ID: 1169274017

View in Genome Browser
Species Human (GRCh38)
Location 20:4221180-4221202
Sequence AGACAGCCCCAAGCATGGCC AGG (reversed)
Strand -
Crispr in exon? Yes
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total 255
Summary {0: 1, 1: 0, 2: 1, 3: 26, 4: 227}

Found 10 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1169274017_1169274030 30 Left 1169274017 20:4221180-4221202 CCTGGCCATGCTTGGGGCTGTCT 0: 1
1: 0
2: 1
3: 26
4: 227
Right 1169274030 20:4221233-4221255 AGTGTTTCTCAAATAGGGATTGG 0: 1
1: 0
2: 1
3: 22
4: 221
1169274017_1169274022 -8 Left 1169274017 20:4221180-4221202 CCTGGCCATGCTTGGGGCTGTCT 0: 1
1: 0
2: 1
3: 26
4: 227
Right 1169274022 20:4221195-4221217 GGCTGTCTACTCAGGGTTCAGGG 0: 1
1: 0
2: 0
3: 12
4: 156
1169274017_1169274027 6 Left 1169274017 20:4221180-4221202 CCTGGCCATGCTTGGGGCTGTCT 0: 1
1: 0
2: 1
3: 26
4: 227
Right 1169274027 20:4221209-4221231 GGTTCAGGGCATGGAGGATGGGG 0: 1
1: 0
2: 3
3: 34
4: 374
1169274017_1169274021 -9 Left 1169274017 20:4221180-4221202 CCTGGCCATGCTTGGGGCTGTCT 0: 1
1: 0
2: 1
3: 26
4: 227
Right 1169274021 20:4221194-4221216 GGGCTGTCTACTCAGGGTTCAGG 0: 1
1: 0
2: 0
3: 10
4: 102
1169274017_1169274029 25 Left 1169274017 20:4221180-4221202 CCTGGCCATGCTTGGGGCTGTCT 0: 1
1: 0
2: 1
3: 26
4: 227
Right 1169274029 20:4221228-4221250 GGGGCAGTGTTTCTCAAATAGGG 0: 1
1: 0
2: 3
3: 44
4: 337
1169274017_1169274025 4 Left 1169274017 20:4221180-4221202 CCTGGCCATGCTTGGGGCTGTCT 0: 1
1: 0
2: 1
3: 26
4: 227
Right 1169274025 20:4221207-4221229 AGGGTTCAGGGCATGGAGGATGG 0: 1
1: 1
2: 11
3: 66
4: 506
1169274017_1169274028 24 Left 1169274017 20:4221180-4221202 CCTGGCCATGCTTGGGGCTGTCT 0: 1
1: 0
2: 1
3: 26
4: 227
Right 1169274028 20:4221227-4221249 TGGGGCAGTGTTTCTCAAATAGG 0: 1
1: 0
2: 9
3: 60
4: 468
1169274017_1169274023 -3 Left 1169274017 20:4221180-4221202 CCTGGCCATGCTTGGGGCTGTCT 0: 1
1: 0
2: 1
3: 26
4: 227
Right 1169274023 20:4221200-4221222 TCTACTCAGGGTTCAGGGCATGG 0: 1
1: 0
2: 1
3: 19
4: 171
1169274017_1169274024 0 Left 1169274017 20:4221180-4221202 CCTGGCCATGCTTGGGGCTGTCT 0: 1
1: 0
2: 1
3: 26
4: 227
Right 1169274024 20:4221203-4221225 ACTCAGGGTTCAGGGCATGGAGG 0: 1
1: 0
2: 0
3: 22
4: 267
1169274017_1169274026 5 Left 1169274017 20:4221180-4221202 CCTGGCCATGCTTGGGGCTGTCT 0: 1
1: 0
2: 1
3: 26
4: 227
Right 1169274026 20:4221208-4221230 GGGTTCAGGGCATGGAGGATGGG 0: 1
1: 0
2: 2
3: 26
4: 330

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1169274017 Original CRISPR AGACAGCCCCAAGCATGGCC AGG (reversed) Exonic
900508146 1:3040263-3040285 AGCCTGCCCCAAGCCTGCCCTGG + Intergenic
900787657 1:4658823-4658845 AGACAGCCCCACGCCTGCCGGGG + Intronic
901051971 1:6429809-6429831 ACACAGCACCTGGCATGGCCTGG - Intronic
901882902 1:12204391-12204413 AAACAGCCCCAAGCATGTGGTGG - Intronic
902482265 1:16718205-16718227 ACACAGCACCTGGCATGGCCTGG + Intergenic
903096633 1:20982167-20982189 AGACAGGCCTAAGAATGGTCTGG + Intronic
903189520 1:21648972-21648994 AGACAGCCCTGAGCAGGGGCAGG + Intronic
903301393 1:22380840-22380862 AGACAGCTCCAATCATGGCAGGG + Intergenic
904284565 1:29445626-29445648 TGAGAGCCCCAAGCCTTGCCAGG + Intergenic
904833210 1:33318819-33318841 AGACAGTCCCTAGCATCGCTTGG - Intronic
905350550 1:37343382-37343404 AGACAGGCCCCACCATGTCCCGG + Intergenic
905501778 1:38445314-38445336 AGACTGCCTCTAGCCTGGCCGGG - Intergenic
906515654 1:46437437-46437459 AGCCATCCCCTAGCATGGCCAGG + Intergenic
908386144 1:63643678-63643700 AGTCTGCCCAAAGAATGGCCGGG - Intronic
911434961 1:97845127-97845149 AGACAGCCTCAAGCATGGAAAGG + Intronic
920208651 1:204312478-204312500 AGCCAGACCCAAGCAAGGGCAGG - Intronic
920699284 1:208205420-208205442 AGACAGGGCAAGGCATGGCCTGG - Intronic
922763498 1:228146275-228146297 AGACAGCCCCAGGCCTTGGCCGG - Intronic
923095779 1:230774091-230774113 AGACAACATCAAGCATGGGCAGG + Intronic
923490438 1:234479034-234479056 ACAGCGCCCCAAGCAGGGCCCGG + Exonic
1062911847 10:1216685-1216707 AAACAGCCCCGAGCAAGGCCCGG - Intronic
1063134059 10:3201196-3201218 AAAGACCCCCAAGCATGGACTGG - Intergenic
1064640630 10:17412057-17412079 AGACAGGGGCAAGCATGGGCAGG - Intronic
1067029922 10:42873105-42873127 GCACAGCCCCATGCATGGACAGG - Intergenic
1067826538 10:49578184-49578206 AGACACCACCAAGCTGGGCCTGG + Intergenic
1068035059 10:51749347-51749369 AGGCTGCCACGAGCATGGCCAGG + Intronic
1068514016 10:58003928-58003950 AGAGAGACCCAAGCATGACTGGG + Intergenic
1073449097 10:103599011-103599033 ATCCAGCCCCAAGGATGGCTGGG - Exonic
1074826225 10:117217202-117217224 AGCCAGGTCCAAGAATGGCCGGG + Intergenic
1075094465 10:119461711-119461733 AGAAAGCCCCAAACCTGGCTGGG + Intergenic
1075336631 10:121613523-121613545 AAAGAGCACCAAGCAGGGCCAGG - Intergenic
1076306008 10:129466476-129466498 ACACAACCCCAAGCAGGGCCTGG + Intergenic
1077300744 11:1845915-1845937 ACCCAGCGCCCAGCATGGCCAGG - Intergenic
1078084368 11:8224907-8224929 GGCCAGCCCCAACCTTGGCCAGG + Intronic
1081489017 11:43553161-43553183 AGACAGCCCATAGCTTGGCAGGG + Intergenic
1083670812 11:64299197-64299219 AGCCAGCCCCAAGGATGGAAGGG - Intronic
1085907765 11:80785270-80785292 ACACAGCCACAAGCATCCCCTGG + Intergenic
1088883183 11:113987440-113987462 AAACAGCCCAAAGCAGGGCATGG + Intronic
1089416763 11:118298636-118298658 ACACAGCCCCAGGCAAGACCAGG - Intergenic
1091450317 12:568849-568871 TCACAGCCCCAAGCACCGCCTGG - Intronic
1100883738 12:99046502-99046524 AGAAAGACCCAAGTCTGGCCGGG + Intronic
1101011502 12:100455315-100455337 AAAAAGCACCTAGCATGGCCTGG - Intergenic
1101355911 12:103977506-103977528 AGACACACACAAGCATGGCATGG + Intronic
1102821058 12:115909590-115909612 AGACAGCCCCACGCCTAGCTGGG + Intergenic
1102862003 12:116344216-116344238 AAAAAATCCCAAGCATGGCCGGG - Intergenic
1104386814 12:128357876-128357898 ACACATCCCCAACCATGGACTGG + Intronic
1106680759 13:32004605-32004627 TGAAAGCCCCAACCATGGCAAGG - Intergenic
1108497742 13:51041991-51042013 AGACAGCCACAAAAATGGACTGG + Intergenic
1110278204 13:73662254-73662276 ATACAGCCCCCAGCTTGGCTGGG - Intergenic
1111423684 13:88051835-88051857 AGCCAGGGCCAAGCAAGGCCTGG - Intergenic
1111653374 13:91122063-91122085 AGACAAGGCCAAGCATGGGCGGG + Intergenic
1112183749 13:97109422-97109444 AGACAGCACCAAGCATGCCAGGG - Intergenic
1112617191 13:101017742-101017764 TGACAGCCCCCTGCATGCCCGGG - Intergenic
1112652501 13:101415590-101415612 AGACACCAGCAAGGATGGCCTGG - Intronic
1118641328 14:67795097-67795119 AGACAGCCCCTCGAATGACCAGG - Intronic
1119775556 14:77246138-77246160 AGACAGCCCCATGCCTGTCATGG + Intronic
1121676612 14:95758782-95758804 AGACAGCCCCATGCCTGGTAAGG - Intergenic
1121883532 14:97522226-97522248 AGACAGCCCCAAGCTGTACCAGG + Intergenic
1122577146 14:102749673-102749695 TGTCGTCCCCAAGCATGGCCTGG - Intergenic
1124121247 15:26891139-26891161 CGAGAGTCCAAAGCATGGCCTGG - Intronic
1124672860 15:31657257-31657279 AGACAGCCCCTGGCCAGGCCCGG - Intronic
1125769642 15:42156534-42156556 AGAGTGCCCAAAGCATGGCTGGG + Exonic
1127469405 15:59276895-59276917 AGACAGCCCCAGGGTAGGCCTGG + Intronic
1128115535 15:65102543-65102565 AGTCAGCCCCGAACATGGGCTGG - Exonic
1128704848 15:69831491-69831513 AGAGAGCGGCCAGCATGGCCTGG + Intergenic
1129300834 15:74624534-74624556 AGGCAGCCCCAACCCTGGCCAGG - Intronic
1131067935 15:89445959-89445981 AGACAGTCACAAGCATGAACAGG + Intergenic
1131245927 15:90792944-90792966 AGCTAGGCCCAAACATGGCCAGG + Intronic
1132460816 16:53727-53749 AGACAGCCTGCAGCAGGGCCGGG - Intronic
1132689100 16:1174567-1174589 AGACAGCCCTGAGCGTGGCAGGG - Intronic
1133212747 16:4272350-4272372 CACCAGCACCAAGCATGGCCGGG + Intronic
1135618673 16:23934111-23934133 AGACAGAACCAAGCAAGTCCAGG - Intronic
1136008698 16:27348356-27348378 AGAGAGTCCCAAGGATGGGCTGG + Intronic
1136148500 16:28330516-28330538 AGGCAGCCACCAGCATGTCCAGG - Intergenic
1136468988 16:30465821-30465843 AGAAAGCCTCATACATGGCCGGG - Intergenic
1137699743 16:50489007-50489029 GGACAGTCCCAAGCATTCCCTGG - Intergenic
1137905306 16:52315526-52315548 AGACAGCCCTGGGCTTGGCCTGG - Intergenic
1138202601 16:55101213-55101235 AGACATCGCTAAGCATGGCCTGG - Intergenic
1140662259 16:77198723-77198745 GGCCAGTCCCAAGCATAGCCTGG - Exonic
1141758441 16:86010794-86010816 AGTCACTCCCAGGCATGGCCAGG - Intergenic
1141818868 16:86431594-86431616 AGCCAGCCCCAAGGAAGGCCAGG + Intergenic
1142287542 16:89177541-89177563 AGACAGCTCCTAGCCAGGCCCGG + Intronic
1203075578 16_KI270728v1_random:1120513-1120535 GGACAGGCCAAAGCAAGGCCAGG - Intergenic
1142614100 17:1125095-1125117 AGACCAACCCAAGCAGGGCCTGG + Intronic
1142719570 17:1767088-1767110 ATAAAGGCCCAAGCCTGGCCTGG - Intronic
1143871504 17:9960062-9960084 AGAGATCCCCAAGCAGGACCTGG + Intronic
1144581165 17:16460389-16460411 AGACAGGACCAGGCAAGGCCAGG - Intronic
1145269361 17:21396520-21396542 AGACATCCCCGTGCCTGGCCGGG + Intronic
1146399370 17:32491505-32491527 GGTCAGGCCCAAGCATGGCCTGG + Intergenic
1146526638 17:33572493-33572515 AGGCTTCCCCAAGCATGGCAAGG + Intronic
1148862647 17:50612653-50612675 AGGGAGCCCAAGGCATGGCCAGG - Intronic
1150124953 17:62629446-62629468 ACACAGCCCCAGGGAGGGCCAGG - Intronic
1150478258 17:65490073-65490095 AGAGAGGCCCAAGCTTTGCCAGG + Intergenic
1151242063 17:72765898-72765920 AGACAGCTCTCAGCATGGCCAGG + Intronic
1151436510 17:74100841-74100863 GGACAGCCCCATCCATGTCCTGG - Intergenic
1151518510 17:74612694-74612716 AGACAGCACCCAGCATGCTCAGG + Exonic
1151679866 17:75617489-75617511 TGACAGCCCCAAAGATGCCCAGG - Intergenic
1151871199 17:76838111-76838133 GGACAGCCCCAGACAGGGCCCGG - Intergenic
1152118586 17:78404125-78404147 GGACAGCCACAAACATGGGCAGG + Intronic
1152377901 17:79928141-79928163 AGCCAGCCCCAGGCCAGGCCTGG - Intergenic
1152738899 17:82010660-82010682 AGCCACCCCCAATCAGGGCCTGG - Intronic
1154379637 18:13837566-13837588 GAACAGCCCCAAACATGGACAGG - Intergenic
1155187997 18:23404382-23404404 AAACAGCCCCAGGCAAGGCGCGG + Intronic
1160312597 18:77809822-77809844 AGACAGCCCCATCCTTTGCCCGG - Intergenic
1160867974 19:1264405-1264427 AGACAGCTCCACGCAGCGCCAGG - Intronic
1160880993 19:1320129-1320151 AGACAGCCCCACCCAAGGCTCGG + Intergenic
1161213420 19:3080324-3080346 AGACATCCCCACGCACAGCCAGG - Intergenic
1161263069 19:3348229-3348251 AGACAGCCCCAGGCCAGGCAGGG - Intergenic
1161572400 19:5037770-5037792 AGACATCCCCAGACATGGCCAGG + Intronic
1161584545 19:5098087-5098109 ACACAGCCCCCAGCTGGGCCAGG + Intronic
1162446271 19:10724745-10724767 AGAGAGCCCTCAGCTTGGCCAGG - Intronic
1162688163 19:12405367-12405389 AGAAAGCCCCATGCATGCACAGG + Intronic
1164527335 19:29021932-29021954 AGGCCGCCCCCAGCATGGCCTGG - Intergenic
1165977088 19:39685661-39685683 AGACAGCCCAAATCATGGGGAGG + Intergenic
1167403215 19:49286769-49286791 AGACACCCCCAACCATTGGCAGG - Intergenic
1167440796 19:49507692-49507714 AGAAAGCCCCTGGCAAGGCCGGG - Intronic
1168680799 19:58314329-58314351 AGAAAGCCTCAACCCTGGCCGGG + Intronic
925119044 2:1403301-1403323 GGACTGACCCAAGCATCGCCAGG - Intronic
926431988 2:12796778-12796800 AGACAGCGCCAAGAAGGTCCTGG + Intergenic
927877425 2:26668064-26668086 AGAGAGCCCCCAGGATGTCCTGG + Intergenic
927893897 2:26769252-26769274 AGTCACTCCCTAGCATGGCCAGG - Intronic
929579219 2:43071167-43071189 TCCCAGCCCCAAGCATAGCCTGG + Intergenic
929584701 2:43106371-43106393 AGGCAGCCCAAAGCCTAGCCTGG + Intergenic
929762964 2:44821221-44821243 AGACAGCCCCAAACCAGGTCAGG + Intergenic
934558659 2:95300880-95300902 AGCCTGGCCCAGGCATGGCCAGG - Intronic
934561896 2:95317832-95317854 AGCCAGGCCCAAGGATGGCAGGG + Intronic
934654928 2:96112439-96112461 AAACAGCCCCAAGCTAGCCCCGG - Intergenic
935807494 2:106763329-106763351 AGCCAGCCCCAAGCAGGACTCGG - Intergenic
937291914 2:120787102-120787124 AGACAGACCCCTGCCTGGCCTGG + Intronic
939955914 2:148527554-148527576 CAACAGCCCCTGGCATGGCCTGG - Intergenic
940737851 2:157473260-157473282 AGAGAGCACCAACCATTGCCAGG - Intronic
942141097 2:172978216-172978238 GGACAGCCCCCAGCATTTCCAGG - Intronic
943664110 2:190590337-190590359 AGACAGCCCAAAACATGGCATGG - Intergenic
947520176 2:230839507-230839529 AGACAGCATGAAGCATGACCTGG + Intergenic
947859646 2:233349389-233349411 AGACAGCCCCACACATGTGCAGG - Intergenic
948181992 2:235989507-235989529 AGGCAGCCCCAGGCAGGGCCTGG + Intronic
948816676 2:240513807-240513829 CCACAGCCTCAAGCATGACCAGG + Intronic
1169122988 20:3108401-3108423 AGAAAAGCCCCAGCATGGCCGGG - Exonic
1169274017 20:4221180-4221202 AGACAGCCCCAAGCATGGCCAGG - Exonic
1170029666 20:11931735-11931757 AGACAGTCCCAAGCATAGGCAGG - Intergenic
1170141244 20:13127027-13127049 TGACAGCCCCAAGCAAGCACAGG - Intronic
1171090686 20:22283445-22283467 AGCCAGCCCTAAGGATGGCTGGG + Intergenic
1171470916 20:25370574-25370596 AGACAGCCCTAAGCAGGGGCAGG + Intronic
1172304406 20:33871089-33871111 AGGCAGCCCCTGGCCTGGCCTGG - Intergenic
1172447686 20:35001717-35001739 AGGCAGCCCCAGCCTTGGCCAGG - Intronic
1173922019 20:46753409-46753431 AGAAGGACCCAAGCTTGGCCGGG + Intergenic
1174380206 20:50151398-50151420 AGACAGCCCAAATCATTCCCAGG - Intronic
1175530881 20:59673668-59673690 AGACAGCACCAAGCAAGCCCGGG - Intronic
1175564573 20:59962887-59962909 AGAGAGCCCCCAGGATGGGCAGG + Intronic
1176053206 20:63131420-63131442 AGACAGCCCTGCACATGGCCGGG - Intergenic
1176059023 20:63164068-63164090 AAACAGCACCAAGCAATGCCAGG - Intergenic
1176342836 21:5714243-5714265 AGACAGACCAGAGCAAGGCCTGG - Intergenic
1176475090 21:7146394-7146416 AGACAGACCAGAGCAAGGCCTGG - Intergenic
1176501991 21:7610213-7610235 AGACAGACCAGAGCAAGGCCTGG + Intergenic
1176537157 21:8112312-8112334 AGACAGACCAGAGCAAGGCCTGG - Intergenic
1179600852 21:42476396-42476418 GGACAGCCCCCAGAATGGCCGGG - Intronic
1180836957 22:18934724-18934746 GCACAGCCCTAAGCATGGCTGGG - Intronic
1180843453 22:18969839-18969861 AGCCAGCCCCCAGCGGGGCCGGG - Intergenic
1180950313 22:19717952-19717974 GGTCAGCCCCAAGCAGGGCTGGG + Intronic
1181466259 22:23112255-23112277 AGAGACCCCCAGGCAGGGCCTGG - Intronic
1182076983 22:27501497-27501519 TGACAGCCCCCAGCCTGGGCAGG - Intergenic
1203242106 22_KI270733v1_random:28716-28738 AGACAGACCAGAGCAAGGCCTGG - Intergenic
1203287050 22_KI270734v1_random:160023-160045 GCACAGCCCTAAGCATGGCTGGG - Intergenic
953500371 3:43427242-43427264 ATAGATTCCCAAGCATGGCCAGG - Intronic
953744835 3:45566450-45566472 AGACAGCCCCAAACATAAGCTGG + Intronic
953885024 3:46710210-46710232 AGACTTCCCCAAGCCTGGCAGGG + Exonic
954463944 3:50643786-50643808 AGAGACCCCCAAGCAGAGCCGGG - Intronic
957926019 3:86812327-86812349 AGACAGTTCCACACATGGCCGGG - Intergenic
959582132 3:107992961-107992983 GGACAGCCCCAAGTATGGCCAGG - Intergenic
960596802 3:119414614-119414636 AGACATTGCCCAGCATGGCCTGG + Exonic
961509633 3:127392919-127392941 AGTCAGCCCCAGCCATGCCCAGG - Intergenic
962637203 3:137343373-137343395 AGACAACCCCCTGCATGGCTGGG + Intergenic
963466305 3:145686655-145686677 AAATAGACCCAAGCAAGGCCGGG + Intergenic
964488300 3:157208559-157208581 AGAGAGCCCCAAGAATGCCTTGG + Intergenic
967471827 3:189870812-189870834 AGACACAGCCAAGCAGGGCCAGG + Intronic
967972074 3:195006384-195006406 TGCCAGCCCCAAGCATGGCAAGG + Intergenic
967975953 3:195034944-195034966 AGCCAGCCCAAATCCTGGCCCGG + Intergenic
968593547 4:1471427-1471449 AGCCAGCCCCAGGTCTGGCCGGG - Intergenic
968890920 4:3368056-3368078 AGAAGGCCCCACGCATGCCCAGG + Intronic
970879637 4:20913858-20913880 AAACAGTACCAGGCATGGCCAGG + Intronic
971457900 4:26861171-26861193 AGCCAGCCCCACGCTGGGCCAGG - Exonic
973645657 4:52949009-52949031 AGGCAGCCCCAAGACTGGACTGG + Intronic
974090759 4:57308455-57308477 AGACAGTGACACGCATGGCCAGG + Intergenic
974399282 4:61381051-61381073 AGACAGCTCCAACCAAGGACAGG - Intronic
980101412 4:128544897-128544919 AGACGTGCACAAGCATGGCCTGG + Intergenic
982351038 4:154415749-154415771 ATTCAGCCCAAAGCGTGGCCAGG + Intronic
984932644 4:184860600-184860622 AGAAAGCCCAAAGCATAGTCGGG + Intergenic
986678981 5:10216266-10216288 AGACATCACCCACCATGGCCAGG + Intergenic
988079500 5:26398897-26398919 AAACAGCTACCAGCATGGCCAGG - Intergenic
989697871 5:44224896-44224918 AGGCAGCCCCAAGGATGCCATGG - Intergenic
990369969 5:55107806-55107828 AGTGAGCCCCAAGAATGACCTGG - Exonic
991590885 5:68250283-68250305 AGACAGGCCCCAGCATGGGAAGG + Intronic
996494297 5:124136018-124136040 AATCAGCCACCAGCATGGCCAGG + Intergenic
998378672 5:141708525-141708547 CGACACCCCCATGCTTGGCCCGG - Intergenic
999283728 5:150381642-150381664 ACACAGCCCAAAATATGGCCGGG - Intronic
1001260815 5:170227020-170227042 AGACAGCCCCCATGGTGGCCAGG - Intergenic
1002872446 6:1179073-1179095 AAGCAGCCCCAAGAGTGGCCTGG - Intergenic
1004407997 6:15352493-15352515 GGAAGGCTCCAAGCATGGCCTGG + Intronic
1007695788 6:43733734-43733756 GTACAGCCCCAAGGATGGCAGGG - Intergenic
1013583566 6:111559356-111559378 ACAAGGCCCCAAACATGGCCTGG + Exonic
1015332298 6:131994586-131994608 AGGCATCCCCATGCATGGCATGG - Intergenic
1015462666 6:133510690-133510712 AGACTGCCCAAGGAATGGCCTGG - Intronic
1018739488 6:166716403-166716425 AGGCAGCCCCCATCCTGGCCAGG + Intronic
1019597242 7:1863791-1863813 AGAAAGCCCCGAGGAAGGCCAGG + Intronic
1019667208 7:2257865-2257887 ACTCAGACCCAAGCCTGGCCTGG + Intronic
1019918837 7:4150201-4150223 AGACAGGCCCCAGGAGGGCCTGG - Intronic
1020180499 7:5918863-5918885 ACACAGCCGCACTCATGGCCTGG - Exonic
1020302432 7:6806019-6806041 ACACAGCCGCACTCATGGCCTGG + Exonic
1023809060 7:43897407-43897429 AGACTGCCGCAGGCATAGCCGGG + Intronic
1024470522 7:49765250-49765272 AGAGAACCCCAAGCAGGGACTGG + Intergenic
1025066970 7:55865378-55865400 AGAAATCCCCAAGCTTGGCCCGG - Intergenic
1026555255 7:71402883-71402905 ACACAGCTCCATGCTTGGCCAGG + Intronic
1029347329 7:99987948-99987970 GGGCAATCCCAAGCATGGCCCGG + Intergenic
1034199700 7:149276295-149276317 AAACAGCCCCAAGCATCACAAGG - Intronic
1035133549 7:156677506-156677528 CGCCACTCCCAAGCATGGCCTGG - Intronic
1035183087 7:157105002-157105024 AGACAGCCCCAGGCAGGTGCTGG + Intergenic
1035351122 7:158247189-158247211 TGGCACCCCCCAGCATGGCCAGG + Intronic
1035663313 8:1363268-1363290 AGACAGCCGCAAGCATGCCATGG - Intergenic
1035663323 8:1363320-1363342 AGACAGCCGCAAGCATGCCACGG - Intergenic
1035793073 8:2325707-2325729 GCACAGCCCCCAGCATGGACAGG - Intergenic
1035799731 8:2395998-2396020 GCACAGCCCCCAGCATGGACAGG + Intergenic
1037802715 8:22044103-22044125 AGAAAGCCCCCAGCCTGGCTGGG + Intronic
1039102118 8:33951780-33951802 AGGCAGCCCAAAGCAGGGCAGGG + Intergenic
1040065298 8:43140301-43140323 AGGCAGGGCCTAGCATGGCCCGG + Intergenic
1040826610 8:51628129-51628151 AGAAAGCCACAAGCATATCCAGG + Intronic
1043750540 8:83928760-83928782 AGACAACCCCAAACAAGCCCAGG - Intergenic
1044406083 8:91827794-91827816 AGACAGCATCAAACATGGCCTGG - Intergenic
1044855398 8:96470051-96470073 AGATTGCCCCAGTCATGGCCCGG + Intergenic
1045495599 8:102705607-102705629 ACAGAGCCCCTAGCATAGCCTGG - Intergenic
1046681121 8:117171355-117171377 AGTCAGCCCCAAGAATGTCGTGG - Intronic
1047934377 8:129762430-129762452 AGGCACCTCCAAGCATGGCCTGG - Intronic
1049097265 8:140556369-140556391 AGACGGTCCCAAGCAGAGCCAGG - Intronic
1049197641 8:141324445-141324467 AGAGGGCTCCAAGCATGGCGAGG - Intergenic
1049426126 8:142538635-142538657 GGACAGCCCCAGGCTTGGGCAGG + Intronic
1054142456 9:61540193-61540215 AGGCAGCCCCAAGCCTGGGTGGG - Intergenic
1054191092 9:61986223-61986245 AGGCAGCCCCAAGCCTGGGTGGG + Intergenic
1054462200 9:65471343-65471365 AGGCAGCCCCAAGCCTGGGTGGG - Intergenic
1054647277 9:67601494-67601516 AGGCAGCCCCAAGCCTGGGTGGG - Intergenic
1054804026 9:69380910-69380932 ACTCAACCCCAAGCATCGCCCGG - Intronic
1056756909 9:89387410-89387432 AGACAGTCCCATCCAGGGCCTGG + Exonic
1056887348 9:90456282-90456304 ATAAAGACCCAAACATGGCCTGG + Intergenic
1060294887 9:122336765-122336787 AGACAGCCCCAGGCAGGGGAGGG - Intergenic
1060801522 9:126548512-126548534 AGGCAGCCCCATCCAAGGCCTGG - Intergenic
1060821581 9:126664393-126664415 AGACAGCCCCAGGGATGGGGGGG + Intronic
1060880788 9:127116657-127116679 AAGCAGCCCCAGGCAAGGCCTGG - Intronic
1062481274 9:136753694-136753716 CGCCAGCCCCCAGCACGGCCGGG - Intergenic
1062506752 9:136881607-136881629 AGCCAGCCCCAGGCTTGCCCTGG + Intronic
1062595788 9:137298574-137298596 AGGCAGCCCCAGTGATGGCCAGG - Intergenic
1062621903 9:137426612-137426634 AGAGAGGCCGAGGCATGGCCTGG - Intronic
1062658134 9:137614641-137614663 AGGCAGCCCCAGGCCTGGCCGGG - Exonic
1203458425 Un_GL000220v1:11793-11815 AGACAGACCAGAGCAAGGCCTGG - Intergenic
1187321276 X:18239709-18239731 ATAAAGCCCCAAACATGGCTGGG + Exonic
1198576952 X:138021006-138021028 AGAAAGCCACAAGCATGCCTAGG - Intergenic
1199979617 X:152913717-152913739 AAACAGCGCCAAGAATGGTCTGG - Intergenic
1199979764 X:152914548-152914570 AAACAGCCCCAAACAGAGCCTGG - Intronic