ID: 1169275174

View in Genome Browser
Species Human (GRCh38)
Location 20:4228877-4228899
Sequence CTGGAGACGTGGAGAGAAGA AGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 613
Summary {0: 1, 1: 0, 2: 4, 3: 54, 4: 554}

Found 0 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1169275174 Original CRISPR CTGGAGACGTGGAGAGAAGA AGG (reversed) Intronic
900333404 1:2148501-2148523 ATGGAGGCCTGGATAGAAGACGG - Intronic
901400399 1:9011604-9011626 GTGGAAAAGTGGAGAGATGAGGG - Intronic
901626450 1:10627779-10627801 CTGAAGACGTGGGCAGAAGCAGG + Intronic
901661255 1:10799273-10799295 TTGGAGACGTTGAGAGAGGTGGG - Intergenic
901672742 1:10865888-10865910 CTGGGAATGGGGAGAGAAGAAGG + Intergenic
901910988 1:12458003-12458025 CTTGTGACGTGGAGAGAGCATGG + Intronic
902652720 1:17846999-17847021 CGGGAGAGGTGGTGAGAAGTGGG - Intergenic
902833127 1:19030269-19030291 CTGGAGCAGGGGAGAGAGGAAGG + Intergenic
902908104 1:19574214-19574236 CTGCAGACAGGGAGAGATGAAGG - Intergenic
902942552 1:19811188-19811210 CCTGAGACGTAGAGAGACGAAGG + Intergenic
904310700 1:29627741-29627763 GAGGAGACATGGGGAGAAGATGG + Intergenic
904437069 1:30506009-30506031 CTGGAGGTGTGCACAGAAGATGG - Intergenic
904592835 1:31624868-31624890 CAGGAAACGTGGACAGAAGTGGG + Intronic
904616955 1:31755141-31755163 CAGGAGACCTGGAGGGAACAGGG - Intronic
905027657 1:34861993-34862015 CTGAATATGTGGAGAGGAGAAGG + Intergenic
905921015 1:41718697-41718719 CAGGAGAGATGGAGAGAGGAGGG - Intronic
907528640 1:55070549-55070571 CTGCTGAGTTGGAGAGAAGAGGG + Intronic
907649071 1:56276148-56276170 CTGGAGACGAACAGAGAGGAGGG - Intergenic
907680388 1:56557843-56557865 CCGGGGACTTGCAGAGAAGAAGG - Intronic
908602967 1:65761294-65761316 CTGGAGAGGCTGAGACAAGAGGG - Intergenic
908639220 1:66203832-66203854 CTTGACAAGTTGAGAGAAGAAGG - Intronic
909837603 1:80276598-80276620 ATGGAGAGGTGGAAAGGAGATGG - Intergenic
909884619 1:80925368-80925390 GTGGAGATCTAGAGAGAAGATGG + Intergenic
909988282 1:82189571-82189593 CTGGTGATGAGGAGGGAAGAGGG - Intergenic
910738487 1:90489193-90489215 TTGGAGACTTGGAGGGAGGAGGG - Intergenic
911397904 1:97335190-97335212 CTGCAGCCATGGAAAGAAGAGGG - Intronic
911736671 1:101343861-101343883 GTGAAGACACGGAGAGAAGATGG + Intergenic
912373601 1:109192588-109192610 CTGGAGACAAGGAAACAAGAGGG - Intronic
912582565 1:110734005-110734027 ATGGGGAGGTGGAGAGGAGAAGG + Intergenic
912616326 1:111103333-111103355 TTGAAGAAGTGGAGTGAAGAAGG - Intergenic
912856349 1:113171566-113171588 CTGCAGACCTGGAGACTAGATGG + Intergenic
912956518 1:114157432-114157454 CTGGGGACTTGGAGGGAGGAGGG - Intergenic
913320775 1:117587021-117587043 CTGTAAACTTGGAGAGAAAATGG + Intergenic
913539209 1:119802922-119802944 CTGGTGAAATGGAGAGAAGAGGG - Intronic
914680801 1:149936930-149936952 CTGGAAAAGTGGAGAGGAAACGG + Intergenic
915011621 1:152692045-152692067 TTTGAGGAGTGGAGAGAAGAAGG + Intergenic
915148012 1:153806802-153806824 CTGGAGGAGTGGGGAGAAAAGGG + Exonic
916901257 1:169226393-169226415 TTGGCGAGGTGGAGAGAAAAGGG + Intronic
917112483 1:171563171-171563193 CTACAGATGTGGAGAGAAAATGG - Intronic
917737192 1:177932196-177932218 GTGAAGACGTGGAAAGAAGATGG + Intronic
918095449 1:181330336-181330358 CTGGAGGCAGGCAGAGAAGAAGG - Intergenic
918470247 1:184865116-184865138 CTGGTGAGGTGCAGAGAAAAGGG + Intronic
919843489 1:201626351-201626373 CTGGAGATGGGGAGGGAAGCAGG - Intronic
920009574 1:202858101-202858123 CTTGAGACGGGGAGAGCAGGTGG + Intergenic
920256688 1:204660173-204660195 CGGGAGACCTGGAGAGGAGCAGG - Intronic
920357075 1:205381752-205381774 ATCGAGAGCTGGAGAGAAGAAGG - Exonic
921301359 1:213754236-213754258 GTGAGGACGTAGAGAGAAGACGG - Intergenic
921392049 1:214626297-214626319 TTTGAAAGGTGGAGAGAAGAAGG - Intronic
922923730 1:229330319-229330341 CTGGAGCTCAGGAGAGAAGATGG + Intronic
922936524 1:229426963-229426985 CTGGAGCTGGGGAGAGAAGCAGG + Intergenic
923875810 1:238045769-238045791 TTGGGGACTTGGGGAGAAGAGGG + Intergenic
924946536 1:248850517-248850539 CTGGAGTCAGGGACAGAAGAGGG + Intronic
1062784899 10:256203-256225 CTGGAGAAGTGGAGTGAGGCAGG - Intergenic
1063060076 10:2541984-2542006 CTGGAGATGTGGAGAGTTTAGGG + Intergenic
1063078816 10:2745086-2745108 CTGGAGCAGTGGCGAGAAAACGG + Intergenic
1063331073 10:5159980-5160002 CTGGAGAAGTGCAAAGAAGCAGG - Intergenic
1063342683 10:5282873-5282895 CTGGAGAAGTGCAAAGAAGCAGG - Intergenic
1063376033 10:5554974-5554996 CTGCTGAAGTGGAGAGAAAAGGG + Intergenic
1064026057 10:11849721-11849743 CGGCAGAAGTGTAGAGAAGAGGG + Intronic
1064841047 10:19592384-19592406 CTGGTGAGTTGGAGATAAGATGG - Intronic
1064852059 10:19719341-19719363 CTTGTGAAGTGGAGTGAAGACGG + Intronic
1065780587 10:29162868-29162890 GTGTAGAGGAGGAGAGAAGAAGG + Intergenic
1065883579 10:30058681-30058703 CTGGAGACGGGGGAAGTAGAGGG + Intronic
1067149462 10:43717842-43717864 TTTGACAAGTGGAGAGAAGAAGG + Intergenic
1067545270 10:47188237-47188259 GTGGAGGTGGGGAGAGAAGAGGG + Intergenic
1069561320 10:69432451-69432473 GTGGAGAAGAGGAGAGAATAGGG - Intergenic
1069671847 10:70212689-70212711 CTGGAGAGGAGGAGGGAATAGGG + Intronic
1069898192 10:71691863-71691885 CTGGAGGCTTGGGGAGCAGATGG + Intronic
1069930798 10:71880433-71880455 GTGGAGAGGTGGAGGGGAGAAGG - Intergenic
1069930801 10:71880441-71880463 CTGGAGAGGTGGAGAGGTGGAGG - Intergenic
1071098660 10:82009996-82010018 CTGGAGAAGTGGAGATAACAAGG + Intronic
1072153864 10:92706158-92706180 ATGGAAATGAGGAGAGAAGAGGG - Intergenic
1072811470 10:98465978-98466000 ATGGAGACCTGGGGAGCAGAGGG - Intronic
1073063813 10:100746876-100746898 CTGGAGATGCTGAGAGATGAGGG - Intronic
1073306159 10:102504619-102504641 CTGTAAACGTGGTGAAAAGAGGG + Intronic
1073421743 10:103429539-103429561 GTGAAGACATGGGGAGAAGATGG - Intronic
1073536550 10:104281831-104281853 CTGGAGACATGCATACAAGAAGG + Intronic
1075489328 10:122853089-122853111 TTGAATAGGTGGAGAGAAGAAGG - Intronic
1075841913 10:125512044-125512066 CTGGACACTTGGAGAAATGAAGG - Intergenic
1076071167 10:127490963-127490985 CTGGGGAGGGGGAGGGAAGAAGG - Intergenic
1076077324 10:127544891-127544913 ATGGAGAGGTGGAGAGAAAGAGG - Intergenic
1076230758 10:128818150-128818172 CTGGAGATTTGGAGAGGAGATGG - Intergenic
1076478225 10:130767256-130767278 CTGGAAACGAGGAGACAAGTAGG + Intergenic
1077149365 11:1062620-1062642 CTGGAGGCTGGAAGAGAAGACGG - Intergenic
1077166753 11:1145152-1145174 CTGGAGACTGGGAGAGGGGACGG + Intergenic
1077343763 11:2037281-2037303 GTGGGGAAGTGGAGAGGAGAAGG - Intergenic
1077528146 11:3081094-3081116 CTGGAGAGGTGGTGAGGAGGTGG + Intergenic
1078239262 11:9515255-9515277 CTGGATACCTGGAGAGAAGTTGG + Intronic
1078313391 11:10269424-10269446 CTGGAACCGTAGAGAAAAGAAGG + Intronic
1078480210 11:11668848-11668870 CTGGACGCGTGGAGAAAAGCAGG + Intergenic
1078868953 11:15326312-15326334 TTGGGGAAGTGGAGAGGAGAAGG + Intergenic
1078930887 11:15911373-15911395 TTGGAGCCATGGAGGGAAGAAGG + Intergenic
1079154338 11:17930504-17930526 CTGCAGCCATGGGGAGAAGATGG + Intronic
1079252083 11:18793772-18793794 CTGGAAATGTGGGGAGAAGGAGG - Intergenic
1079619428 11:22535170-22535192 CTGGACACTGAGAGAGAAGAAGG - Intergenic
1079666199 11:23109056-23109078 CTGGAGAAGTGGAGAAAAAAAGG + Intergenic
1079961184 11:26925931-26925953 ATGAAGACATGGAGAAAAGAAGG - Intergenic
1081781449 11:45715947-45715969 CAGGAGGCGTGGAAAGAAGATGG + Intergenic
1082785618 11:57314678-57314700 GGGAGGACGTGGAGAGAAGAGGG + Intronic
1082841338 11:57692673-57692695 CTGGAGAACTGCAGAGAACACGG - Exonic
1082887989 11:58108669-58108691 ATGAAGACCTGGAGAAAAGATGG + Intronic
1084168715 11:67389933-67389955 CTGGTGACGAGGGGAGCAGAAGG + Intronic
1084596770 11:70121175-70121197 AGGGAGACGGGGAGAGAAGGAGG - Intronic
1084941661 11:72616427-72616449 CTGGAGACCTGGAGAGGGGCAGG - Intronic
1085494547 11:76956036-76956058 CTGGAGGGGTTGAGAGAAAATGG + Intronic
1086132996 11:83420291-83420313 GTAGAGACATGGAGAGAAGGGGG - Intergenic
1087306867 11:96499361-96499383 CTGGAGAAGAAGAGAGAACAAGG - Intronic
1088972701 11:114787605-114787627 CTGGGGAGTTGGAGAGAGGAGGG + Intergenic
1089507683 11:118974996-118975018 CTGGAGTTCTGGAGAGAAGTGGG + Intronic
1090486874 11:127120967-127120989 ATAGACACGTGGAAAGAAGATGG + Intergenic
1091183434 11:133627716-133627738 GTAGAGACAGGGAGAGAAGAGGG - Intergenic
1091183443 11:133627758-133627780 GTAGAGACAGGGAGAGAAGAGGG - Intergenic
1091183452 11:133627800-133627822 GTAGAGACAGGGAGAGAAGAGGG - Intergenic
1202826749 11_KI270721v1_random:92470-92492 GTGGGGAAGTGGAGAGGAGAAGG - Intergenic
1091634284 12:2185610-2185632 GTGAAGACATGGGGAGAAGAGGG + Intronic
1091755064 12:3045982-3046004 CTGAAGATTTGGAGAGATGAAGG - Intergenic
1091772235 12:3159768-3159790 GTGAAGACGTAGGGAGAAGACGG + Intronic
1092028215 12:5261057-5261079 AAGCAGAAGTGGAGAGAAGAGGG + Intergenic
1092999034 12:13978327-13978349 TTGTAGACGTGGTGAGAACATGG + Intronic
1093908478 12:24719468-24719490 CTGGAGACTGTGAGGGAAGAGGG - Intergenic
1093971413 12:25379495-25379517 CTGGAGACAAAGAGACAAGATGG - Intergenic
1094164823 12:27432582-27432604 CTGGAGATGTAGAGAGGATATGG - Intergenic
1095535758 12:43245023-43245045 CTGAAGATGTGGGGAGATGATGG + Intergenic
1096007776 12:48185992-48186014 CTGGAGGCAAGGAGAGAGGAGGG - Intergenic
1096088907 12:48885189-48885211 CTTGAGAAGGGTAGAGAAGAAGG + Intergenic
1096573699 12:52539848-52539870 CTGGAGAGGGAGAGAGGAGATGG - Intergenic
1096778271 12:53976946-53976968 CAGGAGCTGTGGAGAGGAGAGGG - Exonic
1097031841 12:56095366-56095388 GTGGTTACCTGGAGAGAAGAGGG + Intronic
1098015421 12:66099714-66099736 TTTGACAAGTGGAGAGAAGAAGG - Intergenic
1098081514 12:66790929-66790951 CTGGAGGACTGGAAAGAAGATGG + Intronic
1098645697 12:72898041-72898063 CTGTAGACGAGGAGAGGAGGTGG + Intergenic
1100667662 12:96772156-96772178 CTGGACACTTGCAGAGAAGATGG - Intronic
1101242017 12:102848351-102848373 CTGAAGAGGTGGAGGGTAGACGG + Intronic
1101242123 12:102848945-102848967 CTGGAGAGGTTGAGAGTAAATGG + Intronic
1102810274 12:115818410-115818432 CTTGAGAAGAGGAGAGAGGAAGG - Intergenic
1103038991 12:117679134-117679156 AAGGATACATGGAGAGAAGACGG - Intronic
1103626680 12:122225643-122225665 GAGGAGACGTGGAGAGGAGGAGG - Intronic
1103948915 12:124541230-124541252 AGGGAGATGGGGAGAGAAGATGG + Intronic
1104393583 12:128412287-128412309 CTGAAGATGGGGAGAAAAGATGG - Intronic
1104667554 12:130658053-130658075 ACGGAGTCGTGGAGAGAGGATGG - Intronic
1105024176 12:132837768-132837790 CTGCAGCCGTGTAGAGAAGCCGG - Intronic
1105032008 12:132890515-132890537 GTAGAGACATGGAGAGAAGGGGG - Intronic
1106157019 13:27168973-27168995 GTGGAATGGTGGAGAGAAGATGG - Intronic
1107347826 13:39481900-39481922 CTGGAGCAGTAGAGAGATGATGG + Intronic
1107543010 13:41410782-41410804 CTGGAAATGTGGAGAGAAAGAGG + Intergenic
1108576888 13:51798582-51798604 GCGGAGAGGAGGAGAGAAGAGGG - Intronic
1109150045 13:58835742-58835764 CTGGAGGAGTGGGGAGCAGAGGG - Intergenic
1109217479 13:59606067-59606089 ATGGAGACCTGGAGAGATGAGGG + Intergenic
1110509479 13:76332616-76332638 GAGGAGAGGAGGAGAGAAGAAGG - Intergenic
1111171400 13:84530724-84530746 CAGGAGACGTGGAGGCCAGAGGG + Intergenic
1111894913 13:94129452-94129474 CTGGAGACTTGGAAAGGAAATGG - Intronic
1112896574 13:104306579-104306601 ATGGGGACGTGGTGAGAAGATGG + Intergenic
1113162316 13:107395776-107395798 GTGAAAACATGGAGAGAAGACGG - Intronic
1113673205 13:112189010-112189032 CTGTAGACTAGGAGAGAGGAAGG + Intergenic
1113698654 13:112366522-112366544 TTAGAGAGGTGGAGGGAAGAAGG + Intergenic
1113891258 13:113736758-113736780 GTGGTCACGGGGAGAGAAGATGG + Exonic
1117069545 14:52044057-52044079 CTGGAAACGAGGAGACAGGAGGG + Intronic
1117512407 14:56466227-56466249 CATGAGAAGTGGTGAGAAGAGGG + Intergenic
1117671948 14:58117057-58117079 CTGGAGAAGTGGAGGCAGGAGGG - Intronic
1117803488 14:59467301-59467323 TTGGAGATGGGGAGTGAAGAAGG + Intronic
1117871842 14:60209361-60209383 CAGGAGCCATGTAGAGAAGATGG - Intergenic
1118712478 14:68533442-68533464 CTGGAGACATCAAGAGAGGATGG + Intronic
1118865076 14:69696582-69696604 CTGAAGATGTGGAAAGAAGGAGG - Intronic
1118895519 14:69942561-69942583 CTGGAGATAAGGAGAGAAGCAGG - Intronic
1119709258 14:76809505-76809527 CTGCAGCAGTGGCGAGAAGAAGG - Exonic
1120074016 14:80135246-80135268 CAGGAATCTTGGAGAGAAGATGG + Intergenic
1120629312 14:86870578-86870600 CTGGAGACCAGGAGAGCAGATGG + Intergenic
1121230665 14:92355253-92355275 CTGTAGACGTGGGGACAAGGAGG + Intronic
1121317792 14:92972400-92972422 GTGCAGACGTGGGGAGATGAGGG + Intronic
1121379883 14:93455337-93455359 ATGGAGATGTGGAGAGAACAAGG - Intronic
1121560581 14:94872403-94872425 CTGGAAAGGTGCAGAGAAGAGGG - Intergenic
1121742780 14:96265865-96265887 CTGGATACGTGGAGACAGGGAGG + Intronic
1122139102 14:99651697-99651719 CTGGAGAGGTGGGGAGAGGCAGG + Intronic
1122958302 14:105083041-105083063 GTGGAGGGGTGGAGAGAGGAGGG - Intergenic
1123932655 15:25179283-25179305 CTGAAGCCGTGCAGAGATGATGG + Intergenic
1124382247 15:29176735-29176757 CTGGCGACCTGGAGGGAAGGAGG - Intronic
1124553508 15:30705512-30705534 CTGAAGTCGTGGGGAGATGAAGG + Intronic
1125279078 15:38025440-38025462 CTTGAAAGATGGAGAGAAGAAGG - Intergenic
1125777499 15:42230246-42230268 CTGCAAGCGTTGAGAGAAGAGGG - Intronic
1127034268 15:54897490-54897512 CTGGAGACTGGCAGAGAAGGTGG - Intergenic
1127038089 15:54941932-54941954 TGGTAGAGGTGGAGAGAAGAGGG - Intergenic
1127374325 15:58369185-58369207 AAGGAGGCGTGGAGAGAAGTGGG - Intronic
1128161378 15:65424864-65424886 CTGGAGAGGTGGTGAGCACAGGG - Intergenic
1130071365 15:80649129-80649151 CTGGAGCGATGCAGAGAAGATGG + Intergenic
1130099142 15:80878892-80878914 CTGGGGCAGTGGAGGGAAGAGGG - Intronic
1130154848 15:81341488-81341510 TGGGAGACATGGGGAGAAGAAGG + Exonic
1130364576 15:83222669-83222691 TTTGAGAAGTTGAGAGAAGAAGG + Intergenic
1131143962 15:90000159-90000181 CCGGAGGAGTGGGGAGAAGACGG - Intergenic
1131426682 15:92351141-92351163 ATGGAAACGTGGAGAGCACAAGG - Intergenic
1132752693 16:1466088-1466110 CTGGGGACATGAAGGGAAGAAGG + Intronic
1134792011 16:16997596-16997618 TGGGAGGCGTGGAGGGAAGAGGG - Intergenic
1135050106 16:19185643-19185665 TTGGTGACGTGCAGAGAAAATGG + Intronic
1135168743 16:20164604-20164626 ATGGGGAGGAGGAGAGAAGAGGG - Intergenic
1135525281 16:23209400-23209422 CTGGAGGCGTTAAGAGCAGATGG - Intronic
1136143546 16:28302186-28302208 CTGGAAAACTGGAGAGAAGGAGG + Intronic
1137458747 16:48638593-48638615 ATGAGGACGTGGGGAGAAGACGG + Intergenic
1137483408 16:48871332-48871354 CTGGAGAAGAGGAAAGAGGAAGG + Intergenic
1137491643 16:48938004-48938026 CTGGAGATGTGGAGAGAGGGAGG + Intergenic
1137725144 16:50651866-50651888 CAGGAGATGTGCAGAGAAGAGGG - Intergenic
1137841077 16:51641383-51641405 CTGGAGATGAGGAGATAAGCAGG + Intergenic
1138187033 16:54984771-54984793 CTGGTGACGTGAACAGAAGTGGG - Intergenic
1138232952 16:55353056-55353078 CTGGACCAGTGGCGAGAAGAAGG - Intergenic
1139298329 16:65922334-65922356 GTGGAGCAGTGGAGAGGAGAGGG - Intergenic
1139344762 16:66295862-66295884 CTGCAGCCTTGCAGAGAAGAGGG + Intergenic
1139956934 16:70697659-70697681 CTGCAGAGGTGGGGAGGAGATGG - Intronic
1140546324 16:75813350-75813372 CTGGTGAGGTGGGGAGAAAAGGG - Intergenic
1140727000 16:77822529-77822551 TTGGAGGAGGGGAGAGAAGAAGG + Intronic
1141272322 16:82552667-82552689 CAGGAAACCTGGAGAGAAAAAGG + Intergenic
1141667826 16:85474969-85474991 CTGGAGACGTCTGGAGAACAGGG - Intergenic
1141833245 16:86521544-86521566 CGGGAGAGGGGGACAGAAGAGGG + Intergenic
1141848385 16:86626811-86626833 CTGCAGATGTGGGGAGAAGAGGG - Intergenic
1141856373 16:86683819-86683841 ATGGAGAGGTGGAGAGAGGGAGG - Intergenic
1141856484 16:86684760-86684782 CTGGAGACGGGGAGAGTGGGGGG - Intergenic
1141865945 16:86749847-86749869 TCTGAGACTTGGAGAGAAGAGGG + Intergenic
1142614716 17:1127587-1127609 CTGGAGAGGAGGAGGGAGGAGGG - Intronic
1142694031 17:1623594-1623616 CTGGAGGAGAGGAGAGAAGTGGG - Intronic
1142889830 17:2936052-2936074 GTGGAGACAGGGAGAGGAGATGG - Intronic
1143702091 17:8668232-8668254 TGGGAGAAATGGAGAGAAGATGG - Intergenic
1143747602 17:9005112-9005134 GTGAAGACGTGGAGAGATGCGGG - Intergenic
1144193492 17:12868195-12868217 ATGAAGACGCAGAGAGAAGATGG - Intronic
1144252394 17:13430831-13430853 CTGGTGTGGTGGAAAGAAGAAGG - Intergenic
1144371304 17:14594294-14594316 CAGGAGATATGGATAGAAGAGGG + Intergenic
1146008282 17:29176112-29176134 CTGGAGAGTAGGGGAGAAGAAGG + Intronic
1146646273 17:34579368-34579390 ATGGACACGTGGACAGAGGAGGG + Exonic
1146788896 17:35740523-35740545 CTGGAGACGAGGTGAGAGGCTGG + Exonic
1147610346 17:41798342-41798364 CTGGGGACAGGGAGAGGAGAGGG - Intergenic
1147705643 17:42423146-42423168 CGGGAGACCCGGAGAGAAGCAGG + Exonic
1147861136 17:43524243-43524265 CTGGAGACGGGGTGGGAAGTGGG - Exonic
1148744697 17:49911761-49911783 CTGGAGAGGAGGGAAGAAGAGGG + Intergenic
1149242040 17:54662485-54662507 CTGGAGAAATGGACAGAAGTAGG - Intergenic
1149433992 17:56617990-56618012 CTAGTGACGTGGAGGGAAAATGG + Intergenic
1149541585 17:57471863-57471885 CTGGAGGAGAGGAGAGGAGAGGG + Intronic
1149675987 17:58462037-58462059 CTGGAGACGTGGAAGGATGCGGG - Intronic
1150245423 17:63671108-63671130 CTGATGAAGTGGAGAGAGGAAGG + Intronic
1150613420 17:66751300-66751322 AAGGAGACTTGGAGAGGAGACGG + Intronic
1150988729 17:70230265-70230287 CTGGATACGAACAGAGAAGAGGG + Intergenic
1151235576 17:72717537-72717559 AGGGACACGTGGAGGGAAGACGG - Intronic
1151356644 17:73562558-73562580 CAGGAGAGGCGGGGAGAAGAAGG + Intronic
1152008504 17:77696870-77696892 CTGGAGGGGAGGGGAGAAGAGGG - Intergenic
1152155732 17:78631677-78631699 GGGGAGAAGAGGAGAGAAGAGGG + Intergenic
1152155742 17:78631707-78631729 GGGGAGAAGAGGAGAGAAGAGGG + Intergenic
1152812767 17:82390202-82390224 CTTTAGACGTGGCGAGAAGCCGG + Intronic
1152918943 17:83056042-83056064 CTGGAGACTTGGACACACGAAGG - Intergenic
1154395925 18:13988569-13988591 ATGGAGACCTGGGGAGAAGTGGG + Intergenic
1155315426 18:24566467-24566489 CTGTAGACGAGGAGAGAGAAAGG + Intergenic
1156519357 18:37708727-37708749 ATAGAGAAGTGGAGAGAGGAAGG - Intergenic
1157560865 18:48645146-48645168 TCGGAGAGGTGGAGGGAAGAAGG + Intronic
1157662860 18:49460623-49460645 CAGGAGGCGGCGAGAGAAGAGGG + Exonic
1158300434 18:56046284-56046306 GTGCAGAGGTGGTGAGAAGAAGG - Intergenic
1159395029 18:67845948-67845970 CTGGAGAGATGGAGGCAAGATGG + Intergenic
1159888292 18:73931322-73931344 CTGGAGAGCTGGAGAGAAAATGG - Intergenic
1161199361 19:3005969-3005991 CTGGGGTCGGGGAGAGAAGCAGG + Intronic
1162576293 19:11500943-11500965 TTGGAGAAGTGGACAGGAGAGGG - Intronic
1164324414 19:24179427-24179449 GAGGAGAGGTGGAGAGAAAAAGG + Intergenic
1164634726 19:29784191-29784213 CTGAAGGTGTGGGGAGAAGAGGG + Intergenic
1165830614 19:38728590-38728612 CTGGAGACTTCTAGGGAAGAAGG - Intronic
1165837887 19:38770497-38770519 CGGGAGGCCAGGAGAGAAGAGGG + Intergenic
1165841678 19:38792200-38792222 CGGGAGGCCAGGAGAGAAGAGGG - Intergenic
1166301109 19:41912767-41912789 GTGGAGACACGGAGAGAAGGGGG + Intronic
1167266615 19:48485931-48485953 CTGGAGCAGAGGGGAGAAGAGGG - Intronic
1167524952 19:49977767-49977789 CTGGAGAGGTGGGGGAAAGAGGG + Intronic
1167801355 19:51744686-51744708 CTGGAGGTGAGGAGATAAGAGGG + Intergenic
1167958857 19:53090136-53090158 CTGGTGACAAGGAGAGCAGAGGG - Intronic
1167967205 19:53157714-53157736 CCGGTGACGAGGAGAGCAGAAGG - Intronic
1167971758 19:53192313-53192335 CTGGTGACAAGGAGAGCAGAGGG - Intronic
1168076910 19:53985512-53985534 ACGGATACGTGGAGAGAAGAGGG + Exonic
1168326400 19:55540898-55540920 CTGGAGGAGTGGACAGATGAGGG - Exonic
926086492 2:10023364-10023386 CTTGAGACTTGGGGAGGAGAGGG + Intergenic
926707848 2:15849314-15849336 AGGGGGAGGTGGAGAGAAGATGG + Intergenic
927002419 2:18811943-18811965 TTGGAGAAGTGGAGGGGAGAGGG + Intergenic
928099303 2:28426249-28426271 CTGGAGACTTGTAGGCAAGAGGG - Intergenic
928204926 2:29277104-29277126 CTGGCAACATGGAGAGAACAGGG + Intronic
928940039 2:36718287-36718309 CTGGGGACTGGAAGAGAAGAAGG + Intronic
929304173 2:40341058-40341080 ATGGAGTAGTAGAGAGAAGAGGG + Intronic
929578997 2:43070044-43070066 CTGGAGAAGCTGGGAGAAGAGGG - Intergenic
929897034 2:45969580-45969602 GTGGAGAAGGGGAGAGAAGAGGG - Intronic
930765969 2:55085412-55085434 CTGGAGACCTGGAGAGGAGTGGG + Intronic
931430438 2:62204955-62204977 CTAGAGAGGGAGAGAGAAGAAGG + Intronic
931994180 2:67824015-67824037 CTAGAGGAGTGGAGAGGAGAGGG - Intergenic
932040603 2:68295165-68295187 CAGAAGACGTGGACAGAGGAAGG + Intronic
933232941 2:79830066-79830088 CTGGAGACTGAGAGAGACGAGGG + Intronic
933321153 2:80777267-80777289 CTGAGGAGGTGGAGAGAAGCTGG + Intergenic
933552882 2:83796308-83796330 GAGGAGAGGAGGAGAGAAGAGGG + Intergenic
933562123 2:83900806-83900828 CTGGAAACGGGGAGAGACAATGG - Intergenic
934615361 2:95767401-95767423 CTGGAGAGTAGGAGAGGAGAGGG - Intergenic
934645544 2:96057158-96057180 CTGGAGAGTGGGAGAGGAGAGGG + Intergenic
934753802 2:96811186-96811208 CTGGAAGCCTGGAGAGAAGGTGG + Exonic
934838948 2:97613247-97613269 CTGGAGAGTGGGAGAGGAGAGGG + Intergenic
936155503 2:110044032-110044054 CTGGAGAGGTGGGAAGAACAGGG + Intergenic
936189183 2:110327402-110327424 CTGGAGAGGTGGGAAGAACAGGG - Intergenic
937064513 2:119007044-119007066 CTGGAGTAGTGGAAGGAAGAAGG - Intergenic
937282484 2:120729781-120729803 CTGGAGACGAGTGGAGAGGATGG + Intergenic
937394082 2:121519385-121519407 CTGGAGGCAGGGACAGAAGAGGG + Intronic
937988098 2:127647653-127647675 CTGGAGACTGGAAGAGGAGAGGG - Intronic
938151870 2:128894013-128894035 GTGAAGACGTAGGGAGAAGACGG + Intergenic
940388865 2:153107599-153107621 CTGGAGAGGAGTAGAGAAGTAGG + Intergenic
940701738 2:157053215-157053237 CTGAAGAGCTGGAGAGAAGAGGG + Intergenic
941920325 2:170844022-170844044 CTGGAAAGGTGGTAAGAAGAAGG - Intronic
942127033 2:172837326-172837348 ATGGAGACTTGGAGAGATTAAGG + Intronic
942411854 2:175717726-175717748 ATTGAGAAGTTGAGAGAAGAAGG + Intergenic
943151285 2:184116499-184116521 TTGGAGAGGTGGAGAGGTGATGG + Intergenic
943436093 2:187867398-187867420 CTGGAGACCCGGAGAGGAGCTGG - Intergenic
943436373 2:187869430-187869452 CTGGAGACCTGGGGAGGAGCAGG - Intergenic
943794959 2:191980693-191980715 CTGGAGGTCTGGAGAGAAGAGGG - Intronic
943942412 2:194015344-194015366 CTGGAAAATTGGAGAGAAGGTGG - Intergenic
944306573 2:198186469-198186491 CTGGAGCAGGGCAGAGAAGAAGG - Intronic
946401863 2:219472472-219472494 CATGCAACGTGGAGAGAAGACGG - Intronic
946406154 2:219493049-219493071 ATGGAGAAGTGGAGAGGAAAAGG + Exonic
946531232 2:220572483-220572505 CTGGAGATGTGGACAGAACAAGG + Intergenic
946613174 2:221481059-221481081 CTGGAGAGTTAGAGAGGAGAAGG - Intronic
947190964 2:227504141-227504163 CTGGAGAGGTGGAGGGGAGGCGG + Intronic
948274731 2:236699670-236699692 CTGGAGAGATGGTGAGAAGATGG + Intergenic
949071114 2:242024849-242024871 CTGGAGACCTGGGGAGGAGCTGG + Intergenic
1169113687 20:3048946-3048968 TGGGAGACATGGAGAGAAGCTGG - Intergenic
1169275174 20:4228877-4228899 CTGGAGACGTGGAGAGAAGAAGG - Intronic
1170166978 20:13369939-13369961 TTGGAAAGGTGGAGAAAAGAAGG + Intergenic
1170687689 20:18584345-18584367 CAGGAGGGATGGAGAGAAGAGGG + Intronic
1170861124 20:20104822-20104844 GTGAAGACATGGGGAGAAGATGG - Intronic
1172199958 20:33118436-33118458 CTGGAGAAGAGGAGTGAAGCAGG + Intergenic
1172261287 20:33568043-33568065 TTGGACAGATGGAGAGAAGACGG + Intronic
1172292089 20:33783981-33784003 ATGGAGAAGTGGAGGGAAAAGGG - Intronic
1172314566 20:33943758-33943780 CTGGAGGAGTGGAGTGATGATGG + Intergenic
1172583415 20:36065654-36065676 CTGGACAGCTGGAGAGAAGGTGG - Intergenic
1173648060 20:44646022-44646044 CTGGGGAGGTGGAGAGGAGCAGG - Intronic
1174045185 20:47728149-47728171 CCGGAGAGGGGGAGGGAAGATGG + Intronic
1174060991 20:47833015-47833037 CTGGAGACCTGGACAGGAGCTGG - Intergenic
1174061279 20:47834711-47834733 CTGGAGACCCAGGGAGAAGATGG - Intergenic
1174070248 20:47894612-47894634 CTGGAGACCCAGGGAGAAGATGG + Intergenic
1174070839 20:47897926-47897948 CTGGAGACCTGGGGAGAGGCCGG + Intergenic
1174070906 20:47898355-47898377 CTGGAGACCTGGACAGGAGCTGG + Intergenic
1174100197 20:48121427-48121449 CTGGAGACCTGGACAGGAGCTGG - Intergenic
1174100311 20:48122065-48122087 CTGGAGACCTGGGGAGAGGCCGG - Intergenic
1174100477 20:48122981-48123003 CTGGAGACCTGGGGAGAGGCCGG - Intergenic
1174101074 20:48126596-48126618 CTGGAGACGCAGGGAGAAGATGG - Intergenic
1174130653 20:48341488-48341510 CTGGCTAGGTGGAGAGAGGAAGG - Intergenic
1174148992 20:48472880-48472902 CTGGAGACCTGGAGAGGAGATGG - Intergenic
1174149021 20:48473086-48473108 CTGGAGACCCAGAGAGGAGATGG - Intergenic
1174149047 20:48473244-48473266 CTGGAGACCCAGAGAGGAGATGG - Intergenic
1174149054 20:48473297-48473319 CTGGAGACCAGGAGAGGAGCTGG - Intergenic
1174149085 20:48473495-48473517 CTGGAGACCCAGAGAGGAGATGG - Intergenic
1174149227 20:48474430-48474452 CTGGAGACCTAGAGAGGAGCTGG - Intergenic
1174149300 20:48474902-48474924 CTGGAGAACTGGAGAGGAGATGG - Intergenic
1174149537 20:48476414-48476436 CTGGAGACCTGGGGAGAAGCTGG - Intergenic
1174149606 20:48476813-48476835 CTGGAGACGTGGGGAGAAGCTGG - Intergenic
1174153154 20:48500304-48500326 CTGGAGACCTGGACAGGAGCTGG - Intergenic
1174153264 20:48500922-48500944 CTGGAGACCTGGGGAGGAGCCGG - Intergenic
1174153463 20:48502040-48502062 CTGGAGACCTGGGGAGGAGCTGG - Intergenic
1174156146 20:48516614-48516636 CTGGAGACCCAGGGAGAAGATGG - Intergenic
1174862672 20:54105990-54106012 TAGGAAACGTTGAGAGAAGATGG + Intergenic
1175683451 20:61008671-61008693 CTGGGAGGGTGGAGAGAAGATGG - Intergenic
1175785785 20:61711037-61711059 CTGGACACGTGGAGATTAGAGGG - Intronic
1176200026 20:63855903-63855925 GTGGAGACGGGGAGGGGAGAAGG + Intergenic
1178491837 21:33057507-33057529 CTGGGGATGCGGAGAGGAGAGGG - Intergenic
1179899397 21:44381187-44381209 CTGCGGACGAGGAGAGAAGCAGG + Intronic
1182035725 22:27196831-27196853 CTGGAGACATGCAGAGGAAAGGG - Intergenic
1182075866 22:27495058-27495080 CAGGAGACCTGGAGAAAAGGAGG + Intergenic
1182464458 22:30505758-30505780 CTGGAGAGGAGGAGAGAACTGGG - Intergenic
1182520082 22:30880271-30880293 CTAGAAACCTGGAGAGCAGAGGG + Intronic
1182919948 22:34070071-34070093 CTGGAGCCCGGGAGAGAAGCTGG - Intergenic
1183931255 22:41237437-41237459 CTGGGGACCTGGGGAGAACACGG - Exonic
1184648953 22:45910919-45910941 CTGGAGCAGGGGACAGAAGAGGG - Intergenic
1185310057 22:50149360-50149382 CTAGAGATGTGGAGGGAAGAAGG - Intronic
949158883 3:857827-857849 CTGGAGACCTGCAGAGAAGCCGG - Intergenic
949159205 3:859994-860016 CTGGAGACCTGGGGAGCAGCGGG - Intergenic
949159298 3:860726-860748 CTGGAGACATGGAGAGGAGCGGG - Intergenic
949695564 3:6690176-6690198 CTGAAATCATGGAGAGAAGAAGG + Intergenic
950215751 3:11157273-11157295 ATGGAAATGTGGAGAAAAGAAGG + Intronic
950507840 3:13406765-13406787 CTGCTGAGGTGCAGAGAAGAAGG - Intronic
951180645 3:19654742-19654764 CTGGTGGAGTGGTGAGAAGAGGG - Intergenic
951855642 3:27193846-27193868 CTGGAAACTTCTAGAGAAGAGGG + Intronic
953970356 3:47342513-47342535 ATGGAGATGAGCAGAGAAGATGG + Intronic
954868604 3:53750185-53750207 CGGGTGACGTGGTGAGGAGAGGG + Intronic
954901323 3:54022374-54022396 GTGGAGAGGTGGTGAGATGAGGG + Intergenic
954928716 3:54261290-54261312 CACCAGATGTGGAGAGAAGACGG - Intronic
955074434 3:55600500-55600522 CTTGAGTGGTGGGGAGAAGATGG - Intronic
955164969 3:56501977-56501999 GTGAAGACATAGAGAGAAGATGG - Intergenic
956820185 3:72947261-72947283 CTGTAGACGGGGAGAGAATTAGG + Intronic
956931949 3:74053463-74053485 CTGGAGTCATAGAGAGAAAATGG + Intergenic
957024117 3:75160373-75160395 CTGGAGACAGGGATTGAAGAGGG - Intergenic
957083948 3:75663298-75663320 CAGCAGAGGGGGAGAGAAGAAGG + Intergenic
958600866 3:96295025-96295047 CTGGAGATTTGAAGATAAGATGG + Intergenic
958770169 3:98416468-98416490 GAGGAGACGGGGAGAGAACAAGG + Intergenic
958982904 3:100745246-100745268 ATGGAGAGGTGGAGGGAAGGGGG - Intronic
960352280 3:116607773-116607795 CTGGAGAAGTTGAGAGCAGTGGG + Intronic
961153452 3:124659062-124659084 CTGAAGTGGTGGAGAGAATAAGG + Intronic
961200115 3:125038806-125038828 CTGGAGAAATGGAAAGGAGACGG + Intronic
961630564 3:128295628-128295650 CTGGAACTGTGGTGAGAAGATGG + Intronic
961714186 3:128847538-128847560 TTGGAAAGGTGGAGAGAGGATGG + Intergenic
961774550 3:129275048-129275070 CTGGATCCTTGGAGAGAAAAGGG - Intronic
962070774 3:132032113-132032135 CTGGAGACTTGGAGATAAACAGG + Intronic
962583314 3:136818096-136818118 CTGGAAAGGTGGGGAAAAGATGG + Intergenic
962931350 3:140040506-140040528 CTTGGGAGGTGGAGAGAAGAAGG + Intronic
964147996 3:153489354-153489376 TTGTAGAGGTGGAGGGAAGAAGG - Intronic
964375599 3:156045709-156045731 CTGGAGAGGTTTAGAGAAAAAGG - Intronic
965835757 3:172850370-172850392 ATTGAGAAATGGAGAGAAGAAGG + Intergenic
966043226 3:175518013-175518035 CTGGAAAGGAGGAGAGAAGATGG + Intronic
966646605 3:182252512-182252534 CTGGAGAGGTGGAGGGAGGAAGG + Intergenic
966890111 3:184401096-184401118 CTGTAGACATTGTGAGAAGAAGG + Intronic
968049428 3:195644030-195644052 CTGAAGACCTGGAGAGGAGGTGG + Intergenic
968097975 3:195945596-195945618 CTGAAGACCTGGAGAGGAGGTGG - Intergenic
968106441 3:196004979-196005001 CTGAAGACCTGGAGAGGAGGTGG - Intergenic
968305190 3:197645902-197645924 CTGAAGACCTGGAGAGGAGGTGG - Intergenic
969199528 4:5591509-5591531 CTGCAGAGGTGCAGAGCAGAGGG + Intronic
969449983 4:7267501-7267523 CTGGATACATGGAGGAAAGATGG + Intronic
969835439 4:9836437-9836459 GTGGAGATGTGGATTGAAGACGG + Intronic
970368835 4:15387947-15387969 AGGGAGAAGAGGAGAGAAGATGG + Intronic
971116240 4:23648795-23648817 GTGGGGAAGTGGAGAGAAAATGG - Intergenic
974088863 4:57289642-57289664 GTGGAAACGCAGAGAGAAGATGG + Intergenic
974466059 4:62258087-62258109 CTGGAGACACAGAGAGAAAATGG - Intergenic
975273946 4:72473259-72473281 CTCTAAAGGTGGAGAGAAGAAGG + Intronic
975421353 4:74167700-74167722 CTGAAGATCTGGAGAGAACATGG + Intronic
976351445 4:84064530-84064552 CTGGAGAGGTGGACAGCAGCAGG + Intergenic
976488709 4:85641518-85641540 ATGAAGACCCGGAGAGAAGATGG - Intronic
976777720 4:88724077-88724099 CTGGAGAAGTGCAGAAATGAGGG - Intergenic
977343791 4:95792518-95792540 TTTGACACGTTGAGAGAAGAAGG + Intergenic
977591480 4:98832203-98832225 CTGGGGGCGTGGACAGAAGGAGG + Intergenic
977784086 4:101012739-101012761 CAGGTAAGGTGGAGAGAAGATGG + Intergenic
977976263 4:103270245-103270267 CTTGAGACCTGGAGAGCTGATGG + Intergenic
978340740 4:107719710-107719732 CTGAAGATGTGCAGAGAAGGCGG - Intronic
981596952 4:146435350-146435372 CTGGCCATGTGGAGAGAAGCAGG - Intronic
981730021 4:147887329-147887351 CTGGAGCAGTGGAGAGAAGATGG - Intronic
981779067 4:148405257-148405279 CTTGAGAGTTGGAGAGAAAAGGG - Intronic
981872950 4:149508248-149508270 CTAGAGAAGCTGAGAGAAGAGGG + Intergenic
982000488 4:151016826-151016848 CTTGAGAAGTGGACAGAAGCCGG + Intergenic
983010512 4:162540002-162540024 TTGGAGACATAGTGAGAAGAAGG - Intergenic
984758570 4:183345023-183345045 GTGGAGAGGTGGAGAGAAGTGGG + Intergenic
984935586 4:184887232-184887254 CTAGACTCGTGGAGGGAAGAGGG - Intergenic
985124799 4:186682777-186682799 CTGATGACATGGAGAAAAGAAGG - Intronic
985164418 4:187077731-187077753 CTGCATAGGTGGAGAGAAGCTGG + Intergenic
985481857 5:117550-117572 CTGGAGAAGTTTAGAGAAAAGGG + Intergenic
985506092 5:281294-281316 CTGAAGACCTGGAGAGGAGCTGG + Intronic
986011336 5:3718602-3718624 CTGAAGACCCAGAGAGAAGATGG + Intergenic
986585240 5:9309559-9309581 CTGGAGGCATGGATTGAAGACGG + Intronic
986808305 5:11329669-11329691 TTGGAGACCAGGAGAGAAGAAGG + Intronic
988065283 5:26224250-26224272 CTGGAGACCTGGGGAGGAGCTGG - Intergenic
988065594 5:26226584-26226606 CTGGAGACCTGGGGAGGAGTGGG - Intergenic
988065711 5:26227567-26227589 CTGGAGACCTGGGGAGGAGCGGG - Intergenic
988618953 5:32802869-32802891 CTGTAAATGTGCAGAGAAGATGG + Intergenic
988793401 5:34630125-34630147 CTGGGGAGGTGGGGAGAGGAGGG - Intergenic
989238896 5:39180760-39180782 CTGGAGAAGTAGAAAGTAGATGG - Intronic
989953668 5:50331233-50331255 CTTGATAAGTTGAGAGAAGAAGG + Intergenic
990417121 5:55597213-55597235 CAGGAGTCCTGGAGAGGAGAGGG + Intergenic
991197484 5:63953396-63953418 CTGGAGACAAGGAGACCAGATGG - Intergenic
992391888 5:76337239-76337261 CTGAAGACACAGAGAGAAGATGG - Intronic
993140820 5:84031027-84031049 GTGAAGACATGGAGAGAAGATGG - Intronic
993738893 5:91511781-91511803 TTGGAGATGTGGATAGAAGTAGG + Intergenic
994566301 5:101449931-101449953 CTTGAGAGGTGGAGGGAGGAGGG + Intergenic
994926305 5:106121127-106121149 CTGGTGACGAGGAGAGCAAAGGG - Intergenic
994987546 5:106956510-106956532 GGGAAGACGTTGAGAGAAGAGGG + Intergenic
995931917 5:117455903-117455925 CTGGTGATGTGGAGACACGAAGG + Intergenic
996128788 5:119755792-119755814 TTGGAGACTTGGGGAAAAGATGG + Intergenic
996253161 5:121363402-121363424 CTAGAGGTGTGGAGAGAGGAAGG + Intergenic
996272619 5:121625193-121625215 ATGCAGACTTAGAGAGAAGAGGG + Intergenic
996882303 5:128313486-128313508 CAGAAGACTGGGAGAGAAGACGG - Intronic
997582616 5:135027270-135027292 CTGGCTCCGAGGAGAGAAGAGGG + Intergenic
997607750 5:135187314-135187336 TAGGAGACGTGGAGAAAAGAGGG + Intronic
998399782 5:141842660-141842682 CCAGAGAAGTAGAGAGAAGAGGG + Intergenic
999054301 5:148557255-148557277 CTGGGGAGATGGAGAGAAGTGGG + Intronic
999322042 5:150621496-150621518 CTGGAGATCAGGAGGGAAGAAGG + Intronic
1000533535 5:162453231-162453253 CTGGAGATCTGGAGGGCAGAGGG - Intergenic
1000681940 5:164196045-164196067 CTGAAGAGGTAGAGAGAAGATGG - Intergenic
1001837316 5:174843235-174843257 GTGGAGACATGGAGAAAAAAAGG + Intergenic
1002459946 5:179368379-179368401 CTGGGGATGTGGACAGAGGAGGG - Intergenic
1002722463 5:181271256-181271278 CTGAAGGCCTGGAGAGAACAAGG - Intergenic
1002899577 6:1399605-1399627 CTGGGGACCTGGAGAGAGAATGG - Intergenic
1002924297 6:1595851-1595873 GTGGAGGCGGGGAGAGAAGAGGG - Intergenic
1003035312 6:2636438-2636460 CTGGAACGGGGGAGAGAAGATGG - Intergenic
1003670266 6:8150870-8150892 CTGGAGACCAGGAGAGCTGATGG + Intergenic
1003679952 6:8243202-8243224 CAGGAGAAGAGGGGAGAAGAGGG - Intergenic
1004828380 6:19449509-19449531 CTGGAGACGTGGCGGGGAGAGGG + Intergenic
1005173010 6:23009821-23009843 CTGGAGACCAGGAGAGCTGATGG - Intergenic
1005286549 6:24333856-24333878 TGGCAGAAGTGGAGAGAAGAGGG + Intronic
1005743890 6:28817960-28817982 GGGGAGACGAGGGGAGAAGAGGG + Intergenic
1005997557 6:30940683-30940705 CTGGGGAAGTGGGGAGCAGATGG - Intergenic
1006373407 6:33658957-33658979 CTGGAGGCGTGGTGACAAGAGGG + Intronic
1006596046 6:35193054-35193076 CTGGAGTCTTGGAGCAAAGAAGG - Intergenic
1006770209 6:36547004-36547026 CTGGAGACGGGGGAAGAAGGGGG + Intronic
1006792762 6:36714541-36714563 CTGGAGACCAGCAGAGAAGGGGG + Intronic
1007821722 6:44565278-44565300 GAGTAGACTTGGAGAGAAGAGGG - Intergenic
1008342758 6:50387682-50387704 CTGTAGACATGGTGAGAGGAGGG - Intergenic
1010951051 6:82037582-82037604 CTGGAGCCTAGGAGAGATGATGG + Intergenic
1013611567 6:111800768-111800790 CTGGAGATGTGGGCAGGAGAGGG - Intronic
1014778513 6:125537435-125537457 CTGGTGCTGTGGAGTGAAGAAGG - Intergenic
1016888309 6:148980318-148980340 CAGCAGCCGTGGAGAGAAGATGG - Intronic
1017009615 6:150054404-150054426 CTGGAGACCTGGTGAGGAGCTGG - Intergenic
1017009642 6:150054608-150054630 CTGGAGACCTGGGGAGGAGCTGG - Intergenic
1017192102 6:151665568-151665590 GTGGAGTGGTGGAGAGAAAAGGG - Intronic
1019033997 6:169039493-169039515 CTGGAGACTTGGAGGGTGGAAGG + Intergenic
1019327600 7:445986-446008 ATGGAGAGATGGAGAAAAGAAGG + Intergenic
1019900989 7:4020498-4020520 CTGGGGAGGTGAAGGGAAGACGG + Intronic
1020167107 7:5816197-5816219 GTGGAGACGTGGAAACAGGATGG + Intergenic
1020414929 7:7934700-7934722 ATTGAAAGGTGGAGAGAAGAAGG - Intronic
1020654394 7:10912171-10912193 CAGTGGAGGTGGAGAGAAGAGGG - Intergenic
1021292856 7:18867143-18867165 GTGGAGACATGCAGGGAAGAAGG + Intronic
1021469910 7:20990259-20990281 ATGGAAACGTGAGGAGAAGAGGG - Intergenic
1023090014 7:36608827-36608849 CTGGACACTTTGAGAGAAGAGGG - Intronic
1023528242 7:41127750-41127772 AAGGAGACTTGGTGAGAAGAAGG - Intergenic
1023591339 7:41783635-41783657 CTGTAGATGTGGAGAGAAGACGG + Intergenic
1025233143 7:57216357-57216379 CTGGAGACCCAGGGAGAAGATGG + Intergenic
1025233469 7:57218319-57218341 CTGGAGACCTGGATAGCAGATGG + Intergenic
1025233801 7:57220166-57220188 CTGGAGACCTGGGGAGAGGCTGG + Intergenic
1025233943 7:57221001-57221023 CTGGAGACCTGGACAGGAGCTGG + Intergenic
1025233977 7:57221215-57221237 CTGGAGACCTGGGGAGGAGCTGG + Intergenic
1025932926 7:66010842-66010864 CTGGAGACAGAGAGAGGAGAAGG + Intergenic
1025950457 7:66141411-66141433 CTGGAGACAGAGAGAGGAGAAGG - Intronic
1027053249 7:75032649-75032671 CTGGAGACCGGGAGTGAAAATGG + Intronic
1027882291 7:83855957-83855979 CTTGAGAACAGGAGAGAAGAGGG + Intergenic
1027890500 7:83967355-83967377 CTGGAGCTGGGGAGAGAAGGGGG - Intronic
1029444377 7:100604383-100604405 CGGGAGGAGGGGAGAGAAGACGG - Intronic
1029493615 7:100885405-100885427 ATGGAGAAGTGGAGGGTAGAGGG + Intronic
1029551891 7:101240907-101240929 CTGGGGAGGGGCAGAGAAGAGGG + Intronic
1030855111 7:114546111-114546133 CTGGAGCCTAGGAGAAAAGAGGG - Intronic
1031362664 7:120865469-120865491 CTAGAGATGGGGAGAGAAGGAGG + Intergenic
1032345331 7:131110846-131110868 CTGAAGATGAGGAGAGAAGCGGG - Intronic
1032545615 7:132739259-132739281 CTGGAGAGGTGGTGGGGAGAGGG - Intergenic
1033028733 7:137804087-137804109 CTGGAGATGTGAAGAGAGAATGG - Intronic
1033346264 7:140527496-140527518 CTGCAGCCGGGGAGAGAACAGGG + Intronic
1033854192 7:145536916-145536938 CTGGAGACTGGGAGAGGAGATGG + Intergenic
1034459613 7:151191280-151191302 CTGCAGGTGTGGAGGGAAGAGGG - Intronic
1034560328 7:151876086-151876108 CTGGAGACGGAGAGAGGGGAGGG - Intronic
1035017711 7:155781182-155781204 ATTGAGACATGGAGAGATGACGG + Exonic
1036751359 8:11445451-11445473 CTGCAGCTGTGGAGGGAAGAAGG + Intronic
1036932916 8:12973608-12973630 CTGGAGAGGTGAAGAGATGGCGG + Intronic
1038524494 8:28261424-28261446 GTGAAGACATGGAGAGAAGACGG + Intergenic
1038791730 8:30674040-30674062 CTGGAGACCAGGAGAGACGGTGG - Intergenic
1039588094 8:38723712-38723734 CTGGGGGCGTGGGGAGCAGAGGG - Intergenic
1041750946 8:61260514-61260536 ATGGAGAGGTGGAGAGGAGATGG - Intronic
1041981397 8:63865143-63865165 CTTGAAAGGTGGAGACAAGAAGG - Intergenic
1042193192 8:66208739-66208761 CTGGATTCATGGAGAGAGGAGGG + Intergenic
1042482701 8:69322270-69322292 CTGGAGACTTGGGGAGGAGCTGG + Intergenic
1042482712 8:69322370-69322392 CTGGAGACCTAGAGAAAAGCTGG + Intergenic
1042482790 8:69322958-69322980 CTGGAGACCTGGGGAGGAGTGGG + Intergenic
1042482840 8:69323397-69323419 CTGGAGACCTGGGGAGGAGCAGG + Intergenic
1042483218 8:69325901-69325923 CTGGAGACCTGGGGAGGAGCTGG + Intergenic
1042895973 8:73668159-73668181 CTGTAGACTTGTAGTGAAGAAGG - Intronic
1043339011 8:79214773-79214795 CTATATACATGGAGAGAAGATGG - Intergenic
1043821193 8:84867132-84867154 GTGAAGACATGGGGAGAAGATGG - Intronic
1044145029 8:88702145-88702167 CTGGAAATGTGGACAGGAGAGGG + Intergenic
1046023092 8:108689868-108689890 CTGGAGAAATGGAGAGGAGGGGG - Intronic
1046942752 8:119946899-119946921 CTGGAGAGGGTGAGGGAAGAAGG - Intronic
1047263302 8:123281532-123281554 GTGGAGACGCAGGGAGAAGATGG - Intergenic
1047343965 8:124009533-124009555 CTGGAGACCCAGGGAGAAGATGG + Intronic
1047605245 8:126467991-126468013 CTGGAGACATTGAGAGATCAAGG - Intergenic
1047983941 8:130213596-130213618 CAAGAGACTGGGAGAGAAGAGGG + Intronic
1048582788 8:135744146-135744168 CTGGTAACGTGGAGACAATAAGG - Intergenic
1048872950 8:138813796-138813818 CTGGTGACCTGGAGAGAGGATGG - Intronic
1049025146 8:139983370-139983392 CTGGAGAGGTGATGAGAATATGG - Intronic
1049124745 8:140776632-140776654 GTGGAGAAGGGGAGAGAAGCAGG + Intronic
1049272879 8:141705415-141705437 ATGGAGAGATGGAGAGATGATGG + Intergenic
1049750017 8:144278601-144278623 CTGGAGACGTGGACAGCAGGAGG + Intronic
1049778341 8:144416375-144416397 CTGGGGTCCTGGGGAGAAGAGGG + Intronic
1050254143 9:3776637-3776659 CTGGAGATATGGTGAGATGAAGG - Intergenic
1050683857 9:8145347-8145369 GTGGAGATGCAGAGAGAAGAGGG + Intergenic
1050831083 9:10014321-10014343 ATGGAGAAGTGGAAAGAATATGG - Intronic
1051944227 9:22547064-22547086 GTGAAGATGTGGAGAGGAGATGG - Intergenic
1052508589 9:29384905-29384927 CTGGAGAGGTGGAGAGGATGTGG + Intergenic
1052993188 9:34534349-34534371 CTGGCAAGGTGGGGAGAAGAAGG + Intergenic
1053052684 9:34975028-34975050 CTGGAGGTGTGGAGAGCAGTTGG - Intronic
1056507592 9:87271614-87271636 CTGAAGACACGGAGTGAAGAAGG - Intergenic
1057268843 9:93635919-93635941 CTGGGGAGGTGGGGAGGAGACGG + Intronic
1057575691 9:96240602-96240624 GTGGCGAGGTGGAGAGAAGCCGG - Intronic
1057761411 9:97877655-97877677 CTGGAGAAGAAGAAAGAAGATGG + Intergenic
1058040533 9:100296970-100296992 CTGGAGATGTGGACAGATGGAGG + Exonic
1058503151 9:105642959-105642981 GTAGAGACATAGAGAGAAGATGG + Intergenic
1059153897 9:111973124-111973146 CTGAAAACTTGGAGAGATGAAGG - Intergenic
1059971373 9:119672325-119672347 CAGGAGAGGAGGAGAGGAGAAGG - Intergenic
1061271281 9:129544840-129544862 CTGGGGAGGTGGAGAGTAGGAGG - Intergenic
1061319393 9:129818583-129818605 CTGGAGGAGTGGAAAGCAGAGGG - Exonic
1061644250 9:131987336-131987358 CTGTAGATGTGGAGATGAGAAGG + Intronic
1062430121 9:136523189-136523211 CTGGAGACAAGGGGACAAGAGGG + Intronic
1062486247 9:136777782-136777804 CTGGAGACCTGGGGAGAGGCTGG - Intergenic
1062486265 9:136777885-136777907 CTGGAGACCTGGGGAGAAGCTGG - Intergenic
1062486288 9:136778035-136778057 CTGGAGACTTGGAGAGGAGCTGG - Intergenic
1062486314 9:136778188-136778210 CTGGAGACCAGGGGAGAAGCTGG - Intergenic
1062486349 9:136778387-136778409 CTGGAGACCTGGGGAGGAGATGG - Intergenic
1062586732 9:137252968-137252990 AAGGAGGCCTGGAGAGAAGAGGG + Intronic
1185550468 X:979902-979924 CTGGAAACGTTTAAAGAAGAGGG + Intergenic
1185783424 X:2868527-2868549 ATGGAGAGGTGGGGAGAATAGGG - Intronic
1186503219 X:10068703-10068725 CTGCAGAGATGGAGATAAGATGG - Intronic
1186733334 X:12433903-12433925 CTTTATAGGTGGAGAGAAGAAGG + Intronic
1186733370 X:12434344-12434366 CTTTATAGGTGGAGAGAAGAAGG - Intronic
1187433577 X:19246943-19246965 CTGTAGCCCTGGAGTGAAGAGGG - Intergenic
1187604177 X:20865112-20865134 CAGGAGACGAGGAAAGAACATGG + Intergenic
1187984522 X:24796063-24796085 CTGGAGAGGAGGAGAGAGGTGGG - Intronic
1188060611 X:25596417-25596439 GTGGAGTCATGGAGAGAAGCTGG + Intergenic
1188845503 X:35066999-35067021 ATGAGGACGTGGAGAAAAGAGGG - Intergenic
1189350667 X:40273342-40273364 TTGGAGACCTGGGGAGAAGTTGG - Intergenic
1190912849 X:54788447-54788469 CTGGGGAAGAGGAGAGAGGATGG - Intronic
1190918105 X:54824923-54824945 CTGGGGAAGAGGAGAGAGGATGG + Intergenic
1191602075 X:63019029-63019051 CTTGACAAGTTGAGAGAAGAAGG + Intergenic
1191647088 X:63493248-63493270 TTTGACAAGTGGAGAGAAGAAGG + Intergenic
1191671801 X:63755106-63755128 CGGGGGATGGGGAGAGAAGAGGG - Exonic
1191681026 X:63839788-63839810 TTGGACAAGTTGAGAGAAGAAGG + Intergenic
1192389924 X:70715775-70715797 TTTGACAAGTGGAGAGAAGAAGG - Intronic
1192806456 X:74514111-74514133 ATTGAAAAGTGGAGAGAAGAAGG + Intronic
1192990463 X:76448803-76448825 CTGGACACGTGGCCAGAAGTGGG + Intergenic
1193102660 X:77633314-77633336 CTGCAGAGGTGGCAAGAAGATGG - Exonic
1193960464 X:87918933-87918955 CTGGAGACGTTTCGAGAAAAAGG + Intergenic
1193969339 X:88032503-88032525 CTGGTGAGGTGCAGAGAAAAGGG + Intergenic
1194511907 X:94807095-94807117 CTGGAAAGGTGCAGAGAAGAAGG - Intergenic
1194629342 X:96264502-96264524 GTGAAGACATGGTGAGAAGATGG - Intergenic
1195253860 X:103074951-103074973 CTGCAGTCGTTGAGATAAGATGG - Intergenic
1195329198 X:103782947-103782969 CTGGGGATGGGGGGAGAAGAAGG - Intronic
1195750535 X:108159046-108159068 CTGGGAGGGTGGAGAGAAGAGGG + Intronic
1196669368 X:118349295-118349317 CTGGAGAGGTGGTGAGATCATGG + Intronic
1198187408 X:134266951-134266973 CAGGAGAAGGGGAGAGAAGTGGG + Intergenic
1198405061 X:136304127-136304149 CTGTAGATATGGAGAGCAGATGG + Exonic
1199074024 X:143510038-143510060 CTGGAGAAGATGAGAGAATAGGG - Intronic
1199623363 X:149718331-149718353 CTGGAGATGAGGAAAGAACATGG + Intergenic
1200689580 Y:6293743-6293765 TTTGACAAGTGGAGAGAAGAAGG - Intergenic
1201045692 Y:9880977-9880999 TTTGACAAGTGGAGAGAAGAAGG + Intergenic
1201075618 Y:10185180-10185202 TGGGAGAAGGGGAGAGAAGAGGG - Intergenic
1202039169 Y:20664815-20664837 CTGGAGAAGTAAAGAGAATAAGG - Intergenic