ID: 1169272205

View in Genome Browser
Species Human (GRCh38)
Location 20:4209233-4209255
Sequence ATAATTAGACTTGGGTAATG AGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total
Summary

Found 5 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1169272198_1169272205 9 Left 1169272198 20:4209201-4209223 CCACTGTGCCCCACCTTTTCTGT No data
Right 1169272205 20:4209233-4209255 ATAATTAGACTTGGGTAATGAGG No data
1169272200_1169272205 0 Left 1169272200 20:4209210-4209232 CCCACCTTTTCTGTGTTTTTCTC No data
Right 1169272205 20:4209233-4209255 ATAATTAGACTTGGGTAATGAGG No data
1169272202_1169272205 -4 Left 1169272202 20:4209214-4209236 CCTTTTCTGTGTTTTTCTCATAA No data
Right 1169272205 20:4209233-4209255 ATAATTAGACTTGGGTAATGAGG No data
1169272201_1169272205 -1 Left 1169272201 20:4209211-4209233 CCACCTTTTCTGTGTTTTTCTCA No data
Right 1169272205 20:4209233-4209255 ATAATTAGACTTGGGTAATGAGG No data
1169272199_1169272205 1 Left 1169272199 20:4209209-4209231 CCCCACCTTTTCTGTGTTTTTCT No data
Right 1169272205 20:4209233-4209255 ATAATTAGACTTGGGTAATGAGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1169272205 Original CRISPR ATAATTAGACTTGGGTAATG AGG Intergenic