCCAGGAAGCAGGAGGG - Intronic
961112461 3:124296689-124296711 GTGTGGCTGGGGAGGCAGGTGGG - Intronic
961331936 3:126147617-126147639 CAGTGGGGCAGGAGTCAGGAGGG + Intronic
961390588 3:126550335-126550357 CTGGGGCTCAGGAGGCACTGGGG - Intronic
961745024 3:129059279-129059301 CAGAGGCTCAAGAGGAAGGAGGG + Intergenic
962029332 3:131582815-131582837 TTGTGCCTCAGCAGCCAGGATGG - Intronic
962274570 3:134002290-134002312 CCCTGGGCCAGGAGGCAGGAGGG - Intronic
964268530 3:154929529-154929551 CTGTGAGCCAGGAGGCAAGAGGG + Intergenic
965051175 3:163649636-163649658 CTGAAGCCCAGGAGGCAGGAAGG - Intergenic
965178458 3:165367089-165367111 CTGTAGTTCAGTGGGCAGGAAGG + Intergenic
965635905 3:170780242-170780264 CTGTGTTTCTGGATGCAGGAGGG - Intronic
965960421 3:174422723-174422745 TTGGGGCTGAGGAGGGAGGAAGG + Intergenic
966177943 3:177159742-177159764 CTGTGCATCAGGTGGCAGCAGGG - Intronic
966840509 3:184083628-184083650 CTGGGGCTCCTGAGGCAGAAGGG + Intergenic
966878084 3:184335039-184335061 AAGTGGCTGAAGAGGCAGGATGG + Exonic
967042408 3:185705753-185705775 CTGTGTCTCTGGATGGAGGAAGG + Intronic
967975542 3:195032502-195032524 CGGTGGCTCAGGAAGCACCAGGG + Intergenic
968161694 3:196432191-196432213 CTCTTCCTCAGGAGGGAGGACGG + Intronic
968601299 4:1511190-1511212 CTGCAGCTCAGGAAACAGGAAGG - Intergenic
968641081 4:1715371-1715393 CTGTGGGTCAAGAAGCAGAATGG + Intergenic
969021476 4:4142817-4142839 CGGGGCCTCAGGAGGGAGGAAGG + Intergenic
969292965 4:6252405-6252427 CTGTGGCCCAGCAGGCTTGAGGG - Intergenic
969476228 4:7423979-7424001 CTGTGGCTTAGGAGGATGGCAGG + Intronic
969671335 4:8591983-8592005 CTGTGGCCCCGGAGGCTGGCCGG + Intronic
969690790 4:8703067-8703089 CTGTGTCTCGGGAGGAAGAAAGG - Intergenic
969732390 4:8964600-8964622 CGGGGCCTCAGGAGGGAGGAAGG - Intergenic
969791971 4:9498683-9498705 CGGGGCCTCAGGAGGGAGGAAGG - Intergenic
969856393 4:10003126-10003148 CTGTTTATCAGGTGGCAGGAGGG - Intronic
970309557 4:14767906-14767928 CTGTGGCATGGGAGGCAGCAAGG - Intergenic
971045004 4:22796366-22796388 CTTTGGCTCAGGAGTAAGGTAGG + Intergenic
971211040 4:24616575-24616597 CAGTTACTCAGGAGGCAGGCAGG - Intergenic
973052297 4:45610802-45610824 CTTAGTCTCTGGAGGCAGGAGGG - Intergenic
974423323 4:61707048-61707070 CTGTGTCTCAGGAATCAGGAAGG + Intronic
974442419 4:61937278-61937300 GTGTGGCAAATGAGGCAGGAAGG - Intronic
974623072 4:64385485-64385507 CTGTGTCCCAGGAAACAGGAGGG - Intronic
974660973 4:64888406-64888428 CAGTGGGACTGGAGGCAGGAGGG + Intergenic
976326024 4:83772665-83772687 CTGTGGTTCAGGAACCTGGATGG + Intergenic
977260411 4:94790434-94790456 TTGGGGTTCTGGAGGCAGGAAGG + Intronic
978292817 4:107165591-107165613 CAGTGGCTGAGAAGGAAGGAGGG + Intronic
979721856 4:123909647-123909669 CTGTGGCTCAGGAATTTGGAAGG + Intergenic
980654943 4:135769514-135769536 CTGTGTCTCAGGGAGTAGGAAGG + Intergenic
981039896 4:140213418-140213440 CTGTGGGTCAGGAGTCTGGGTGG + Intergenic
984183890 4:176518963-176518985 CTGTGTCTCAGAAGGCAGGATGG - Intergenic
984215746 4:176910960-176910982 CTGGAGCTAAGGAGGCTGGATGG + Intergenic
984624873 4:181995968-181995990 CTGGGGCTCTTGAGGGAGGAAGG - Intergenic
985440485 4:189980101-189980123 CAGGGGCCCAGGAGGCAGCAGGG - Intergenic
985875465 5:2591045-2591067 CTGAGGCTCTGCAGACAGGAGGG + Intergenic
985901291 5:2796729-2796751 CTGTGGGTCAGGATTTAGGATGG + Intergenic
986386658 5:7240854-7240876 CAGTGGCTCAGGATACATGAGGG + Intergenic
987038623 5:14041265-14041287 CTGGGGACCATGAGGCAGGAAGG - Intergenic
987363915 5:17131245-17131267 CTCAGACTCTGGAGGCAGGAAGG + Intronic
987590055 5:19912880-19912902 CTGAGGCTGAGGAAGCAGCAGGG + Intronic
988698657 5:33649989-33650011 CTATGAATCAGGAGTCAGGAAGG + Intronic
992171209 5:74103818-74103840 TTGTGGCTGACCAGGCAGGATGG + Intergenic
992554011 5:77885621-77885643 CTGTGGCTCAGGACCTAGGAGGG - Intergenic
994926250 5:106120721-106120743 CTGTGAACCTGGAGGCAGGAGGG - Intergenic
995204997 5:109469583-109469605 CTGAAGCTCAGGATGCATGAAGG - Intergenic
995372976 5:111440221-111440243 CCTTGACTCAGGAGTCAGGAGGG + Intronic
996022872 5:118611119-118611141 CTTGGGATTAGGAGGCAGGAGGG - Intergenic
997230445 5:132238637-132238659 CACTGGCTGAGGAGGCAGGGAGG + Intronic
997589919 5:135066260-135066282 GTGTGGCCAAGGAGGCGGGAAGG + Intronic
998998288 5:147891149-147891171 CTGAGGCTCAGGAGGCTGATTGG - Intronic
999213010 5:149906584-149906606 ATGAGGCTCAAGAGGGAGGAAGG - Intronic
1000009882 5:157220961-157220983 CGGAGGCTGAGGAGGGAGGATGG - Intronic
1000046270 5:157524283-157524305 CTGGGGCCCAGGAGGCTGGGTGG + Intronic
1000145948 5:158453473-158453495 CTGAGGCTTAGGAGGGTGGAGGG + Intergenic
1001012446 5:168110560-168110582 CTGTCTCTCAGCAGGCAGAATGG - Intronic
1001118774 5:168961669-168961691 CTGTGGTGCAGAAAGCAGGATGG + Intronic
1001562093 5:172676535-172676557 CATTGCCTCAGGAGTCAGGAGGG - Intronic
1002201306 5:177530157-177530179 CTGGGGCTCATCTGGCAGGAGGG + Intronic
1002204535 5:177553883-177553905 CTGTGGCTGAGGGAGCAGGTGGG + Intronic
1002565582 5:180111417-180111439 CCGTGGCCCAGTAGGCAGGAGGG + Intronic
1002614172 5:180440255-180440277 CTGTGGCTCAGCGGTCAGCAAGG - Intergenic
1004260630 6:14104520-14104542 CTGGGGCTCAGGAGCAAGGTGGG - Intergenic
1004415864 6:15423577-15423599 GTGTGGCTTACGTGGCAGGATGG + Intronic
1004580486 6:16946485-16946507 GTGTGGCTAAGGAGGCAAGGTGG + Intergenic
1005958165 6:30679104-30679126 CTGTGGTCCAGGAGAGAGGAGGG - Intronic
1005977501 6:30811246-30811268 TGGTGGCTCAGAAGGCTGGATGG - Intergenic
1006153394 6:32001263-32001285 CTGGGACTGAGGAGGCAGAATGG + Intronic
1006159702 6:32034000-32034022 CTGGGACTGAGGAGGCAGAATGG + Intronic
1006425818 6:33962330-33962352 CTGTGTCTGAGAAGGAAGGAAGG - Intergenic
1006657532 6:35608580-35608602 CGGTGGCTGAGGTGGGAGGATGG + Intronic
1006659817 6:35631407-35631429 CTGGGGCTCAGGGTCCAGGAAGG + Intronic
1006683594 6:35814529-35814551 CTGTGGCTGAGGGGGAAGGAGGG - Exonic
1007176803 6:39902737-39902759 CTGTGGATTAGTAGACAGGATGG - Exonic
1007224826 6:40305826-40305848 CTATGGCTAAAGAGGCAGAAGGG + Intergenic
1007325046 6:41053318-41053340 CTGTGGCTCAGGAGTCACTGAGG - Exonic
1007662830 6:43496898-43496920 CTGAACCTCAGGAGGCCGGAGGG + Intronic
1007767757 6:44171033-44171055 CTGTGGCTCAGTAGGCTGGAGGG + Intronic
1007858655 6:44884621-44884643 ATGTGGATCAGGAGCCAAGATGG + Intronic
1008044275 6:46835557-46835579 CTGTGGCTGGGGAGACAGGCAGG + Intronic
1008770163 6:54968600-54968622 CTGTTGATTAGAAGGCAGGAGGG + Intergenic
1009884166 6:69604486-69604508 GTGAGGCTGAGAAGGCAGGATGG - Intergenic
1010049840 6:71489936-71489958 CTGTGACTCAGCAGTCAGGAAGG - Intergenic
1010375763 6:75168403-75168425 CTGTGGTACAGTTGGCAGGATGG + Intronic
1010732154 6:79402760-79402782 CTGTCACCCAGGAGGCAGGTAGG + Intergenic
1013122395 6:107152180-107152202 CTGTCACTCAGCAGGCAGCAGGG + Intergenic
1013233325 6:108175781-108175803 CTGCGGCGCAGGAAGCCGGAGGG + Intronic
1013418178 6:109943230-109943252 CTAAAGCTCAGGAGGCAGGTCGG - Intergenic
1013429878 6:110046003-110046025 TCGTGGCTCAGGAGGCACAATGG - Intergenic
1013743604 6:113318769-113318791 CTGGGGCTGGGGAGGAAGGAAGG - Intergenic
1015206762 6:130649450-130649472 AGTTAGCTCAGGAGGCAGGACGG - Intergenic
1015510124 6:134030232-134030254 CTGTGGCCCAGGAGATAAGAGGG - Intronic
1016367539 6:143335909-143335931 CTGTGGCTCAGGATGGAGTGTGG - Intronic
1016400545 6:143675533-143675555 CTGGGGGTGAGGAGGCAGGAGGG - Intronic
1016797163 6:148130484-148130506 CTGTAGCTGAGCAGGCAGGAAGG - Intergenic
1016993880 6:149947487-149947509 AGGTGGGTGAGGAGGCAGGATGG + Intronic
1017004453 6:150020050-150020072 AGGTGGGTGAGGAGGCAGGATGG - Intronic
1017484012 6:154886088-154886110 CAGTGGTCCAGGAGGCAGGAAGG + Intronic
1019144953 6:169970559-169970581 CTGTGCCTGCAGAGGCAGGAGGG + Intergenic
1019389603 7:778705-778727 ACGTGTCTCAGGAGGAAGGACGG - Intronic
1019539330 7:1544711-1544733 CTGAGGGTCAGGAGGCAGGGAGG + Exonic
1019571827 7:1716434-1716456 CTAAGGCTCTGGAGGGAGGATGG - Intronic
1020308898 7:6854846-6854868 CGGGGCCTCAGGAGGGAGGAGGG + Intergenic
1020371675 7:7438906-7438928 CTGTGGCCCAAGAGGCAAAATGG - Intronic
1020437104 7:8176226-8176248 CTGTAGCTCAGCATGCATGAAGG - Intronic
1021196464 7:17679713-17679735 TTGGGGCGCAGGAGGGAGGAGGG + Intergenic
1021622637 7:22563650-22563672 CCCTGGCTTAGGAGACAGGAAGG - Intronic
1021901194 7:25287537-25287559 CTCTGGCTCAGGAGGCTGCCTGG + Intergenic
1022324388 7:29317877-29317899 CGGAGGCTGAGGAGGGAGGATGG + Intronic
1022959232 7:35410426-35410448 CTGTGTCGCAGGAGGATGGATGG - Intergenic
1023124546 7:36942477-36942499 CTCTGTCTCAGGAGACAGGTGGG + Intronic
1023803122 7:43852062-43852084 CTGTAGTTCAGCAAGCAGGAGGG - Intergenic
1024000445 7:45185809-45185831 CAGAGGCTCACAAGGCAGGAAGG + Intronic
1024253176 7:47521489-47521511 CTGGAGCCCAGGAGGCATGAGGG - Intronic
1024541059 7:50475494-50475516 CTGTGAGCCAGGAGGCAGGGGGG - Intronic
1024715433 7:52074645-52074667 CTGTGGCACAGGAGACCAGAAGG + Intergenic
1024820349 7:53322146-53322168 CTAAGGAACAGGAGGCAGGAGGG + Intergenic
1025967231 7:66285443-66285465 ATGTGGCTCCTGAGGTAGGAGGG + Intronic
1026018925 7:66693474-66693496 CTGTGTCTCTGGGGGCAGCAGGG - Intronic
1026445440 7:70480683-70480705 CTGTGTGGCAGGAGACAGGAAGG + Intronic
1026850428 7:73719893-73719915 CTGGGGCAGAGGAGGCAGCAGGG - Intergenic
1026865604 7:73822386-73822408 CTGGGGAGCAGGAGGCAGGGTGG - Intronic
1026923473 7:74173311-74173333 CAGAGGCTAAGGCGGCAGGATGG + Intergenic
1026940819 7:74287030-74287052 ATGTGCCTCAGGAGGTAGGCAGG - Intergenic
1029188456 7:98755579-98755601 CTGTAGTTCAGGAGGAAGGAGGG + Intergenic
1032180882 7:129676464-129676486 CTGTGTCTCAGGGAACAGGAAGG + Intronic
1032193223 7:129776041-129776063 CGGTGGCCCAGAAGGCAGGGTGG + Intergenic
1032501739 7:132404831-132404853 CTGTGGCCCAGGAGACCAGAAGG + Intronic
1032883876 7:136116875-136116897 CTGTGGCTGAAGAGGAAGGAGGG - Intergenic
1033174783 7:139113964-139113986 CTGAGGCTCTGCAGGGAGGAAGG + Intergenic
1033339219 7:140479083-140479105 CTGCGGCGCGGGAGGGAGGAGGG - Intronic
1034276854 7:149827656-149827678 CTGTGGCTGAGAAGGCAAGATGG + Intergenic
1035321625 7:158033407-158033429 CCGTGACTCAGGAGGCTGCAAGG - Intronic
1035359157 7:158298899-158298921 CTGTGGCTCAGGAGGTATTTGGG - Intronic
1035564703 8:633749-633771 CTTTGGCACAGGTGCCAGGATGG + Intronic
1036741750 8:11368897-11368919 CTGTGGCTCAGGCTGGAGTATGG - Intergenic
1036815777 8:11902047-11902069 CCGAGGCTCAGGTGGGAGGATGG - Intergenic
1037389080 8:18373998-18374020 CTGTGACTCAGACTGCAGGAGGG + Intergenic
1037877311 8:22554429-22554451 CTGTGGGGAAGGAGGAAGGAAGG - Intronic
1038174407 8:25167033-25167055 CTGAGGCTGAGGTGGAAGGATGG - Intergenic
1038659380 8:29483500-29483522 TTTTGGCTGAGGAGGGAGGATGG + Intergenic
1039782292 8:40797381-40797403 CTGGGGCCCAGCACGCAGGATGG - Intronic
1039914720 8:41851482-41851504 GTGAGGCCCAGCAGGCAGGAAGG - Intronic
1040530923 8:48265696-48265718 TTGTGCTTCAGAAGGCAGGATGG + Intergenic
1040937843 8:52799702-52799724 CTATAAATCAGGAGGCAGGAAGG + Intergenic
1041776488 8:61528720-61528742 CTGTGGGTGAAGGGGCAGGAAGG - Intronic
1042820052 8:72920536-72920558 CTGAGGCTGAGGTGGGAGGATGG + Intronic
1043877570 8:85503329-85503351 CTGTGGTTCAGTGGGGAGGAAGG - Intergenic
1043888500 8:85630389-85630411 CAGAGGCTCAGGTGGGAGGACGG + Intergenic
1044170396 8:89043906-89043928 TTGTGGCTCAGGGGGCATCAGGG + Intergenic
1044919649 8:97155531-97155553 CAGTGACTCAGGAGGCAGTGGGG - Intergenic
1047507570 8:125491833-125491855 CTGTGTCAGAGGAGGCTGGAGGG + Intergenic
1047975586 8:130127155-130127177 GTGTGGCTGAGTAGGAAGGAAGG + Intronic
1048020974 8:130538735-130538757 CTATGACTCAGGGGACAGGATGG - Intergenic
1048450609 8:134530045-134530067 CTGTGGCATAGCAGGCAGGAGGG + Intronic
1048636458 8:136301134-136301156 GTGTGGGTCAGAAGGCAGAAGGG + Intergenic
1048738273 8:137525995-137526017 AGGTGGCTCAGGAGGCATGTGGG + Intergenic
1048959565 8:139564665-139564687 ATGTGGCTAATTAGGCAGGAAGG + Intergenic
1049018442 8:139937890-139937912 CTGTGGCTCAGGACGCCGACAGG + Intronic
1049060202 8:140270695-140270717 CCGGAGCTGAGGAGGCAGGAGGG + Intronic
1049211229 8:141387287-141387309 CTGGAGCTCAGCAGGCAGGAGGG - Intergenic
1049232595 8:141492277-141492299 CTGTGTCCCAGGAGGCGGGTAGG + Intergenic
1049232821 8:141493056-141493078 CTGTGTCCCAGGAGGCGGGTAGG + Intergenic
1049389324 8:142360014-142360036 CTGTGCCACAGAAGCCAGGAAGG + Intronic
1049422796 8:142524351-142524373 CCGAGGCCCAGGAGGCAGGTGGG - Intronic
1049526744 8:143130708-143130730 CATCGGCTGAGGAGGCAGGAGGG - Intergenic
1049561076 8:143310587-143310609 CTTTCCCTAAGGAGGCAGGAAGG - Intronic
1049600696 8:143506062-143506084 CTGGGGCTGAGGAGGCCGGGAGG - Intronic
1049621565 8:143600593-143600615 CTGTGGCTGATGAGGAAGCAGGG - Exonic
1049637633 8:143697576-143697598 CAGCGACCCAGGAGGCAGGAAGG - Intronic
1050077055 9:1876195-1876217 CTGGCGCTCAGAAGGCAGGGAGG - Intergenic
1050598187 9:7224924-7224946 ATCTGGTTCAGGAGGCAGAAAGG - Intergenic
1050774798 9:9246486-9246508 CTGTGGGAGTGGAGGCAGGAAGG - Intronic
1050847416 9:10239819-10239841 CTGAGGGGCAAGAGGCAGGAGGG - Intronic
1050991964 9:12167032-12167054 CTCTGGATCAGAAGGCAGGATGG + Intergenic
1051371711 9:16364717-16364739 CTGTGGCCTGGTAGGCAGGAGGG - Intergenic
1053184985 9:36008493-36008515 CAGAGGCTGAGGAGGGAGGATGG - Intergenic
1053307553 9:36995127-36995149 GTGTGGCTTTGGGGGCAGGAAGG - Intronic
1053596499 9:39566998-39567020 CTGTGGAGCAGCAGGAAGGAAGG - Intergenic
1053653327 9:40191434-40191456 CTGTGGCTGGGGAGACAGGCAGG - Intergenic
1053751956 9:41266199-41266221 CTCAGGCGCAGGAGGGAGGACGG + Intergenic
1053854464 9:42323638-42323660 CTGTGGAGCAGCAGGAAGGAAGG - Intergenic
1053903729 9:42820724-42820746 CTGTGGCTGGGGAGACAGGCAGG - Intergenic
1054257479 9:62830529-62830551 CTCAGGCGCAGGAGGGAGGACGG + Intergenic
1054569760 9:66798020-66798042 CTGTGGAGCAGCAGGAAGGAAGG + Intergenic
1055307871 9:74949755-74949777 CTGTGTCTTTGGAGGCAGGAAGG + Intronic
1055514535 9:77022170-77022192 CTGGGGCTCAAGAGGGGGGAAGG - Intergenic
1056497255 9:87170506-87170528 CTGTTGGTCAAGAGGCAGAAAGG + Intergenic
1057216174 9:93230119-93230141 CTCAGGCTCAGGACGCAGGCTGG + Intronic
1057364873 9:94410340-94410362 GTGAGGCTCAGGTGGCAGGTGGG - Intronic
1057519798 9:95751821-95751843 CTGAGCCACAGGAGGGAGGATGG + Intergenic
1057658457 9:96977751-96977773 GTGAGGCTCAGGCGGCAGGTGGG + Intronic
1057785145 9:98081675-98081697 CTATGACTCAGAAGGCAAGAAGG - Intronic
1057912507 9:99031100-99031122 CTGTGGCAAAGGAGCCAGCAGGG - Intronic
1057933235 9:99214303-99214325 CCTTGGCTCAGGGGTCAGGATGG + Intergenic
1058412147 9:104745979-104746001 CTGAGGCTGAGGAGGGAAGAAGG - Intergenic
1058603827 9:106699572-106699594 CTGTGAATCACGAAGCAGGAGGG - Intergenic
1058879094 9:109271240-109271262 CTGTGGCTGAGCAGGAAGGATGG - Intronic
1059108410 9:111531784-111531806 ATGAGGCTGAGGAGGGAGGATGG - Intronic
1059441390 9:114309024-114309046 CTCTGGCTCTGGAGTCAGGCAGG + Intronic
1060042097 9:120308638-120308660 CTGTGCCTCTTGAGGGAGGAAGG + Intergenic
1060112004 9:120913263-120913285 CTGCCGCTCTGGAGACAGGATGG + Intronic
1060213224 9:121723160-121723182 CTGTGGCTCTGGAAGGAAGAGGG + Intronic
1060745956 9:126131072-126131094 CTGTGGCTCAGGAAGCTTGACGG + Intergenic
1060860309 9:126948631-126948653 CTGAAGCTGAGGAGGCAGAAGGG - Intronic
1060963457 9:127698153-127698175 GGGAGGCTCAGGTGGCAGGATGG + Intronic
1061045583 9:128163312-128163334 CTGAGGCTCAGGAAGCAGTAGGG + Intronic
1061198942 9:129125051-129125073 CTGAGGCTCTGGGTGCAGGATGG + Intronic
1061332525 9:129904716-129904738 CTGTGGGAAAGAAGGCAGGAAGG - Intronic
1061489010 9:130934832-130934854 GTGTGGCTGAGGAGGTAGAATGG - Intronic
1061530955 9:131212433-131212455 TTGTGGCTCAGGGGGCATCACGG + Intronic
1061940404 9:133880895-133880917 CCGTGGCTCAGGATGGAGGCAGG + Intronic
1062475530 9:136724969-136724991 CTGTGGCCCTGGGGGCAGGTGGG + Intergenic
1185623711 X:1468560-1468582 CCGGGGCTCAGCGGGCAGGATGG + Intronic
1186720672 X:12300365-12300387 GTAAGGCTCTGGAGGCAGGATGG + Intronic
1187066759 X:15847956-15847978 CTGTGGATAAGGAGCGAGGATGG - Intronic
1187120093 X:16397060-16397082 CTATATCTCTGGAGGCAGGAAGG - Intergenic
1187705796 X:22008177-22008199 GTGTAGCCCAGGAGGCAGTAAGG + Intergenic
1188062041 X:25612809-25612831 GTATGGCTCTGGAGGCTGGAGGG + Intergenic
1189315590 X:40053876-40053898 CTGTGGCTCAGGGGTGAGCATGG - Exonic
1189911197 X:45812041-45812063 CTATGTTTCAGGAGGCAAGAAGG - Intergenic
1190260775 X:48795486-48795508 CTGTGGGTCAGGCGGCAGGCTGG + Intergenic
1192214650 X:69150135-69150157 CTGCAGCTCCGGGGGCAGGAAGG + Intergenic
1192224931 X:69221628-69221650 CTGCAGCTCTGGGGGCAGGATGG - Intergenic
1193326330 X:80182122-80182144 CTCTGGGTGAGCAGGCAGGATGG - Intergenic
1193799031 X:85913426-85913448 CTGGAGGACAGGAGGCAGGAAGG + Intronic
1194978309 X:100414868-100414890 CAGTGGCGGGGGAGGCAGGAAGG - Intergenic
1195202666 X:102565324-102565346 GCTGGGCTCAGGAGGCAGGAAGG - Intergenic
1195254788 X:103080978-103081000 CGCAGGCTCAGGAGGCAGAAGGG + Intronic
1195509508 X:105697992-105698014 CTGAATCTCAGGAAGCAGGAGGG - Intronic
1195987917 X:110651329-110651351 CTGTGCCTCAGGAAATAGGAAGG + Intergenic
1196297284 X:114012578-114012600 CTTAAGCCCAGGAGGCAGGAGGG + Intergenic
1196856548 X:119990583-119990605 GTGTGGCCCTGGAGGCAGGCGGG - Intergenic
1198239202 X:134766494-134766516 ATGGGGCTGAGGAGGCAGGCCGG + Intergenic
1198412847 X:136389217-136389239 ATTTTGCCCAGGAGGCAGGAAGG - Intronic
1198845148 X:140902257-140902279 GTATTCCTCAGGAGGCAGGAGGG + Intergenic