ID: 1169265657

View in Genome Browser
Species Human (GRCh38)
Location 20:4165851-4165873
Sequence CTCTGGTTGCTGAGGGGGCA TGG
Strand +
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 424
Summary {0: 1, 1: 0, 2: 1, 3: 38, 4: 384}

Found 1 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1169265650_1169265657 -10 Left 1169265650 20:4165838-4165860 CCTCCCAGCAGATCTCTGGTTGC 0: 1
1: 0
2: 1
3: 12
4: 179
Right 1169265657 20:4165851-4165873 CTCTGGTTGCTGAGGGGGCATGG 0: 1
1: 0
2: 1
3: 38
4: 384

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1169265657 Original CRISPR CTCTGGTTGCTGAGGGGGCA TGG Intronic
900008966 1:88806-88828 CTCTGGGTGCTGAGGGCGAGAGG - Intergenic
900197864 1:1386210-1386232 CTCTCGTTCCTGAGGGGGACTGG - Intronic
900212351 1:1462345-1462367 CTGTGGGTGCTGAGTGGACAGGG + Intronic
900231278 1:1559665-1559687 CTCAGGTGGCTGAGGCGGGAGGG - Intronic
900243778 1:1628667-1628689 CCCTGGTGGCTGATGGGGCCGGG + Exonic
900391181 1:2434663-2434685 CTCTGCTGGCTGTGGGGGGAAGG - Intronic
901252871 1:7795087-7795109 CTCTGGATGCTTGGGGGGGACGG + Intronic
901370608 1:8794456-8794478 CTGTGATTGTTGAGGTGGCAGGG + Intronic
902722005 1:18309977-18309999 CTCTAGCTGCTGATGGGCCAAGG + Intronic
903184941 1:21623482-21623504 CTTTGGATGTTGCGGGGGCAGGG + Intronic
903326197 1:22569905-22569927 CTCTGAATCCTGCGGGGGCAGGG + Intronic
903556670 1:24198983-24199005 CTCAGGAGGCTGAGGGGGGAGGG - Intergenic
903879591 1:26500150-26500172 CTCTGGCTGCTGTGGGGCCGGGG - Intergenic
904558749 1:31382814-31382836 CTCTAGTTGCAGTGGGTGCATGG - Intergenic
904596587 1:31650125-31650147 CTGTGGATGCTGTGGGAGCAGGG + Intergenic
904613518 1:31737814-31737836 CTATGGTAGATGAGGGGACAGGG - Intronic
904838246 1:33353642-33353664 CTGTGTTTGCTGAGGGGGTAGGG - Intronic
905641513 1:39593107-39593129 CTCTGGCTGCTGTGGGAGAATGG - Intergenic
906168779 1:43707041-43707063 CCCTGGTGGGTAAGGGGGCACGG - Intronic
906205187 1:43982825-43982847 CTCTGGTTGCATATGGAGCATGG + Intronic
907393145 1:54171775-54171797 CTCTTGGAGCTGTGGGGGCATGG - Intronic
909506619 1:76397896-76397918 CTCTGGTTGCTGTGTTTGCAAGG + Intronic
910472655 1:87571853-87571875 CTGTGGATGCTTTGGGGGCATGG + Intergenic
912534737 1:110358216-110358238 CTCTGGAGGCTGAGGGAGTATGG + Intergenic
912700519 1:111875054-111875076 CTTTGGTTCCAGAGGGGCCATGG + Intronic
913346882 1:117818404-117818426 CTCTCGTTCCTGATGGGGCATGG - Intergenic
913469742 1:119176188-119176210 CTCTGGTATTTGAGGGAGCAGGG - Intergenic
914936889 1:151989479-151989501 TACTGGTTGCTGAGGAGACAAGG - Intronic
915099212 1:153486442-153486464 CTCTGCTCTCTGAGGTGGCAAGG - Intergenic
915308442 1:154994439-154994461 CACTGGTTCCTGAGTGGGGAGGG + Intergenic
917111740 1:171556013-171556035 CTCTGTATGCTCTGGGGGCAGGG - Intronic
917416681 1:174817698-174817720 TTCTGGTTGCTGTGTGGGAATGG + Intronic
919610923 1:199744800-199744822 CTGTGGTTGATGAAGAGGCAGGG + Intergenic
919944389 1:202308993-202309015 GTGGGATTGCTGAGGGGGCAGGG - Intronic
919975142 1:202605564-202605586 CTCTGGTGGCTGAGAGGGTGGGG - Intronic
920252384 1:204630345-204630367 CTCTGGCGGCTGAGGAGACAGGG + Intronic
920445441 1:206012641-206012663 ACCTGGATGCTGAGGGGACAGGG + Exonic
920902666 1:210127001-210127023 CTATGGCTGTTGAGTGGGCAGGG + Intronic
922387275 1:225099544-225099566 TTCTGGTTGGTGTGGGGGCTGGG - Intronic
922722053 1:227904267-227904289 CTCTGGGTGCAGACGGGGCGGGG + Intergenic
922991222 1:229913479-229913501 CTCTGATTGATGAGGGTGCTAGG + Intergenic
923441754 1:234027352-234027374 CTGTGGATGGTGAGGTGGCACGG - Intronic
924520611 1:244802998-244803020 CTCTGGGACCTGAGGCGGCAGGG - Intergenic
1063412399 10:5846658-5846680 CTCTGTTTACTAAGAGGGCAGGG + Intergenic
1063545619 10:6978283-6978305 CTCTCGTTTCTGAGAGGGCAGGG + Intergenic
1066663387 10:37758483-37758505 CTCTGTCCACTGAGGGGGCATGG - Intergenic
1069956831 10:72057147-72057169 CTCTGTTTGCTGTTGGGCCAAGG + Intergenic
1070205954 10:74261680-74261702 CACTGGTTGCTAATGGAGCAAGG - Intronic
1071288325 10:84169441-84169463 CTCTGGTTGATGAAGTGCCAGGG + Intergenic
1072440190 10:95447358-95447380 CTCTGGAGGCTGAGGTGGGAGGG + Intronic
1074032987 10:109707609-109707631 CTCTGGAGGCTGAGGTGGAAGGG - Intergenic
1075295966 10:121275540-121275562 AACTGGTGGCTGATGGGGCAAGG - Intergenic
1076477446 10:130762462-130762484 CTCTGGGTCCTGCGGGTGCAGGG - Intergenic
1076651949 10:131996141-131996163 CTCAGGTAGCTGAGGTGGGATGG - Intergenic
1076666758 10:132097531-132097553 CCATGGTTACAGAGGGGGCAGGG + Intergenic
1077023539 11:430171-430193 ATCTCCTTGCTGAAGGGGCAGGG + Exonic
1077117415 11:891406-891428 CTTTGGTTGCTGTGGGGTGAGGG + Intronic
1077529049 11:3086626-3086648 CTCTGGTTGCTGTGAGGGGTGGG + Intergenic
1077927794 11:6699012-6699034 CTCTGGTTTCTGAGTGGGTGAGG - Intergenic
1080616303 11:33947569-33947591 CTCTGGTGACTGAAGGGGCCTGG - Intergenic
1082060647 11:47857048-47857070 CTCTGGAGGCTGAGGTGGGAGGG + Intergenic
1082581623 11:54876835-54876857 CTATGGTTGTGGAGGGGGGAGGG + Intergenic
1083845279 11:65328396-65328418 CTCTGGAGGCTGAGGTGGCAAGG + Intergenic
1084055956 11:66633245-66633267 CTCTGGTTCCTGAGGCTGGATGG + Intronic
1084534220 11:69747191-69747213 CTCTGGGTGCTGGGCTGGCAGGG + Intergenic
1084598896 11:70133295-70133317 CTCTGCTTACTGATGGGGCACGG - Intronic
1084944288 11:72630560-72630582 CTGGGGTTGTGGAGGGGGCATGG + Intronic
1088848624 11:113687978-113688000 CTGTGGTTGCTGAGGGATGAGGG - Exonic
1089151848 11:116370470-116370492 CTCTGGTTACTCAGGGGCCTTGG + Intergenic
1089698900 11:120232342-120232364 CTCTGGTGGATGAGGGGACAAGG + Intergenic
1091242592 11:134063931-134063953 ATCTGCTTGCTCAAGGGGCATGG + Intergenic
1091822823 12:3489408-3489430 CTCTGCTTGCTGATGGACCATGG + Intronic
1093942069 12:25066037-25066059 CTCTAGTTGCTTAGTGGGCAGGG + Intronic
1094362101 12:29641060-29641082 CTGTGGCTGCTGTGGGGGCTGGG - Intronic
1094557155 12:31512322-31512344 CTCTGGAGGCTGAGGTGGGAGGG - Intronic
1096226117 12:49867891-49867913 CTCTGGGTCCTGAGGGGGGGTGG - Exonic
1096610385 12:52797127-52797149 CTGGGGTTTGTGAGGGGGCATGG - Intergenic
1097067025 12:56328180-56328202 CTGAGGTTGTTGCGGGGGCAGGG - Intronic
1097231364 12:57513504-57513526 CTCAGGATGCTGAGGCGGGATGG + Intronic
1101778820 12:107817445-107817467 CTGTGGTGGCTGAGGTGGAATGG + Intergenic
1101850513 12:108398301-108398323 CTCTGGTTGCTAATGGAGAAAGG - Intergenic
1102804491 12:115767687-115767709 CTCTGGTGGGGGTGGGGGCAGGG + Intergenic
1103273987 12:119696632-119696654 CTCTGGAGGCTGAGGTGGCGGGG - Intronic
1103675280 12:122651105-122651127 CTCTGGAGGCTGAGGTGGGAGGG - Intergenic
1104771896 12:131368939-131368961 ACCTGGCTGCTCAGGGGGCAGGG + Intergenic
1105223707 13:18408378-18408400 CTCAGGTTGAGGAGGGGCCAGGG + Intergenic
1105415644 13:20209052-20209074 CTCCTGTGGCTGAAGGGGCAAGG - Intergenic
1106559017 13:30833011-30833033 CTCTGTGTGCTGCGGGGACAGGG - Intergenic
1106708859 13:32310553-32310575 ATCTGATTCCTGAGGGAGCATGG - Intronic
1106716448 13:32393727-32393749 CTCTGTCTGCTGAGAGGGCCTGG - Intronic
1107401037 13:40069328-40069350 CTCTGGACACTGAGGGGTCATGG + Intergenic
1107742439 13:43465618-43465640 CTCTTTCTGCTGAGGGGGCCTGG - Intronic
1109222886 13:59658596-59658618 CTCTGCTTGCTGAGGTAGCTTGG + Intergenic
1109624990 13:64962761-64962783 CTGTGGTTGCTGTGGGGGATGGG - Intergenic
1110459039 13:75723971-75723993 CTCTTGTTGTGGAAGGGGCAAGG + Intronic
1114007863 14:18333267-18333289 CTCAGGTTGAAGAGGGGCCAGGG + Intergenic
1114471657 14:22967398-22967420 CTCTGGAGGCTGAGGTGGGAGGG - Intronic
1114533840 14:23411013-23411035 CTCTGGTTGCTTAGGTGCCCTGG + Intergenic
1114568214 14:23647716-23647738 TTCTGGATGTTGAGGGGGGAGGG + Intergenic
1115211511 14:30971273-30971295 CTCTGGTTGATGAAATGGCAGGG - Intronic
1118076026 14:62300158-62300180 CTCTGGAGGCTGAGGTGGGAGGG - Intergenic
1118201722 14:63680225-63680247 GTCTGGTTGTTGACCGGGCATGG - Intergenic
1119005588 14:70924693-70924715 CTCAGGATGCTGAGGTGGGAGGG - Intronic
1121136806 14:91506656-91506678 CTCTGGAGGCTGAGGTGGGAGGG - Intronic
1121839158 14:97118384-97118406 ATCTGGTTGCTGGGGCTGCAAGG - Intergenic
1122052484 14:99069556-99069578 CTCAGGTTGTTGTGGGGGAAAGG - Intergenic
1122204087 14:100139721-100139743 CCTTGGCTGCTGAGGGGTCATGG - Intronic
1122799665 14:104223290-104223312 TGCTGATGGCTGAGGGGGCAGGG + Intergenic
1124350428 15:28951505-28951527 CTCTGTCTGCTGAGAGGGCCTGG - Intronic
1124562878 15:30791758-30791780 GGCTGCTTGCTGAAGGGGCAGGG - Intergenic
1124960427 15:34389465-34389487 AGCTGTTTGCTGAAGGGGCAGGG + Intronic
1124977056 15:34535686-34535708 AGCTGTTTGCTGAAGGGGCAGGG + Intronic
1126086393 15:45014444-45014466 CTCTGGTTTTTGAGAGAGCAGGG - Intergenic
1127058075 15:55152706-55152728 CTCAGGAGGCTGAGGGGGGAGGG + Intergenic
1127399630 15:58573096-58573118 CTCTGGTCGCTGTGAGGGGAAGG - Intergenic
1129237262 15:74231166-74231188 GTCTGCTTGCTGAGTGGGCCAGG - Intergenic
1129771550 15:78206337-78206359 CTCTGGGAGCTGTGGGGGCAAGG - Intronic
1129801860 15:78421029-78421051 ACCTGGGTGCTGAGAGGGCAGGG - Intergenic
1129914170 15:79253912-79253934 CTCAGGTTGATGAGGGGTCAGGG + Intergenic
1130763757 15:86849306-86849328 CTCTGGCTGCTGAAGCGGCCAGG + Intronic
1131442200 15:92467522-92467544 TTCTGGGTGCCGAGGGGCCAGGG - Exonic
1131507992 15:93033093-93033115 CTCTGGGGGCTGAGGAGGCTCGG + Intergenic
1131535319 15:93232527-93232549 CGCTGGTTGCGGAGGGGCCGGGG - Intergenic
1132727577 16:1345562-1345584 CTGGGGTTGCTGAGGAGGCTGGG - Intronic
1132727590 16:1345598-1345620 CTGGGGTTGCTGAGGAGGCTGGG - Intronic
1132747363 16:1442633-1442655 CTCTGTTTTCTGGTGGGGCAGGG - Intronic
1133184817 16:4088397-4088419 CTCTGGAGGCTGAGGTGGGAGGG - Intronic
1134093822 16:11405760-11405782 CTCTGGCTGCTGTGTGGGGAGGG - Intronic
1134122015 16:11591290-11591312 CTCTGGAGGCTGAGGTGGGAGGG - Intronic
1135136749 16:19890490-19890512 CTCTGGAGGCTGAGGTGGGAGGG + Intergenic
1135267251 16:21038058-21038080 GCCTGGTTGCTGACGGGGCAAGG - Intronic
1135589485 16:23694951-23694973 AGCTGGTTGCTGAGGGCGGAAGG + Intronic
1135780663 16:25297422-25297444 CTCTCCTTGCTGAAGGGGGAAGG + Intergenic
1136117349 16:28102920-28102942 CTCTGGTAGCTTAGGGGCCCAGG - Intronic
1137268382 16:46886337-46886359 CTCTGGTTCCTGAGCTGGCAGGG + Intronic
1137451471 16:48578325-48578347 CTAGGGCTGGTGAGGGGGCAAGG - Intronic
1137744818 16:50812815-50812837 TTCTGGTTGCTGATGAGACAGGG - Intergenic
1138053883 16:53812188-53812210 CTCTGGTTGTAGAGGTGTCAGGG - Intronic
1139593959 16:67947623-67947645 CTCTGCCAGCTGAGGGGGCCCGG - Intronic
1140271869 16:73473227-73473249 CTCAGGATGCTGAGGTGGGAGGG + Intergenic
1140315472 16:73892136-73892158 CCCTGGTTGCAGAGGGGGCCAGG + Intergenic
1141792081 16:86243746-86243768 CCCAGGTTCCTGAGGAGGCACGG + Intergenic
1142114900 16:88351513-88351535 CTCTTGCTCCTGAGGGGTCAGGG - Intergenic
1142153666 16:88523623-88523645 CCCTGGCTGCTGAGGATGCAGGG - Intronic
1142212623 16:88815757-88815779 CTCTGGTGGCCAAGGGGGCAGGG - Intronic
1142455368 16:90218158-90218180 CTCTGGGTGCTGAGGGCGAGAGG + Intergenic
1143459569 17:7092984-7093006 CTCTGGAGGCTGAGGTGGAAAGG + Intergenic
1143703179 17:8676624-8676646 GCCTTGTTGGTGAGGGGGCAGGG - Intergenic
1143803879 17:9409080-9409102 CTCTGGTGGGGGCGGGGGCAGGG - Intronic
1144176617 17:12713690-12713712 ATCTGGTTGCTTAGGGGGAAAGG + Intronic
1145857424 17:28174830-28174852 ATGTGGTTGGTGAGTGGGCAGGG - Intronic
1147223880 17:38959751-38959773 CTCAGGATGCTGAGGTGGGAGGG - Intronic
1147230714 17:39015790-39015812 ATCTGGGTGCCGAGAGGGCAGGG - Intergenic
1147727962 17:42578398-42578420 CTCTGGAGGCTGAGGTGGGAGGG + Intergenic
1147945657 17:44078749-44078771 CTCAGGCTGCCAAGGGGGCACGG - Intronic
1147988209 17:44318527-44318549 CACCAGTTCCTGAGGGGGCAGGG - Exonic
1148777376 17:50103214-50103236 CTGTGGCTGCTGATGGGGCTGGG - Intronic
1150072527 17:62163960-62163982 CTGTGGTAGGTGAAGGGGCAAGG - Intergenic
1150160527 17:62894105-62894127 CTCAGGTTGGGGAGGGGCCAGGG + Intergenic
1152332262 17:79680095-79680117 GTCTGGCTGCTCAGGGGGCCCGG - Intergenic
1152645555 17:81467017-81467039 CTCAGGCTGCTGTGAGGGCAGGG + Intergenic
1154078544 18:11230503-11230525 GACTGGGGGCTGAGGGGGCAGGG - Intergenic
1154529597 18:15330695-15330717 CTCAGGTTGAGGAGGGGCCAGGG - Intergenic
1155548473 18:26939932-26939954 CTCTGCTTGGGGAGGGGGTATGG - Intronic
1156844226 18:41645344-41645366 CTTTAGTGGCTGAGGGGCCATGG + Intergenic
1158992803 18:62887567-62887589 CTCACGTGGCTGAAGGGGCAAGG + Intronic
1159623187 18:70662753-70662775 CTCTGGCTTCTGATAGGGCATGG + Intergenic
1160015228 18:75135142-75135164 CTGTGGCTGCTGTGGGGGCCAGG - Intergenic
1160113517 18:76056104-76056126 CTCATATTGCTGAGGGGGCCAGG + Intergenic
1160362477 18:78295553-78295575 CCCTGGTGGCTGAGGAGGCATGG + Intergenic
1160606390 18:80053092-80053114 CTCGGGTGGCTGAGGTGGGAAGG + Intronic
1160749173 19:725960-725982 CCTTGGCCGCTGAGGGGGCAGGG + Intronic
1160976264 19:1794196-1794218 CTTTTGTTGTTGATGGGGCACGG + Intronic
1161424371 19:4194678-4194700 CTCTGGCTGCTGGGGGAGAAGGG + Intronic
1161793781 19:6375284-6375306 CTGTGGTGGCTGAGGGTGCCCGG - Exonic
1162025961 19:7894329-7894351 CTCTGGAGGCTGAGGTGGGAGGG - Intronic
1162164350 19:8742501-8742523 GTCTGGTGCCTGAGGGTGCATGG + Intergenic
1162165422 19:8749969-8749991 GTCTGGTGCCTGAGGGTGCATGG + Intergenic
1162166487 19:8757425-8757447 GTCTGGTGCCTGAGGGTGCATGG + Intergenic
1162167553 19:8764881-8764903 GTCTGGTGCCTGAGGGTGCATGG + Intergenic
1162168492 19:8771179-8771201 GTCTGGTGCCTGAGGGTGCATGG + Intergenic
1162169562 19:8778629-8778651 GTCTGGTGCCTGAGGGTGCATGG + Intergenic
1162267672 19:9589229-9589251 CTCTGGTTGCTGAAATGCCAGGG + Intergenic
1162754984 19:12852424-12852446 CCCTGGTTCCTGGGAGGGCAGGG + Intronic
1163114610 19:15181369-15181391 CTCTGGTGCCTGAGAGGGCATGG - Intronic
1163114623 19:15181435-15181457 CTCTGATGACTGATGGGGCAGGG - Intronic
1163341951 19:16714236-16714258 CTCTGGAGGCTGAGGTGGGAAGG + Intergenic
1164513722 19:28917195-28917217 CACTGGTTGATGAGGAGTCAAGG + Intergenic
1164658341 19:29940884-29940906 CAATGGTTGCTGAGGTGGCTGGG + Intronic
1164881648 19:31738001-31738023 CTCTGGCTGCTGTGTGGACAAGG + Intergenic
1164950934 19:32336390-32336412 CTCTGGAGGCTGAGGTGGGAGGG + Intergenic
1165074801 19:33274878-33274900 CTCTGACTGCTGTGGAGGCAGGG + Intergenic
1165760973 19:38320977-38320999 TTCTGGGTCCAGAGGGGGCAAGG - Intronic
1166072090 19:40393729-40393751 CTCTGTGTGCATAGGGGGCAGGG - Intergenic
1166873621 19:45884707-45884729 CTCTGGGTACTGCTGGGGCAGGG + Exonic
1166889515 19:45981896-45981918 CTCTGGTTGCTGGTGGGAAAGGG - Intergenic
1166936369 19:46335626-46335648 CTCTGGAGGCTGAGGTGGGAGGG + Intronic
1167038301 19:47007315-47007337 CTCTGGGTGCTGACTGGCCAAGG + Intergenic
1167050616 19:47075676-47075698 CTGGGGGTGCTGAGGAGGCAGGG - Intronic
1167331468 19:48859042-48859064 CTGTGTCTCCTGAGGGGGCAGGG + Exonic
1167409236 19:49335280-49335302 CTCTGGTACCTGAGGGGCCTTGG - Intronic
1168250332 19:55137913-55137935 GTCTGAGTTCTGAGGGGGCAGGG - Intronic
925652329 2:6104332-6104354 CTGTGGCTGCTGTGGGGGGATGG + Intergenic
926291350 2:11533469-11533491 CTCCGGTGGGTGAGGGGGCAGGG + Intergenic
926946005 2:18188208-18188230 CTCTAGGTGCAGAGGGGGCAGGG + Intronic
927029440 2:19105078-19105100 CTCTGGGTCCTGAGGAGACAGGG - Intergenic
928074848 2:28254839-28254861 CTCTGGAGGCTGAGGTGGGAGGG - Intronic
929572200 2:43029712-43029734 CTCTGATGGCTGGCGGGGCATGG + Intergenic
930234235 2:48873663-48873685 CTCTGGGAGCAGAGGGAGCAGGG + Intergenic
930612634 2:53560485-53560507 CTCTGGAGGCTGAGGTGGGAAGG - Intronic
931725312 2:65104303-65104325 CTCAGGGTGCTGAGGGTGGAAGG - Intronic
932114781 2:69036611-69036633 TTCTGGTTACTGAGGGGGTAGGG - Intronic
933987553 2:87604410-87604432 ATCTGCCTGCTGAGTGGGCAGGG + Intergenic
934133652 2:88972955-88972977 CTCTGGGTGCTGAGGAGGACAGG + Intergenic
935094853 2:99934660-99934682 CAGTGGCTTCTGAGGGGGCAGGG - Intronic
935356703 2:102208053-102208075 CTCTGGTTGCTGGAGGAGAAAGG - Intronic
935390486 2:102547039-102547061 CTCTGGTTTCTGAGGCTACACGG + Intergenic
936306286 2:111346398-111346420 GTCTGCCTGCTGAGTGGGCAGGG - Intergenic
937273966 2:120672466-120672488 CTCAGGAGGCTGAGGTGGCATGG - Intergenic
937698867 2:124840604-124840626 TTCTGGATTGTGAGGGGGCAGGG - Intronic
938528693 2:132162137-132162159 CTCAGGTTGAGGAGGGGACAGGG - Intronic
942227799 2:173832069-173832091 CTCTGGGTGCTGGAGGGGGAGGG - Intergenic
942303727 2:174586496-174586518 CCCAGGTGGGTGAGGGGGCAGGG + Intronic
944210230 2:197199110-197199132 CTCTGGTTTCTGTGGTGGGATGG - Intronic
944321313 2:198346762-198346784 GTCTGGTTGGAGTGGGGGCAGGG + Intronic
944977250 2:205068160-205068182 CTCTGTTTGGGGATGGGGCAGGG + Intronic
945132123 2:206584582-206584604 CTGTGGTTGCTGTGGGGGATGGG - Intronic
946261225 2:218492895-218492917 CTCTAGATGCTGAGGTGGGAAGG + Intronic
946643821 2:221812681-221812703 CTCTGTTAGCTGAGAGGGCCTGG - Intergenic
947620135 2:231584782-231584804 CTCTGGAGGCTGAGGTGGGAGGG - Intergenic
947665902 2:231905152-231905174 GCCTGTCTGCTGAGGGGGCAGGG - Intergenic
948216141 2:236234288-236234310 TTCTGGATCCTGAGGAGGCAGGG + Intronic
948916942 2:241039245-241039267 CTTTGGTGGCTGATGGGACATGG - Intronic
949034484 2:241810290-241810312 CTCTGGCGGCCGAGGGGCCACGG + Intronic
949086850 2:242162884-242162906 CTCTGGGTGCTGAGGGCGAGAGG + Intergenic
1169265657 20:4165851-4165873 CTCTGGTTGCTGAGGGGGCATGG + Intronic
1169374956 20:5058894-5058916 CTCTGGAAGCTGAGGCGGAAAGG + Intergenic
1170654887 20:18277156-18277178 CTCTTGTTACTGAGGGGTCTGGG - Intergenic
1170885080 20:20333748-20333770 CTCTGGTTGCAAGGGTGGCAGGG + Intronic
1171879337 20:30605415-30605437 CTCTGGAGGCTGAGGTGGGAGGG + Intergenic
1172245595 20:33443384-33443406 CTCTGGCAGCTGCGGGGGCCCGG + Exonic
1172298835 20:33833505-33833527 CTCTGGCTGCTGTGGGGAGAAGG - Intronic
1172384367 20:34523288-34523310 CTCTGGCTGCTGTGGGGAGAAGG - Intronic
1172634523 20:36401070-36401092 CTCTGGTTGCTGGGCGGGTGGGG - Intronic
1174417823 20:50379208-50379230 CCCTGGGTCCTGAGGGGGCGAGG + Intergenic
1175196190 20:57244826-57244848 CTCTGGCTGCTCTGGGGGGAAGG - Intronic
1175983680 20:62753849-62753871 CTCTGGTTGAGGAGGAGGCTAGG + Intronic
1176052285 20:63126222-63126244 CTCTGCTGGCTGAGGGTGCTTGG - Intergenic
1176246306 20:64098896-64098918 CTCTGGATGCTCAGGGCCCAGGG - Exonic
1178352225 21:31880410-31880432 CTGTGGCTGCAGAGGGAGCATGG - Intronic
1178392901 21:32214044-32214066 CTCTGGTTTCCTAGGGGACAGGG - Intergenic
1178855940 21:36250477-36250499 CTGGGGTTCCTGAGGCGGCATGG + Intronic
1180183345 21:46127641-46127663 CCCTCGTTCCTGATGGGGCAGGG + Intronic
1180432369 22:15264077-15264099 CTCAGGTTGAAGAGGGGCCAGGG + Intergenic
1180514933 22:16132015-16132037 CTCAGGTTGAAGAGGGGCCAGGG + Intergenic
1181275505 22:21685279-21685301 CTGTGGTGGCTGGGAGGGCAGGG + Intronic
1182360035 22:29740886-29740908 CTCTGGCTGCTGAATGGGCAGGG - Intronic
1182471418 22:30550761-30550783 CTCTGGAGGCTGAGGTGGGAGGG - Intergenic
1182623452 22:31630268-31630290 CTCTGGGTGCTGAGGGGAACCGG + Intronic
1183107674 22:35626774-35626796 CTCTGGCAGGTGAGGGGGCCAGG - Intronic
1183774223 22:39952565-39952587 ATGTGTGTGCTGAGGGGGCAAGG - Intronic
1183942226 22:41302232-41302254 CTCCGGGTGCTGCGGGGCCAAGG - Intronic
1184159268 22:42688330-42688352 CTCCGGTAGCTGTGGGGGCTCGG - Intergenic
1184187321 22:42873472-42873494 CTCTGGGTGCTGAGGGGAGGAGG + Intronic
1185392726 22:50571339-50571361 CTCCCGCTGCTGAGAGGGCAGGG - Intronic
949293940 3:2498586-2498608 CTCTGGAGGCTGAGGTGGGAGGG - Intronic
950148323 3:10667370-10667392 CTCTGGAGGCTGAGGGGGCTGGG + Intronic
950199235 3:11031079-11031101 CTCTGGAGGCTGATGGGGCTGGG - Intronic
950916978 3:16656023-16656045 TTCTGGATCCTGAGTGGGCAGGG + Intronic
952887923 3:38022812-38022834 TTCTGGGTGCTAAGGGAGCAAGG - Intronic
953556621 3:43951246-43951268 CTCAGGTGGCTGAGGGGATATGG - Intergenic
954372365 3:50175511-50175533 CTCTGGGTGCTGAGTGAGGAAGG - Intronic
954451008 3:50571744-50571766 CTGTAGTTGCTGAGAGGTCAAGG - Exonic
954758494 3:52856574-52856596 CTCTGGAAGCTGAGGTGGGAGGG + Intronic
954810197 3:53242751-53242773 CCCTGGGTGCTGAGAGGGCAGGG - Intronic
955509799 3:59668182-59668204 TTCTGGATGCTGAGGTGGGAGGG - Intergenic
956191447 3:66612045-66612067 CTCAGGTGGAAGAGGGGGCAGGG + Intergenic
957022528 3:75141169-75141191 GTCAGGTTCCTGAGGGAGCAGGG - Intergenic
959311813 3:104748126-104748148 CTCATGTTGCTAAAGGGGCAAGG - Intergenic
960048964 3:113222801-113222823 CTCAGGTTGCTAAGGGAGGAGGG - Intronic
961324224 3:126100747-126100769 TTCTGGCTGCTGAGAGTGCAAGG - Intronic
961365741 3:126398225-126398247 GGCTGGGTGCTGAGGGTGCAGGG - Intronic
961486811 3:127222492-127222514 CTCTGGTTGCAGTGGGGTGAGGG + Intergenic
961609607 3:128126170-128126192 CTCTGGTGGAAGTGGGGGCATGG - Intronic
961728891 3:128952671-128952693 CTCGGGAGGCTGAGGTGGCAGGG + Intronic
962028377 3:131572715-131572737 CCCTGGTTGCTCAGGAGCCAAGG + Intronic
962310459 3:134323328-134323350 CTCTGCCTGCTGAGGCGGCAGGG + Intergenic
962876192 3:139537927-139537949 ATCTGGTTGCTGGGAGGTCAAGG - Intronic
962986928 3:140544701-140544723 CTCAGGGTGGGGAGGGGGCAGGG + Intronic
963401277 3:144802536-144802558 ATCTGCTTGCAGAGTGGGCAAGG - Intergenic
966383128 3:179363597-179363619 CTCTGGTGGCTGAGGTGGAAGGG - Intronic
966988893 3:185208309-185208331 CTCAGGTTGATTAGGGGTCAGGG - Intronic
967282255 3:187833792-187833814 CTCTGGTTGAGGGAGGGGCAAGG + Intergenic
968790127 4:2654318-2654340 CTCTGGAGGCTGAGGTGGGAGGG - Intronic
969397873 4:6934372-6934394 CAGAGGTTGCTGAGAGGGCAGGG + Intronic
971356842 4:25902825-25902847 CTCTGGAAGCTGAGGTGGGAGGG - Intronic
973997652 4:56475451-56475473 CTCTGGTGGCTGAGGCAGCAGGG + Intronic
974492539 4:62585658-62585680 CTCATGTTGCAGAAGGGGCAAGG - Intergenic
974763115 4:66305082-66305104 CTGTGGGTGCTGTGGGGGTAGGG + Intergenic
975139629 4:70905957-70905979 CTCTGGGGGCTGAGGTGGAAGGG + Intronic
975213837 4:71731251-71731273 ACCTGGGTGCTGAGAGGGCAGGG + Intergenic
977526763 4:98155652-98155674 CTCAGGATGCTGAGGTGGGAGGG + Intergenic
980148287 4:129015757-129015779 CTCTGGTGGCTCCGGGGGAATGG - Intronic
984245338 4:177268605-177268627 ACCTGGGTGCTGAGAGGGCAGGG + Intergenic
984814055 4:183820997-183821019 CTCAGGAGGCTGAGGTGGCAGGG + Intergenic
985836231 5:2274080-2274102 CTCTGGAGGCTGAGGAGGGAGGG - Intergenic
986042389 5:4005988-4006010 TTCTCCTTGCTGAGGGAGCAAGG + Intergenic
987016184 5:13822356-13822378 CTCTGGATGCTGAGGTGGGAGGG - Intronic
987867648 5:23566576-23566598 CTCTGTTAGCTGAGAGGGCCTGG - Intergenic
991051190 5:62274101-62274123 CACTTGTTTCTGAGAGGGCAGGG - Intergenic
991519508 5:67480065-67480087 CTTTGGTTGCTCAGGGTGGATGG + Intergenic
992152338 5:73917575-73917597 CTCTGTGTGCTGAGGCGGGATGG - Intronic
992238006 5:74732060-74732082 CTCAGGATGCTGAGGTGGGAAGG - Intronic
992346699 5:75886378-75886400 CTCTGGTGGCTCAGAGGGGAAGG - Intergenic
992778217 5:80106191-80106213 CTCTGGGTGGTGAGGGGGTAGGG - Intergenic
995420475 5:111961277-111961299 CACTGGTGGCTGAGTGGGTAAGG - Intronic
996943945 5:129043866-129043888 ATCTGGGAGCTGAGAGGGCAGGG + Intergenic
997178086 5:131798682-131798704 CTCGGGTGGCTGAGGTGGGAGGG + Intergenic
999484861 5:151985334-151985356 CTGTGGTTGCTGTGGGGGGTGGG + Intergenic
999728131 5:154453933-154453955 CTCTGGAGGCTGAGGTGGGAAGG - Intronic
1000353110 5:160368080-160368102 CCCTGTTAGCTGAGGGGCCATGG - Intronic
1001436948 5:171706782-171706804 CTCTGGTTGCTGGGAGGGCAAGG + Intergenic
1002431628 5:179207486-179207508 GTGGGGTGGCTGAGGGGGCAGGG - Intronic
1003989964 6:11476493-11476515 CTCTGGCTGCTGCGTGGGAATGG + Intergenic
1004905074 6:20229971-20229993 CTCTGGTTGGTGAGAGGATAGGG - Intergenic
1005040654 6:21596632-21596654 CTCCGGCTGCAGAGGGGGCAAGG - Exonic
1005168594 6:22955320-22955342 TTCTTGTTGCTGAGGGAGAAGGG + Intergenic
1005956416 6:30666515-30666537 CTCTGGTGGCTGGGTGGGCGTGG + Intronic
1006257599 6:32843993-32844015 CTCTGGGTGCTGGGCGGTCATGG - Exonic
1006781944 6:36637859-36637881 CTGCGGGTGCTGAGGGGGTAAGG - Intergenic
1007304273 6:40892088-40892110 CTCTGGGTGCTGAGGGGGAGTGG - Intergenic
1007403048 6:41615557-41615579 CTCTGGTGGGTGAGAGGGGAGGG - Intergenic
1007549245 6:42716315-42716337 CTCTGGAGGCTGAGGTGGGATGG + Intronic
1008580690 6:52904092-52904114 CTCAGGTGGCTGAGGTGGGAGGG - Intronic
1009382833 6:63053622-63053644 CTCAGGCTGCTCAGGGGTCAGGG - Intergenic
1009939248 6:70270313-70270335 CTCTGGGTCCTGGGGGGCCAGGG + Exonic
1011168627 6:84479468-84479490 CTGTGGATGCTGTGGGGGCTGGG - Intergenic
1013370459 6:109466145-109466167 CTCTGGCTGCTGCGTGAGCAGGG + Exonic
1013913763 6:115310196-115310218 CTCTGGCTGCTGTGGGGGATGGG + Intergenic
1015152962 6:130059179-130059201 ATCTGGTGCCTGGGGGGGCAGGG - Intronic
1016357209 6:143231509-143231531 CTCTCTTGGCTGAGGGAGCATGG + Intronic
1016804147 6:148195999-148196021 CTCTGGTTAATGAGTGGGCTGGG + Intergenic
1017802252 6:157907815-157907837 CTCTGTTTCATGAGTGGGCAAGG - Intronic
1018143043 6:160858819-160858841 CTCTGGTTGGTGGGGTGGCAGGG - Intergenic
1018143707 6:160863984-160864006 CACTGGTTGCTGAGGATGCAGGG + Intergenic
1018370157 6:163160863-163160885 ATATGGTAGCTGAGGGGGAAAGG - Intronic
1018423862 6:163662979-163663001 CTCTGGTTGCAGGGGTGACATGG + Intergenic
1018815162 6:167325067-167325089 CACTGGTTGCTGATGATGCAGGG - Exonic
1018855011 6:167668993-167669015 CTTTGGTTGCTCAGGGGTCCTGG - Intergenic
1019002735 6:168769097-168769119 CACTGGATCCTGAGGTGGCAGGG + Intergenic
1019062020 6:169263474-169263496 CTGTGGTTGCTGTGTGGGGAGGG - Intergenic
1019382024 7:728750-728772 CACTGGTTGCTGTGGGGTGAGGG + Intronic
1020373697 7:7461703-7461725 CTGTGGCTGCTGTGGGGGTAAGG - Intronic
1021875985 7:25049760-25049782 CACTGGTTGCTGATGGGATATGG - Intergenic
1024987881 7:55211801-55211823 CTCTGGTTCCTGAGGTGCGATGG - Intronic
1026806577 7:73433047-73433069 CTCTGGTGGCTGAGGCGGGAAGG + Intergenic
1028235243 7:88353333-88353355 CTATGCTTGCTGTGGTGGCATGG + Intergenic
1028271335 7:88794202-88794224 CTCTGGATTCTGAGGTGGTATGG - Exonic
1030117053 7:106070066-106070088 TGCTGGGTGCTGAGGGAGCAGGG + Intergenic
1033622905 7:143078021-143078043 CTCTGGCTGCTGTGGGGGATGGG - Intergenic
1033907772 7:146226549-146226571 CTCTGGAGGCTGAGGTGGAAAGG + Intronic
1034537934 7:151737638-151737660 CTGTGGTTCCTGAGGAGGCCTGG - Intronic
1035497859 8:68385-68407 CTCTGGGTGCTGAGGGCGAGAGG - Intergenic
1036162776 8:6405734-6405756 ATCTGGTTGCTTCCGGGGCAGGG + Intergenic
1037797934 8:22011706-22011728 CTCTGGAGGCTGAGGGGGGAGGG + Intergenic
1038455425 8:27669476-27669498 CTCTGGCTGCTGAGCTGCCAGGG + Intronic
1039442223 8:37603000-37603022 CTGTGGGTGCTGTGGGAGCAAGG - Intergenic
1040106117 8:43543013-43543035 CTCTGATTCCTCAGGGAGCAGGG - Intergenic
1040393944 8:46976612-46976634 CTCTGGAGGCTGAGGTGGGAAGG - Intergenic
1040649145 8:49430206-49430228 CTCTGGTATTTGAGGGAGCAGGG - Intergenic
1040953591 8:52958532-52958554 CTCTGGTATCTGAGAGAGCAGGG - Intergenic
1041715900 8:60931800-60931822 CTCAGGAGGCTGAGGTGGCAGGG - Intergenic
1042691083 8:71499560-71499582 CTCTGGTCTCTTAGTGGGCAGGG - Intronic
1042916374 8:73879083-73879105 CTCTCGTTACTGAGGAGACACGG + Intergenic
1043458525 8:80436442-80436464 CTCTGGAAGCTGAGGTGGGAGGG + Intergenic
1043527870 8:81115693-81115715 CTTTGGTTGCTGAGGAGCAAAGG + Intergenic
1043953746 8:86338763-86338785 CTCTGGAGGCTGAGGTGGGAGGG - Intergenic
1044108056 8:88236639-88236661 CTCTGGAAGCTGAGGTGGGAGGG + Intronic
1044333032 8:90943857-90943879 CTCTGGTGGCTGAGGTGGGAGGG - Intronic
1045640667 8:104246986-104247008 GTCTGAGTGCTGAGGGGGCAAGG + Intronic
1046867465 8:119166729-119166751 CTCTGTATGCTGAAGGGTCATGG - Intronic
1049211970 8:141391143-141391165 CTCTGGCTGCTGAGGGTGGATGG + Intergenic
1049755564 8:144309952-144309974 CCCCGGGTGCTGTGGGGGCAGGG + Intronic
1049796349 8:144498886-144498908 CTCTGGTCGCTCACGTGGCACGG + Intronic
1049864868 8:144928234-144928256 CTCAGGAGGCTGAGGTGGCAGGG + Intergenic
1051935454 9:22438424-22438446 CTCTGGTAGTTGAGAGAGCAAGG - Intergenic
1052860726 9:33436364-33436386 CTCTTCTGGCTGAGGGGGAACGG - Intergenic
1052982426 9:34458691-34458713 CTGTGATTCCTGAGGGGGCGGGG + Intronic
1053007309 9:34612647-34612669 GTCTGGGGGCTGAGGGGGCGGGG + Intergenic
1053707311 9:40768477-40768499 CTCAGGTTGAGGAGGGGCCAGGG - Intergenic
1054417227 9:64889245-64889267 CTCAGGTTGAGGAGGGGCCAGGG - Intergenic
1054455906 9:65430309-65430331 CTCTGGCTGCTGCTGGGGAATGG - Intergenic
1055577174 9:77671743-77671765 CCCTGGTTCCTGAGGGTGGAGGG - Intergenic
1055613152 9:78043847-78043869 CTCTGGAGGCTGAGGTGGGAGGG - Intergenic
1056182367 9:84097712-84097734 CTCTGGAGGCTGAGGTGGGAGGG + Intergenic
1056308559 9:85316882-85316904 CTCTGGAGGCTGAGGTGGGAGGG - Intergenic
1057265067 9:93611616-93611638 CTCTGGAGGCTGAGGTGGGAGGG - Intronic
1057344734 9:94239344-94239366 CTTTGGGTGCTCAGGGGGAAAGG - Intergenic
1058594613 9:106602046-106602068 CTCTTGTTGCTTAGGTGCCAAGG + Intergenic
1059354037 9:113686129-113686151 CTCTGGGCGCTGAGGGTGGAGGG + Intergenic
1059807646 9:117820984-117821006 CACTGGAAGCTGAGGGAGCAAGG + Intergenic
1060311185 9:122464112-122464134 CTGTGGCTGCTGTGGGGGCTGGG + Intergenic
1061327950 9:129875437-129875459 GTCTGGTTGGTGATGGGGCCTGG - Exonic
1061498282 9:130988039-130988061 CTCTGGTTGCTGGGGCAGGATGG + Intergenic
1062596639 9:137302605-137302627 GTCTGGCTGCTGAGGGAGCTTGG - Intergenic
1186944125 X:14546143-14546165 CACTGGTTACAGAGTGGGCACGG - Intronic
1187201457 X:17137712-17137734 CTCAGGAGGCTGAGGGGGAAAGG - Intronic
1188524051 X:31070987-31071009 CCCTGGTGGCTGTGGGTGCATGG - Intergenic
1189478679 X:41376480-41376502 CTCTGGGTGCTGCGGGGGTTTGG + Intergenic
1189833724 X:45000421-45000443 CTCTGGTTGATGAAGTGCCAGGG + Intronic
1189842286 X:45093273-45093295 CTCTGGAGGCTGAGGCGGCAGGG + Intronic
1190103964 X:47545142-47545164 CTCAGGATGCTGAGGTGGGAGGG + Intergenic
1190288526 X:48976319-48976341 CTCTGCTGGCCGAGGGGGCTGGG + Exonic
1192555007 X:72082249-72082271 ATCTGGTTGCGCAGGGTGCAGGG + Intergenic
1194854598 X:98914205-98914227 CTCTGGTTTCAGAGGGGGGTAGG + Intergenic
1198078987 X:133220846-133220868 CTCTGATAACTGAAGGGGCAGGG - Intergenic
1198180087 X:134199036-134199058 CTCTGGAGGCTGAGGTGGGAGGG - Intergenic
1198365050 X:135931807-135931829 CTCTGGGGGCTGAGGTGGGAAGG + Intergenic
1200089142 X:153626263-153626285 CTCTGGTTTCTCAGGGGCCAAGG - Intergenic
1200123978 X:153804643-153804665 CTCTGCTGGCCGAGGGGGCGGGG - Exonic
1200124134 X:153805328-153805350 CTCTGAAGGCTGAGGGGGCTGGG - Intronic
1200384883 X:155880640-155880662 CTGTGTTTGATGAGGGGGCTTGG + Intergenic
1201317029 Y:12657591-12657613 CTCAGGTTGCTGAAGGTGGAAGG - Intergenic
1201616564 Y:15907078-15907100 CTCTGGTGGCTCATTGGGCATGG + Intergenic