ID: 1169274017

View in Genome Browser
Species Human (GRCh38)
Location 20:4221180-4221202
Sequence AGACAGCCCCAAGCATGGCC AGG (reversed)
Strand -
Crispr in exon? Yes
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total 255
Summary {0: 1, 1: 0, 2: 1, 3: 26, 4: 227}

Found 10 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1169274017_1169274025 4 Left 1169274017 20:4221180-4221202 CCTGGCCATGCTTGGGGCTGTCT 0: 1
1: 0
2: 1
3: 26
4: 227
Right 1169274025 20:4221207-4221229 AGGGTTCAGGGCATGGAGGATGG 0: 1
1: 1
2: 11
3: 66
4: 506
1169274017_1169274021 -9 Left 1169274017 20:4221180-4221202 CCTGGCCATGCTTGGGGCTGTCT 0: 1
1: 0
2: 1
3: 26
4: 227
Right 1169274021 20:4221194-4221216 GGGCTGTCTACTCAGGGTTCAGG 0: 1
1: 0
2: 0
3: 10
4: 102
1169274017_1169274022 -8 Left 1169274017 20:4221180-4221202 CCTGGCCATGCTTGGGGCTGTCT 0: 1
1: 0
2: 1
3: 26
4: 227
Right 1169274022 20:4221195-4221217 GGCTGTCTACTCAGGGTTCAGGG 0: 1
1: 0
2: 0
3: 12
4: 156
1169274017_1169274024 0 Left 1169274017 20:4221180-4221202 CCTGGCCATGCTTGGGGCTGTCT 0: 1
1: 0
2: 1
3: 26
4: 227
Right 1169274024 20:4221203-4221225 ACTCAGGGTTCAGGGCATGGAGG 0: 1
1: 0
2: 0
3: 22
4: 267
1169274017_1169274027 6 Left 1169274017 20:4221180-4221202 CCTGGCCATGCTTGGGGCTGTCT 0: 1
1: 0
2: 1
3: 26
4: 227
Right 1169274027 20:4221209-4221231 GGTTCAGGGCATGGAGGATGGGG 0: 1
1: 0
2: 3
3: 34
4: 374
1169274017_1169274023 -3 Left 1169274017 20:4221180-4221202 CCTGGCCATGCTTGGGGCTGTCT 0: 1
1: 0
2: 1
3: 26
4: 227
Right 1169274023 20:4221200-4221222 TCTACTCAGGGTTCAGGGCATGG 0: 1
1: 0
2: 1
3: 19
4: 171
1169274017_1169274029 25 Left 1169274017 20:4221180-4221202 CCTGGCCATGCTTGGGGCTGTCT 0: 1
1: 0
2: 1
3: 26
4: 227
Right 1169274029 20:4221228-4221250 GGGGCAGTGTTTCTCAAATAGGG 0: 1
1: 0
2: 3
3: 44
4: 337
1169274017_1169274030 30 Left 1169274017 20:4221180-4221202 CCTGGCCATGCTTGGGGCTGTCT 0: 1
1: 0
2: 1
3: 26
4: 227
Right 1169274030 20:4221233-4221255 AGTGTTTCTCAAATAGGGATTGG 0: 1
1: 0
2: 1
3: 22
4: 221
1169274017_1169274026 5 Left 1169274017 20:4221180-4221202 CCTGGCCATGCTTGGGGCTGTCT 0: 1
1: 0
2: 1
3: 26
4: 227
Right 1169274026 20:4221208-4221230 GGGTTCAGGGCATGGAGGATGGG 0: 1
1: 0
2: 2
3: 26
4: 330
1169274017_1169274028 24 Left 1169274017 20:4221180-4221202 CCTGGCCATGCTTGGGGCTGTCT 0: 1
1: 0
2: 1
3: 26
4: 227
Right 1169274028 20:4221227-4221249 TGGGGCAGTGTTTCTCAAATAGG 0: 1
1: 0
2: 9
3: 60
4: 468

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1169274017 Original CRISPR AGACAGCCCCAAGCATGGCC AGG (reversed) Exonic