ID: 1169276319

View in Genome Browser
Species Human (GRCh38)
Location 20:4235820-4235842
Sequence CAGGGTGCACGGTGGGGCTG GGG
Strand +
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 616
Summary {0: 1, 1: 0, 2: 2, 3: 66, 4: 547}

Found 5 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1169276306_1169276319 17 Left 1169276306 20:4235780-4235802 CCACTTGCAAAGTGAGGGAAGTC No data
Right 1169276319 20:4235820-4235842 CAGGGTGCACGGTGGGGCTGGGG 0: 1
1: 0
2: 2
3: 66
4: 547
1169276303_1169276319 26 Left 1169276303 20:4235771-4235793 CCTAGGTGACCACTTGCAAAGTG 0: 1
1: 0
2: 0
3: 8
4: 127
Right 1169276319 20:4235820-4235842 CAGGGTGCACGGTGGGGCTGGGG 0: 1
1: 0
2: 2
3: 66
4: 547
1169276308_1169276319 -5 Left 1169276308 20:4235802-4235824 CCTACCCTCCAGCGTGCTCAGGG 0: 1
1: 0
2: 1
3: 17
4: 177
Right 1169276319 20:4235820-4235842 CAGGGTGCACGGTGGGGCTGGGG 0: 1
1: 0
2: 2
3: 66
4: 547
1169276310_1169276319 -9 Left 1169276310 20:4235806-4235828 CCCTCCAGCGTGCTCAGGGTGCA 0: 1
1: 0
2: 1
3: 10
4: 129
Right 1169276319 20:4235820-4235842 CAGGGTGCACGGTGGGGCTGGGG 0: 1
1: 0
2: 2
3: 66
4: 547
1169276311_1169276319 -10 Left 1169276311 20:4235807-4235829 CCTCCAGCGTGCTCAGGGTGCAC 0: 1
1: 0
2: 1
3: 6
4: 137
Right 1169276319 20:4235820-4235842 CAGGGTGCACGGTGGGGCTGGGG 0: 1
1: 0
2: 2
3: 66
4: 547

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1169276319 Original CRISPR CAGGGTGCACGGTGGGGCTG GGG Intronic
900112248 1:1013264-1013286 CAGGGTGTTGGGTGGGGGTGGGG + Intergenic
900204417 1:1425993-1426015 CAGGGTCCACGGTCTGGCTGGGG + Intergenic
900361873 1:2293038-2293060 CAGGGTGCACGGGAGAGCAGGGG + Intronic
900378822 1:2373658-2373680 CAGGGTGCACTGTGTGCGTGCGG + Intronic
900489264 1:2938773-2938795 CAGGGCTCACGGTGAGGCTGAGG - Intergenic
900555540 1:3278584-3278606 CAGGGTGCCGGGTGCGGCTGAGG - Intronic
900792905 1:4691474-4691496 CTGGGTACACAGTGGGGCTCGGG + Intronic
901416160 1:9118320-9118342 GGGGGTGCAAGGTGGGGATGTGG + Intronic
901512501 1:9724493-9724515 CAGGGTGCAGGATGGGGCTCAGG + Intronic
901565299 1:10109196-10109218 CAGGGGGAACGGGGGGGCCGGGG + Intronic
901677744 1:10896899-10896921 CTGGGTACCCAGTGGGGCTGGGG + Intergenic
902082391 1:13829896-13829918 AAGGGTGCAGGGTGAGGCTGGGG - Intergenic
902131338 1:14263636-14263658 GCGGGGGCAGGGTGGGGCTGGGG + Intergenic
902859206 1:19232639-19232661 CAGGGTGCACTGTGGGGGATGGG + Exonic
902864373 1:19268781-19268803 CAGGGTGTGGGGTGGGGCAGTGG - Intergenic
902869608 1:19306227-19306249 CAGGGTGTGGGGTGGGGCAGTGG - Intronic
903227322 1:21901343-21901365 GAGGGTGCATGGTAGGGGTGAGG + Intronic
903365235 1:22801948-22801970 GAGCGTGCTCGGAGGGGCTGAGG - Intronic
903451598 1:23457232-23457254 CTGGGGTCAGGGTGGGGCTGTGG - Intronic
903788246 1:25875411-25875433 CACGGGGCGCGGCGGGGCTGCGG - Intergenic
903804808 1:25997758-25997780 TGGGGTCCAAGGTGGGGCTGCGG + Intronic
903853572 1:26322258-26322280 CAGGCTCCAAGGTGGTGCTGTGG - Exonic
903869891 1:26426422-26426444 CCGGGAGCAGGGTAGGGCTGTGG - Exonic
903999907 1:27332992-27333014 CAGAGTGCCCGGTGGGTCTCAGG - Intronic
904211110 1:28887410-28887432 CAGGGTGCAGGGAGGGGCGTGGG + Intronic
904356615 1:29944423-29944445 TAGGGTACACAGTGAGGCTGGGG - Intergenic
904617375 1:31757189-31757211 CAGGTTGGATGGTGAGGCTGGGG - Exonic
905653491 1:39671770-39671792 CAGGGCGCATTCTGGGGCTGAGG + Intronic
905830811 1:41065923-41065945 CAGGGTGCAAGGTTCTGCTGGGG - Intronic
905867784 1:41385653-41385675 CTGGCTGTAGGGTGGGGCTGGGG - Intergenic
905974294 1:42164018-42164040 CAGGCTGCAGGCTGGAGCTGGGG - Intronic
906071909 1:43023013-43023035 CAGAGAGCAAGGTGGGGATGGGG + Intergenic
906072194 1:43025149-43025171 CAGGGTCCACGGTGATGCTGTGG + Intergenic
906076910 1:43058626-43058648 CAGGGGCCGCGCTGGGGCTGGGG + Intergenic
906148767 1:43575654-43575676 GAGGGGGCTCAGTGGGGCTGGGG - Intronic
906201925 1:43966025-43966047 CTGGGTGAAAGATGGGGCTGAGG + Intronic
906514772 1:46432391-46432413 CAGGGTGGCAGGAGGGGCTGGGG + Intergenic
906526256 1:46494880-46494902 CAGGGTTAACGGTGGCGATGTGG + Intergenic
906566810 1:46806733-46806755 GAGGGTGGGAGGTGGGGCTGGGG + Intronic
906832409 1:49047120-49047142 CAGGGTGGGAGGTGTGGCTGTGG + Intronic
907245073 1:53103281-53103303 CAGGCTGCTGGGAGGGGCTGGGG + Intronic
909203685 1:72725772-72725794 CAGGGTGCTAGCGGGGGCTGGGG - Intergenic
909358210 1:74732611-74732633 GGGGGTGCAGCGTGGGGCTGGGG + Intronic
913246539 1:116875142-116875164 CAGGGCGCGCGATGGGGATGTGG + Intergenic
913453219 1:119006967-119006989 CTCGGAGCAAGGTGGGGCTGCGG + Intergenic
914730354 1:150364494-150364516 CACGCTGCAAGGAGGGGCTGCGG - Intronic
914848130 1:151294006-151294028 CATGCAGCAAGGTGGGGCTGGGG - Exonic
915298981 1:154941445-154941467 CAGGTTGCAGGGTAGGGGTGTGG - Intergenic
915558127 1:156671079-156671101 CAGTGTGAAGGGAGGGGCTGAGG - Exonic
916787033 1:168093823-168093845 CAGGGTGAGCGGCTGGGCTGGGG + Intronic
917035708 1:170744941-170744963 TTTGGTGCACGATGGGGCTGGGG + Intergenic
917554314 1:176067964-176067986 CAGGGTGTGCGATGGGGGTGTGG - Intronic
919923366 1:202179124-202179146 CAGGGTGGGCAGTGGGGCCGAGG - Intergenic
920315508 1:205073448-205073470 CAGGGTGCAGGGGGAGGCTGAGG + Intronic
920321065 1:205123008-205123030 CAGGGTGCACTGTGTGAATGAGG - Intergenic
920833794 1:209488852-209488874 CAGGGTTCCCTGTAGGGCTGAGG - Intergenic
921939771 1:220827683-220827705 CAGGGGGCACAGAGGGGCTGGGG + Intergenic
921946089 1:220887082-220887104 CAGGGGGCACGGCAGAGCTGGGG + Intergenic
922219065 1:223544006-223544028 CAAGGTGCAAGGTGGGGCAGGGG - Intronic
922613063 1:226944159-226944181 CAGGGAACACTGTGGGGCAGGGG + Intronic
922802956 1:228372377-228372399 CAGGGGGCATGCTGGGGCAGGGG + Exonic
923622107 1:235587730-235587752 CAGGGTTCAGGGTGGGGGTGAGG + Intronic
924606605 1:245540886-245540908 CAGCAGGCAGGGTGGGGCTGGGG - Exonic
1062795060 10:338871-338893 CAGGGTGCAGGGTGCAGGTGGGG - Intronic
1063334695 10:5200078-5200100 CAGGGTGTGCAGTGGGGGTGTGG - Intronic
1063375917 10:5554075-5554097 CAGGGTGCACCGAGGATCTGTGG - Intergenic
1063964915 10:11339379-11339401 CAGTGAGCATGCTGGGGCTGGGG + Intergenic
1067078987 10:43203195-43203217 CGGGGTTCACGGTAGAGCTGGGG - Intronic
1067185382 10:44022716-44022738 CTTGGGGCAAGGTGGGGCTGGGG + Intergenic
1067321367 10:45224212-45224234 CCGGGTGCAGGGAGGGGATGGGG + Intergenic
1067419564 10:46134284-46134306 CACGGGGCACAGTGAGGCTGTGG - Intergenic
1067426455 10:46215127-46215149 CACGGGGCACAGTGAGGCTGTGG + Intergenic
1067504915 10:46840881-46840903 CACGGGGCACAGTGAGGCTGTGG - Intergenic
1067727044 10:48778354-48778376 CAGTGTGCTCTGTGGGGCAGAGG - Intronic
1069908053 10:71743627-71743649 CACTGGGCAGGGTGGGGCTGGGG + Intronic
1069956306 10:72053964-72053986 CAGGGAGGAGGCTGGGGCTGCGG + Intergenic
1070752385 10:78971987-78972009 CAGGGTTCAAGGCAGGGCTGGGG + Intergenic
1070961871 10:80505196-80505218 CAGGGTGCCCTGTGGGGCAGGGG + Intronic
1071352770 10:84763232-84763254 CTGGGAGCTCAGTGGGGCTGAGG + Intergenic
1071353159 10:84767076-84767098 CAGGGTGTGCGATGGGGATGTGG + Intergenic
1071486907 10:86108221-86108243 CAGGGTGTGCGATGGGGGTGTGG - Intronic
1071562100 10:86652662-86652684 CTGGGGGCAGGGTGAGGCTGAGG - Intergenic
1072417658 10:95262593-95262615 AAGGGTGCTGGGTGGGGGTGGGG - Intronic
1073306042 10:102504179-102504201 CCGGGGGCGCGGTGGGGCCGGGG - Exonic
1074814591 10:117134697-117134719 CCGGCTGCTGGGTGGGGCTGCGG - Intronic
1075067973 10:119302519-119302541 TAGGGTGGAGGATGGGGCTGGGG + Intronic
1075776603 10:124993143-124993165 CCGGCTGCACTGTGGAGCTGAGG + Intronic
1076208481 10:128622464-128622486 CAGGGTTCAGGGGGAGGCTGAGG - Intergenic
1076348044 10:129794170-129794192 CTGGGTGCACAGCGCGGCTGCGG - Intergenic
1076402058 10:130190846-130190868 CGGGGTGCACGGTTGTGCGGGGG + Intergenic
1076408583 10:130230411-130230433 CACTGAGCAGGGTGGGGCTGGGG - Intergenic
1076741790 10:132489258-132489280 CTGCCTGGACGGTGGGGCTGGGG - Intergenic
1076753626 10:132556295-132556317 CAGTGTCCACTGTGGGTCTGTGG - Intronic
1076825769 10:132967160-132967182 CAGGGTGTGCGATGGGGGTGTGG + Intergenic
1077101944 11:826274-826296 CAGGGGCCAGGCTGGGGCTGGGG + Intronic
1077113106 11:870543-870565 GGGGGTACAGGGTGGGGCTGTGG - Intronic
1077323236 11:1951823-1951845 CAGGGAGCCATGTGGGGCTGTGG + Intronic
1077492852 11:2870118-2870140 CAGGAGGGACGGTGGTGCTGGGG - Intergenic
1078051784 11:7971737-7971759 CAGGCTGGAGGGTGGTGCTGTGG + Intronic
1080142651 11:28941443-28941465 CAAGGTGCCAGCTGGGGCTGTGG - Intergenic
1083107705 11:60374298-60374320 CAGGGTGCGTGATGGGGGTGTGG - Intronic
1083276054 11:61597741-61597763 CAGCCTTCATGGTGGGGCTGAGG - Intergenic
1083393308 11:62371364-62371386 CAAGGTGGGCGGTGCGGCTGTGG + Intronic
1083464243 11:62834594-62834616 CAGTGTGCAGGGAGGGGGTGAGG - Intronic
1083994735 11:66266353-66266375 CAGGGAGAAGGGTGGGGCTGGGG - Intronic
1084115900 11:67042863-67042885 CATGGTGGCCGGTGGCGCTGGGG + Intronic
1084209990 11:67616393-67616415 CAGGGTTGAGGGAGGGGCTGGGG + Intergenic
1084214654 11:67640766-67640788 GAGGGGGCATGGAGGGGCTGGGG + Intergenic
1084705074 11:70811366-70811388 GAGGATGCACAGTGGGGCCGTGG - Intronic
1085121290 11:73969212-73969234 CAGGGCCAAAGGTGGGGCTGAGG - Intronic
1085272032 11:75275775-75275797 CAGGAAGCGCTGTGGGGCTGGGG - Intronic
1085690415 11:78659694-78659716 AAGGAAGCACGGTGGGGCAGAGG - Intronic
1086079453 11:82888345-82888367 CAGGTTGCCCTGTGGTGCTGCGG - Intronic
1087286061 11:96266173-96266195 CAGGGTGTACGATGGGGAAGTGG - Intronic
1088343728 11:108798742-108798764 CAGGTTGCAGGGTGGGGTAGGGG + Intronic
1088884017 11:113993140-113993162 CAGGGTGCACAGTGTGGCCCGGG - Intergenic
1090628674 11:128627510-128627532 CAGGGTGGGCGGTGGGGCAGCGG - Intergenic
1090974913 11:131672367-131672389 CAGTGTCCTCGGTGGGGGTGCGG - Intronic
1202806222 11_KI270721v1_random:7018-7040 CAGGGAGCCATGTGGGGCTGTGG + Intergenic
1091392851 12:136434-136456 CAGAGGGCACGGCTGGGCTGTGG + Intronic
1091396116 12:155150-155172 AAGGGTGCAGGGTGGAGGTGAGG + Intronic
1091697160 12:2635525-2635547 AAGGGTGCATGGAGGAGCTGGGG - Intronic
1091779180 12:3203144-3203166 CAGGTGGCAGGGTGGGGGTGGGG - Intronic
1091785582 12:3241740-3241762 CAGTGTGCCCAGTGGGGCTGGGG + Intronic
1092170591 12:6371545-6371567 GAGGGTGGACGGTGGGGGTGGGG + Intronic
1094474818 12:30833052-30833074 CAGGGTGCACAGAGGAGGTGGGG - Intergenic
1095641850 12:44494839-44494861 CAGGGTGCGTGATGGGGGTGTGG + Intergenic
1097393548 12:59045250-59045272 CAGGAATCACGGTGGGGATGAGG - Intergenic
1097430632 12:59501111-59501133 TAGGGTGAAGGGTGGGGCAGAGG - Intergenic
1101432227 12:104636132-104636154 CAGGTTACACAGTAGGGCTGTGG + Intronic
1103363807 12:120368739-120368761 CAGGGCGCAGGGCCGGGCTGGGG + Intronic
1103522456 12:121545612-121545634 CAGGGAGAGCGGAGGGGCTGAGG - Intronic
1103576040 12:121877979-121878001 CAGTCTGCACTGTGGGTCTGTGG - Intergenic
1104038794 12:125116122-125116144 AAGGGTCCATGGTGGGGGTGGGG - Intronic
1104056871 12:125237251-125237273 CAGGGGGCACCAAGGGGCTGTGG + Intronic
1104478840 12:129090101-129090123 CAGGGTGATCGATGGCGCTGAGG + Intronic
1104875212 12:132029222-132029244 CAGGTTGCAAGGTGGGCCTTAGG + Intronic
1104971005 12:132530708-132530730 CGGGGTGGGGGGTGGGGCTGGGG + Intronic
1104989992 12:132619593-132619615 TAGGGTGCACGGCGGGGCGGGGG - Intronic
1105351421 13:19619684-19619706 CAGAGTGCAGGGTGGTGGTGGGG - Intergenic
1106116336 13:26820936-26820958 CAGGATCCACGGAGGTGCTGTGG + Intergenic
1106618626 13:31353151-31353173 CAGGGTGCACGATGCGGGTGTGG - Intergenic
1106735806 13:32586808-32586830 CCGGCTGCGCGGTGGGGGTGGGG + Intronic
1107372754 13:39770545-39770567 CAGGGGGCAGGGTGAGGCAGTGG - Intronic
1107634756 13:42381001-42381023 CAGGGTGCACAGAGGGGAGGGGG + Intergenic
1110733097 13:78904164-78904186 CAAGGTACAAGGTGGGGCTCAGG - Intergenic
1111237762 13:85431224-85431246 GAGAGGCCACGGTGGGGCTGAGG + Intergenic
1112494847 13:99896382-99896404 CAGGGTGCGCGGGGGTACTGGGG - Exonic
1113424388 13:110195973-110195995 CAGGGTGTGGAGTGGGGCTGTGG + Intronic
1113513344 13:110872775-110872797 CAGGGCTCAGGGAGGGGCTGCGG - Intergenic
1113758767 13:112833112-112833134 GAGGGCACAGGGTGGGGCTGAGG - Intronic
1113892474 13:113743670-113743692 CAGTGTCCACTGTGGGGCTCAGG - Intergenic
1114447010 14:22796387-22796409 CAGGGTGCTGGTGGGGGCTGAGG - Intronic
1114736679 14:25049866-25049888 CAGGCTGCACGGTAGGACCGGGG - Exonic
1115979080 14:39029921-39029943 CAGGGTGTACGATGGGGGTGTGG + Intergenic
1116467723 14:45253122-45253144 CAGGATACACCGTGGGCCTGAGG - Exonic
1116961515 14:50972904-50972926 CAGGGGGCAAGGTGAGCCTGGGG + Intergenic
1117524241 14:56581023-56581045 CATGGTGTGCGATGGGGCTGCGG + Intronic
1121448526 14:93993539-93993561 CAGGATGCAGAGTGGGGCTGCGG - Intergenic
1122056069 14:99099239-99099261 TGGGGTGCAGGGTGGGGCCGTGG - Intergenic
1122113558 14:99517026-99517048 CTGGGTGCACTGTGAGACTGTGG - Intronic
1122232706 14:100314825-100314847 CAGTGAGCCCGGTGGGGCAGTGG - Intergenic
1122296574 14:100709386-100709408 CAGGGAGGAGGGTTGGGCTGGGG - Intergenic
1122371966 14:101233946-101233968 CAGGGTGTGTGGTGGGGCTCTGG - Intergenic
1122372129 14:101234643-101234665 CACGCCGCACAGTGGGGCTGCGG + Intergenic
1122523545 14:102363414-102363436 CGGGATGCAGGGTGGGGCCGGGG - Intronic
1122824728 14:104364109-104364131 CAGACTGCCGGGTGGGGCTGGGG + Intergenic
1122886398 14:104712327-104712349 CAGGGTGCACAGTGGGGTGCCGG + Intronic
1122959136 14:105086669-105086691 CAGGGTGCAGGGTGAGGCACAGG + Intergenic
1124255662 15:28140300-28140322 CATGGTGCAGGCTGGGGTTGCGG - Intronic
1124396138 15:29303636-29303658 CAGGGTGGAGGGTGGGGGAGGGG - Intronic
1124612026 15:31215592-31215614 CAGGGGGCAGGGCGGGGCGGCGG + Intergenic
1126840826 15:52715712-52715734 CTGGGTTGTCGGTGGGGCTGGGG + Intergenic
1127958242 15:63871512-63871534 CAGTGGGCAGGGTGGGGCTGGGG + Intergenic
1128145684 15:65331291-65331313 CAGGGTGCCCGGGGGGACAGCGG + Intronic
1128517075 15:68349064-68349086 CAGGGTGCTGGGGAGGGCTGAGG - Intronic
1129221394 15:74133731-74133753 CAGGAAGCGCGGTGTGGCTGGGG - Exonic
1129227565 15:74178971-74178993 CTGGGTCCACTGAGGGGCTGGGG - Intergenic
1129389966 15:75215538-75215560 CAGATGGCAGGGTGGGGCTGGGG - Intergenic
1129686178 15:77687319-77687341 CAGGGTTTAGTGTGGGGCTGGGG + Intronic
1129780455 15:78266662-78266684 TAGGATGCACGTTGGGCCTGTGG - Intronic
1129878245 15:78990954-78990976 GAGAGTGCCAGGTGGGGCTGAGG + Intronic
1130114626 15:80996039-80996061 GAGGGTGGAAAGTGGGGCTGGGG + Intergenic
1130672706 15:85926738-85926760 CATGGTACAAGGAGGGGCTGAGG - Intergenic
1130682649 15:86010145-86010167 CAGGGTGTGCAGTGGGGGTGTGG + Intergenic
1130987168 15:88852091-88852113 CAGTGTGCCTGGTGGGGCGGGGG + Intronic
1132051234 15:98609419-98609441 CAGTGTGAACGCTGGGGCTCAGG - Intergenic
1132350558 15:101137213-101137235 CAGGCAACACGGTGGGACTGAGG + Intergenic
1132405749 15:101541143-101541165 CAGGGTGCATGGTGGGCGTGGGG - Intergenic
1132554766 16:567636-567658 CCGGGTGCCCGCAGGGGCTGTGG + Exonic
1132557310 16:578345-578367 CAGGGGCCACGCTGGGGCGGGGG - Intronic
1132584949 16:702038-702060 TAGGGAGCACGGTGGGGCCTGGG + Intronic
1132676660 16:1123871-1123893 CAGGCTGGACTGTGGGGCTGGGG + Intergenic
1132694328 16:1195226-1195248 CGGGGCGCGAGGTGGGGCTGGGG + Intronic
1132843458 16:1989753-1989775 CCGGGGGCAGGGTGGGGCTCGGG - Intronic
1132872485 16:2122041-2122063 CAGGCTGCCCGGTGGGGCCCGGG + Intronic
1132890215 16:2200033-2200055 CAGGAGACAGGGTGGGGCTGAGG - Intergenic
1132903956 16:2272627-2272649 CAGGGCGCACTGTGGGGCACAGG - Intergenic
1132938457 16:2494500-2494522 CAGGGTGCAGGGTGGTGTTTAGG + Intronic
1133126074 16:3646829-3646851 CAGGGTGCATGGTGCGGGCGGGG + Intronic
1133671555 16:8026917-8026939 CAGGGGTCAGGGTGGGGCGGGGG - Intergenic
1134630149 16:15750399-15750421 CAGGTTGGTGGGTGGGGCTGGGG - Intronic
1134829003 16:17308248-17308270 CAGGGTCCAGGGTGGAGCTCAGG - Intronic
1134860906 16:17559662-17559684 CAGGGATCACTGTTGGGCTGGGG - Intergenic
1136419325 16:30122481-30122503 CAGAGCACACGGTGGGGCCGGGG + Intronic
1136517811 16:30778333-30778355 CTGGGTGAAGGGTGGGCCTGGGG + Intergenic
1136541270 16:30928665-30928687 CAGGGTGAAGGGTGGGGCAAGGG - Intronic
1137589166 16:49682936-49682958 ACGGGTGCCCGGTGGGGTTGCGG - Intronic
1137715558 16:50596159-50596181 CTGGGTGCACTGTGTGGCTGTGG + Intronic
1139505444 16:67396128-67396150 CCTGGTGCTCAGTGGGGCTGCGG - Intronic
1139782592 16:69364254-69364276 CAGGGAGCAGGGAGGGGCAGTGG - Intronic
1141075947 16:81006860-81006882 CCGGGAGCACGGTGGAGCGGTGG - Exonic
1141297326 16:82782220-82782242 CAGGATTCAGGGTGGGCCTGTGG + Intronic
1141489106 16:84359869-84359891 CAGAGTGCACAGGGGGTCTGGGG - Intergenic
1141644308 16:85359067-85359089 CAGGGTGCAGGCTGGGGCCAGGG + Intronic
1141684253 16:85561487-85561509 CAGAGTTCAGTGTGGGGCTGGGG - Intergenic
1141819057 16:86432518-86432540 CAGGGTGCACGGTGTGGCGGAGG - Intergenic
1142154808 16:88528108-88528130 CAGGGTGGCCGGGGGTGCTGTGG - Exonic
1142492101 17:285986-286008 CGGGGTGCACAGTGGGGCCTGGG - Intronic
1142735546 17:1896517-1896539 CAGGGAGTGGGGTGGGGCTGGGG + Intronic
1143189710 17:5032751-5032773 CAGGGGACAGGTTGGGGCTGTGG - Exonic
1143632010 17:8144913-8144935 CAGGGGCTACTGTGGGGCTGGGG + Exonic
1143751588 17:9032139-9032161 CGGGGTGCAGGGAGGGGCCGAGG + Intronic
1144512153 17:15886533-15886555 CAAGGAGCAGGGTGGGGCTTAGG + Intergenic
1144518994 17:15941976-15941998 GAGGGTACCAGGTGGGGCTGGGG + Intergenic
1144574979 17:16423680-16423702 CAAGCTGCACGGTAGGGCAGAGG - Exonic
1144670993 17:17132502-17132524 GAGGGAGCAGGGTGGGGATGGGG + Intronic
1144738728 17:17569354-17569376 CAGGGTGCACTGTGGGAGAGAGG + Intronic
1144891097 17:18494778-18494800 CAGGGTGCAAGGTGAGAGTGAGG - Exonic
1145141126 17:20449540-20449562 CAGGGTGCAAGGTGAGAGTGAGG + Intronic
1146058876 17:29594163-29594185 GAGGGCGCTGGGTGGGGCTGGGG - Intronic
1146667271 17:34713465-34713487 GTGGGTGGAGGGTGGGGCTGTGG - Intergenic
1146908361 17:36632273-36632295 CAGGGTGCAGCTTGGGCCTGAGG + Intergenic
1147317367 17:39627364-39627386 CGGGGTGGGCGGTGGGGCTGGGG - Exonic
1147588510 17:41666625-41666647 CATGGGGCAAGGTGGGGGTGGGG - Intergenic
1147915028 17:43880881-43880903 CAGGCTGCACGGTGAGGGAGGGG + Intronic
1148104622 17:45112725-45112747 CAGGGTGCACAGAGGACCTGAGG - Intronic
1148747360 17:49926159-49926181 CAGGGTGGCCAGTGGGGTTGTGG + Intergenic
1148879342 17:50713802-50713824 CAGGGTCCAGGGTGGCGTTGTGG + Intergenic
1149497782 17:57131204-57131226 CTGGGTGCGGGGTGGGGGTGGGG - Intergenic
1150291920 17:63987284-63987306 GAAGGTGCTCGTTGGGGCTGGGG - Intergenic
1151239917 17:72749714-72749736 CGGTGTGCAGTGTGGGGCTGGGG - Intronic
1151657870 17:75504096-75504118 CGGGGTGCACTGTGGGCCTCGGG - Intronic
1151657886 17:75504138-75504160 CGGGGTGCACCGTGGGCCTCGGG - Intronic
1151657902 17:75504180-75504202 CGGGGTGCACCGTGGGCCTCGGG - Intronic
1151875918 17:76868319-76868341 CAGGGCGCACAGCGGGGCTGCGG + Intergenic
1151890902 17:76949830-76949852 CAGGGCGTACCATGGGGCTGAGG - Exonic
1151977505 17:77490881-77490903 CAGGTTGCACAGAAGGGCTGGGG - Intronic
1152728134 17:81957736-81957758 CAGGGTGCATGGAAGGGGTGTGG - Intronic
1154502059 18:15001969-15001991 GGGGCTGCACGGTGGAGCTGGGG + Intergenic
1156676239 18:39530036-39530058 CAGGGTGTGCGATGGGGGTGTGG - Intergenic
1157564178 18:48668582-48668604 CAAGGGGCATGGTGGAGCTGGGG - Intronic
1157867353 18:51197759-51197781 GAGGGTGGGGGGTGGGGCTGGGG - Intronic
1159152579 18:64538811-64538833 CAGGCAGCAAGGTGGGACTGGGG + Intergenic
1160007076 18:75075522-75075544 GAGGGTTCAGGGAGGGGCTGCGG - Intergenic
1160282195 18:77501572-77501594 CAGGCTGCACAGTGGGGTTTTGG + Intergenic
1160491315 18:79338400-79338422 CTGGGAGCATGGTGGGGATGGGG - Intronic
1160563728 18:79774254-79774276 GAGGGTGCCAGGTGGGGCGGCGG + Intergenic
1160584205 18:79903803-79903825 CAGGGTGGGCAGTGGGGGTGGGG - Exonic
1160736860 19:666965-666987 CAGGGTGGCCGGTGGGGCCTGGG - Intergenic
1160795032 19:941248-941270 GAGTGTGCACGCTGGGGCTGTGG + Intronic
1160806539 19:994640-994662 GAGGGTGCCGAGTGGGGCTGGGG - Intronic
1160856320 19:1219428-1219450 CAGGGGCCAGGGTGGGGCGGGGG + Intronic
1160910998 19:1473786-1473808 CAGGGTGGAAGGTGGGGAGGGGG - Exonic
1160930863 19:1568823-1568845 GGGGGTGCACCGTGGGGCGGGGG - Intergenic
1160953481 19:1678934-1678956 CAGGGGACAGGGTGGAGCTGGGG - Intergenic
1161037852 19:2095584-2095606 CAGGGTGCGGGGTCGAGCTGCGG - Intronic
1161074023 19:2276307-2276329 CAGAGCGCACGGTGGCGCAGTGG - Exonic
1161091317 19:2361251-2361273 TAGGGTGCAGGGTTGGGATGGGG + Intergenic
1161269608 19:3382604-3382626 CATGGTGCAAGGAGGGTCTGAGG + Intronic
1161611961 19:5248064-5248086 CTGGGTGGAGGGTGGGGGTGTGG + Intronic
1161812554 19:6479028-6479050 AATGCTGCACGGCGGGGCTGGGG + Exonic
1161983687 19:7643139-7643161 CAGGGTGCAGGGTGGGGGTTGGG - Intronic
1162105551 19:8367558-8367580 GAGTCTGCACGGTGGGGGTGGGG - Intronic
1162468080 19:10854750-10854772 CAGGGTCTACCGTTGGGCTGGGG + Intronic
1163158526 19:15451817-15451839 CAGGGTGCTTTGAGGGGCTGGGG + Exonic
1163501379 19:17678608-17678630 CTGGGGGCTGGGTGGGGCTGAGG - Intronic
1163617197 19:18336447-18336469 CAGGGTGGGCGATGGGGGTGTGG - Intergenic
1163724113 19:18912924-18912946 CAGAGTAGAGGGTGGGGCTGGGG - Intronic
1164713491 19:30375481-30375503 TAGGGTGCGCGGTGTGGCTGTGG - Intronic
1165792902 19:38502739-38502761 CAGGCTTCAGGGTGGGGCAGGGG + Intronic
1165822649 19:38686372-38686394 CAGGTTTCAGGGTGGGGGTGGGG - Intronic
1165863216 19:38919949-38919971 CCGGCTGCTGGGTGGGGCTGGGG + Intronic
1166102763 19:40580827-40580849 CCGGGTGCATGGTGGGGCTTTGG + Exonic
1166380073 19:42351120-42351142 CAGTCTGCAGGGTGGGGCAGGGG + Intronic
1166468694 19:43058535-43058557 CAGGGTGCACTGTCAGGCTCTGG + Intronic
1166555842 19:43699510-43699532 CAGGGTGCAAGGAGGGGACGTGG - Intergenic
1166567902 19:43776310-43776332 GAGTGTGCAAGGGGGGGCTGGGG + Intronic
1166792855 19:45408291-45408313 TAGGGTGCCCTGGGGGGCTGAGG - Exonic
1166822617 19:45589856-45589878 CACTGTGCTGGGTGGGGCTGGGG - Exonic
1167062448 19:47158077-47158099 GAGAGTGCAGGGTGGGGGTGGGG + Intronic
1167143810 19:47670603-47670625 CAGGGGCCAAGGTGGTGCTGGGG - Intronic
1168327340 19:55545031-55545053 CAGGATGGAGGGTGGGGCAGGGG + Intronic
1168414631 19:56160408-56160430 CAGGGAGAAGGGGGGGGCTGAGG - Exonic
926121101 2:10241498-10241520 CAGGGCTCACAGAGGGGCTGGGG + Intergenic
926335795 2:11861741-11861763 CAGTGTGCAGGGAGAGGCTGTGG + Intergenic
927174545 2:20396342-20396364 CAGTGGGCACGGTGGGGATTTGG - Intergenic
927927609 2:27024661-27024683 CAGGGGGCAAGAAGGGGCTGTGG - Intronic
928101663 2:28440863-28440885 CAGGGTGTGGGGTGGGGATGGGG + Intergenic
928794291 2:34997529-34997551 CAGGGTGCATGGTAGTGGTGTGG + Intergenic
930516059 2:52409609-52409631 CAGGATACACGGTGGGGCGGGGG + Intergenic
931223135 2:60306295-60306317 GAGGGAGGAAGGTGGGGCTGGGG - Intergenic
931665362 2:64606578-64606600 CAGGGAGCAGGGTTGGGGTGGGG - Intergenic
932258111 2:70303994-70304016 GGGGGTGCAAGGTGGGGGTGGGG + Intergenic
932309638 2:70729226-70729248 CATGGTGCATGGTGGGCCTCTGG - Intronic
932427085 2:71644941-71644963 CAGGGTGTGCAGTGGGGGTGTGG + Intronic
932843488 2:75109103-75109125 AAGGCTGCAGGGTGGAGCTGAGG + Intronic
933775192 2:85767441-85767463 GAGGGTGAACGGTGGGGAAGAGG - Intronic
933780068 2:85795141-85795163 CAGGGTGCACCCTGGGTCTCCGG - Intergenic
934067688 2:88354703-88354725 CAGGGTACAGGTTGGGGCTGGGG - Intergenic
934905337 2:98196114-98196136 CAGGGTGCTGGGTGGGGATGGGG + Intronic
935383727 2:102479341-102479363 GAGGGTTCGGGGTGGGGCTGGGG + Intronic
935689070 2:105714184-105714206 CAGGGTGGTAGGTGGGTCTGGGG - Intergenic
935944322 2:108271676-108271698 CAGGGTGCACATGGGGGCTGAGG + Intergenic
936260939 2:110959236-110959258 CATGGTGCAGGGCAGGGCTGTGG - Intronic
936273219 2:111068315-111068337 CTGGGGGTATGGTGGGGCTGAGG + Intronic
936863869 2:117055617-117055639 CAGGGCGCGCGGCGGGGCTGCGG + Intergenic
937123100 2:119454233-119454255 CAGGCGGCAGAGTGGGGCTGGGG + Intronic
937863411 2:126730744-126730766 CATCCTGCACTGTGGGGCTGGGG + Intergenic
938087368 2:128410221-128410243 AAGGGTGGTGGGTGGGGCTGGGG + Intergenic
942302289 2:174573529-174573551 CAGGGTACATGGAGTGGCTGGGG + Intronic
943533292 2:189114683-189114705 CAGGGAGTAGGGTGGGGTTGCGG + Intronic
944525931 2:200619488-200619510 CAGGGTGAAGGCTGTGGCTGAGG - Intronic
944661905 2:201928573-201928595 CAGGGTGCAGGCTGGGCCAGGGG - Intergenic
944939166 2:204604670-204604692 CAGGGTGAGTGGAGGGGCTGAGG + Intronic
948359977 2:237413115-237413137 GAGGATGCAGGGTGGGGCTCGGG - Intronic
948679998 2:239627181-239627203 CAGGGTCCCCGGCGGGGATGTGG + Intergenic
948765389 2:240216672-240216694 CAGGGTGAGGGGTGGGGGTGGGG + Intergenic
948825456 2:240571610-240571632 CAGGCTTCTCAGTGGGGCTGGGG + Intronic
948862539 2:240759772-240759794 CAGGGTGCAAGGATTGGCTGAGG + Intronic
948864620 2:240769016-240769038 AGGGGAGCACGGTGGGGCTCTGG - Intronic
948873112 2:240813468-240813490 GAGGGTGGATGGCGGGGCTGGGG - Intronic
1168886861 20:1266296-1266318 CTGGGTGCTCGCCGGGGCTGGGG - Exonic
1169276319 20:4235820-4235842 CAGGGTGCACGGTGGGGCTGGGG + Intronic
1169663427 20:8006201-8006223 CAGGGTGTGCGTTGGGGGTGTGG - Intronic
1169756974 20:9053057-9053079 CAAGGTCCTCGGTGGGGCAGAGG - Intergenic
1169848477 20:10022793-10022815 CAGTGTGCATGTTGGGGCAGTGG - Intronic
1170546302 20:17437989-17438011 CTGGGAGCACGGTGTGGGTGGGG - Intronic
1170550508 20:17472172-17472194 CAGGGTGCCCAGAGGGGCTGGGG - Intronic
1170894685 20:20402742-20402764 GAGGGTGCACTGTGGGGATGGGG - Intronic
1171032538 20:21690685-21690707 CAGGGTGCACCTTGTTGCTGGGG - Intergenic
1171069615 20:22055475-22055497 CAGGATGCAAGCTGGGGCTAGGG + Intergenic
1171190553 20:23156257-23156279 CAGGGAGCAAGCTGGGGCCGGGG - Intergenic
1173166284 20:40689119-40689141 CGGAGCGCGCGGTGGGGCTGAGG + Exonic
1173842003 20:46163648-46163670 CAGGTTGACAGGTGGGGCTGTGG + Intergenic
1174065617 20:47862784-47862806 CAGAGTGCTGGCTGGGGCTGGGG + Intergenic
1174067141 20:47873697-47873719 GTGGGTGCACCATGGGGCTGTGG + Intergenic
1174083800 20:47990284-47990306 CAGGGAGCATGGTGGGGTTTGGG + Intergenic
1174360245 20:50024331-50024353 AAGGGAGCCTGGTGGGGCTGAGG + Intergenic
1174360745 20:50027672-50027694 CAGGGGGCTGGTTGGGGCTGAGG - Intergenic
1174421898 20:50404701-50404723 CAGGGTACATAGAGGGGCTGTGG - Intergenic
1175252392 20:57617257-57617279 CAGTGTGCACAAAGGGGCTGGGG - Intronic
1175385495 20:58592408-58592430 CAGGGTGGAAGGTGGTGCTGCGG - Intergenic
1175470217 20:59222275-59222297 CAGGGTGCCCGGGCGGGCGGCGG + Intronic
1175730570 20:61351007-61351029 CTGTGTTCACGGTGGTGCTGGGG + Intronic
1175907318 20:62387216-62387238 CGGGGTGCTGGGTGCGGCTGGGG + Intronic
1175976056 20:62711038-62711060 CAGTATGCCCGGTGGGGGTGAGG + Intronic
1176043838 20:63082430-63082452 CAGAGAGCAAGGTGGTGCTGCGG - Intergenic
1176258739 20:64167691-64167713 CAGGGTGCCCGCAGGGGCTGGGG + Intronic
1176383775 21:6127036-6127058 CAGGGTGCACAGTGGGCCCTGGG + Intergenic
1176957813 21:15126440-15126462 CAGGGTCAAAAGTGGGGCTGTGG + Intergenic
1178438734 21:32581631-32581653 CAGGGTGTGCGATGGGGGTGTGG - Intronic
1178534704 21:33402662-33402684 CATGGTGCAGGCTCGGGCTGGGG + Intergenic
1178902049 21:36606025-36606047 CAGGGTGGAGGGTTGGGCTGTGG - Intergenic
1179739695 21:43411202-43411224 CAGGGTGCACAGTGGGCCCTGGG - Intergenic
1179803954 21:43825745-43825767 GAGGCTGCAGGCTGGGGCTGAGG - Intergenic
1179910296 21:44443943-44443965 CAGGGGGCACGGTGGTGATGGGG - Intergenic
1179918109 21:44491058-44491080 CAGGGTGTGCGATGGGGGTGTGG - Intergenic
1179982282 21:44901737-44901759 CAGGGCACATGGAGGGGCTGGGG + Intronic
1180034127 21:45234513-45234535 CCGGGCGCAGGGAGGGGCTGGGG + Intergenic
1180046138 21:45306634-45306656 GAGGGTGCCCGGTGGGGGTCTGG - Intergenic
1180830668 22:18904437-18904459 CAGGGGGCACGGAAGGGCTTGGG - Intergenic
1181002200 22:19993116-19993138 CAGGGTGCACCCTGCGGCTGGGG - Intronic
1181037630 22:20177575-20177597 CAGGGTGCACAGCAGGGCTGGGG - Intergenic
1181069013 22:20320859-20320881 CAGGGGGCACGGAAGGGCTTGGG + Intergenic
1181110995 22:20602937-20602959 CAGGGTGGCCTGTGGGGGTGGGG - Intergenic
1181590569 22:23882653-23882675 CAGGGTGTGCGGCGGGGCAGGGG - Intronic
1182152889 22:28042865-28042887 CAGGCTACACGTTGGGGATGAGG + Intronic
1182396753 22:30041646-30041668 CAGAGAACACAGTGGGGCTGGGG - Intergenic
1183321429 22:37167311-37167333 GAGGGTGCCGGCTGGGGCTGGGG - Intronic
1183359745 22:37377277-37377299 CAGGGTGGGGGCTGGGGCTGAGG - Intronic
1183517783 22:38277295-38277317 CAGGGGGAAAGGTGAGGCTGGGG - Intergenic
1184285975 22:43471715-43471737 CTGGTCGCACTGTGGGGCTGTGG + Intronic
1184730389 22:46368396-46368418 GGGGGTGCACGGGGGGTCTGGGG - Intronic
1184751155 22:46487586-46487608 CAGGGTGCAGGTGGGGGGTGCGG + Intronic
1184751171 22:46487621-46487643 CAGGGTGCAGGTGGGGGGTGCGG + Intronic
1184751209 22:46487713-46487735 CAGGGTGCAGGTGGGGGGTGAGG + Intronic
1184842160 22:47058425-47058447 GAGGAAGGACGGTGGGGCTGAGG - Intronic
1185157516 22:49203160-49203182 CAGTGTGGACGGCGGGGCTCAGG - Intergenic
1185214043 22:49588280-49588302 GAGGGTCCAGGGTGGGGCTGGGG - Intronic
1203280758 22_KI270734v1_random:129708-129730 CAGGGGGCACGGAAGGGCTTGGG - Intergenic
950264682 3:11564949-11564971 CAGCGCGCTCGATGGGGCTGCGG + Exonic
950265206 3:11568414-11568436 GTGGGCGCACAGTGGGGCTGTGG - Intronic
950487142 3:13280615-13280637 CAGGGTGAGCAGTGAGGCTGTGG - Intergenic
952743620 3:36758032-36758054 CAGGGTGTATGGGGTGGCTGAGG - Intergenic
952753335 3:36843575-36843597 CAGGTGGCAGGGTGGGGGTGGGG - Intronic
954326959 3:49869177-49869199 CCACGTGCACGGTGGGGGTGGGG - Intronic
954649013 3:52148758-52148780 CAGAGCACACGGTGGGTCTGTGG - Intronic
954706883 3:52485640-52485662 CAGGGTACAGCGTGGGGATGGGG + Intronic
954799874 3:53181009-53181031 CTGGGTACAGGGTGGGGGTGGGG + Intronic
954801514 3:53189736-53189758 CCTGGGGAACGGTGGGGCTGAGG - Intronic
955829598 3:62986941-62986963 CAAGGTGGTCAGTGGGGCTGGGG - Intergenic
957547928 3:81663841-81663863 CAGGGCGCGCGATGGGGGTGTGG - Intronic
958466818 3:94469979-94470001 CAGGCTTCAGGGTGGGGCGGTGG + Intergenic
959081062 3:101801594-101801616 CAAGCTGCAGGCTGGGGCTGTGG + Exonic
959705414 3:109334810-109334832 TAGGGTGGAGGTTGGGGCTGAGG - Intronic
960062765 3:113340554-113340576 CAGGGTGTGCGATGGGGGTGTGG + Intronic
960610829 3:119553531-119553553 CAGGCTGCACGGAGAGGGTGGGG - Intronic
960966737 3:123110837-123110859 CAGGGTGAAGGGTAGGGATGGGG - Intronic
961474380 3:127137567-127137589 CAGTGTGGACAGTGGGGGTGGGG - Intergenic
961644034 3:128383003-128383025 CAGGAGGCAGGGAGGGGCTGGGG - Intronic
962845836 3:139273198-139273220 CAGCAGGCAAGGTGGGGCTGTGG + Intronic
963996957 3:151721048-151721070 CAGGGTGTGCGATGGGGGTGTGG + Intergenic
964430964 3:156605767-156605789 CCGGGTGCTGGGAGGGGCTGAGG - Intergenic
966816767 3:183896170-183896192 CTGGGTGGTGGGTGGGGCTGTGG - Intergenic
966866084 3:184259888-184259910 CGGTGTGCGGGGTGGGGCTGCGG + Exonic
967186144 3:186946195-186946217 TCGGCTGCTCGGTGGGGCTGAGG + Intronic
967859830 3:194142049-194142071 CAGGGAGCTCGGTGCGGCGGAGG - Intergenic
967891564 3:194367757-194367779 CAAGGTGGACGGTGAGGGTGTGG - Intronic
968045920 3:195623901-195623923 GAGGGTGGATGGTGGGGGTGGGG + Intergenic
968308734 3:197666186-197666208 GAGGGTGGATGGTGGGGGTGGGG - Intergenic
968487629 4:871548-871570 CTGTGTTCACTGTGGGGCTGGGG + Intronic
968647828 4:1749067-1749089 GAGGGGGCACGGTGGGGAGGGGG - Intergenic
968651319 4:1761380-1761402 CAGGGTGCACGGGGTGGGTGGGG - Intergenic
968651394 4:1761560-1761582 CAGGGTGCACGGGGTGGATGGGG - Intergenic
968921144 4:3522769-3522791 CTGGGGGCGCGGTGGGGGTGAGG + Intronic
968985392 4:3871907-3871929 GGAGGTGCACGGTGGGGCCGCGG + Intergenic
969285754 4:6200802-6200824 CAGGCTGCCCGGCGCGGCTGGGG - Intergenic
969530633 4:7728487-7728509 CCGGAAGCACCGTGGGGCTGGGG - Intronic
969572870 4:8020259-8020281 CAGAGAGCACGGAGAGGCTGGGG + Exonic
970273106 4:14368138-14368160 CAGGGTGTGCGATGGGGGTGTGG + Intergenic
971043414 4:22779067-22779089 CAGAGTGGACGCTGAGGCTGAGG + Intergenic
971585601 4:28402391-28402413 AAGGGTGTACGATGGGGGTGTGG + Intronic
973998818 4:56488957-56488979 AAGGGTGCCTGGTGTGGCTGAGG - Intronic
975836758 4:78430615-78430637 CAGGGTTCAAGGTGGGGCCGGGG - Intronic
976061750 4:81136898-81136920 CATAGTGCACGGTGGGGGTCAGG - Intronic
976399169 4:84588142-84588164 GAGGGTGCACATTGAGGCTGTGG + Intronic
977766552 4:100805678-100805700 CAGGGTGTGCGATGGGGGTGTGG + Intronic
979329384 4:119408836-119408858 CAGGGTCCACTGTGAGGCAGAGG + Intergenic
980074298 4:128278063-128278085 CAGGGTGCATGGGTAGGCTGGGG + Intronic
981576905 4:146214918-146214940 GAGGGTGGGAGGTGGGGCTGTGG + Intergenic
982947831 4:161648401-161648423 CAGGGTGTGCGATGGGGCTGTGG - Intronic
983145908 4:164214889-164214911 CAGGGCGTGCGATGGGGCTGTGG + Intronic
985559872 5:579689-579711 CAGGGTCCTCGGGGTGGCTGTGG + Intergenic
985675568 5:1229766-1229788 CACGGTGCAGGCTGGGGGTGGGG + Intronic
985747373 5:1654941-1654963 CAGGGTGGATGGTGGGGGTGGGG - Intergenic
985898143 5:2762875-2762897 CAGGGTACATCCTGGGGCTGAGG - Intergenic
986156681 5:5183436-5183458 CAGGGCTCACGGTGTGGTTGTGG + Intronic
986379015 5:7164134-7164156 CAGGGTGCAGAGTGGAGGTGGGG - Intergenic
986734096 5:10655429-10655451 TAGTGTGGCCGGTGGGGCTGGGG - Intergenic
987114084 5:14712954-14712976 CAGGGTGCACGGTGCGACCCTGG - Exonic
987859618 5:23467781-23467803 CAGGGTGTCAGCTGGGGCTGAGG - Intergenic
989204443 5:38797383-38797405 CAGGGTGTGCGATGGGGGTGTGG + Intergenic
989667658 5:43874694-43874716 GAAGATGCAGGGTGGGGCTGAGG + Intergenic
990502777 5:56413135-56413157 GAGGGTGCTGGGTGAGGCTGGGG + Intergenic
991040393 5:62169247-62169269 GAGGTGGCACTGTGGGGCTGAGG - Intergenic
991452667 5:66769351-66769373 TTGGGTGCATGGTGGGGCTGGGG + Intronic
992447363 5:76846061-76846083 CAGGCTACATGGTGGAGCTGAGG - Intergenic
994661702 5:102661595-102661617 CAGAGTGTGCGATGGGGCTGTGG - Intergenic
994871149 5:105351524-105351546 CAGGATGCATGATGGGGTTGTGG + Intergenic
997355902 5:133262882-133262904 CAGGAAGGAGGGTGGGGCTGAGG + Intronic
997367107 5:133333131-133333153 CAGGGTGCAGGATGGGGCTGGGG - Intronic
998617302 5:143754175-143754197 CAGGGTTCATGGTGTGCCTGTGG + Intergenic
999166073 5:149550769-149550791 GGGGGTGCACGGTGGTGGTGGGG + Intronic
999239647 5:150120164-150120186 CCAGGTGCAGAGTGGGGCTGAGG - Intronic
999246983 5:150160273-150160295 TGAGGTTCACGGTGGGGCTGAGG + Intergenic
999743778 5:154576534-154576556 CAGGGGGCCAGGAGGGGCTGGGG - Intergenic
1000079425 5:157830926-157830948 GAGGGTGGAGGGTGGGGCTGAGG + Intronic
1000205914 5:159058449-159058471 CTGGTTGCAAGGTAGGGCTGGGG - Intronic
1001031902 5:168269344-168269366 CAGGGTGGAAGGCGGGGCTTGGG - Intergenic
1001264140 5:170260208-170260230 CGGGATGCTCTGTGGGGCTGAGG - Intronic
1002051756 5:176575423-176575445 CAAGGTGCACGGGGGACCTGTGG + Exonic
1002450632 5:179316487-179316509 GAGGGTGTTCTGTGGGGCTGGGG - Intronic
1002528000 5:179825747-179825769 CAGGTTGCACAGTGGGTCTGTGG + Intronic
1002792466 6:446345-446367 CAGGGAGCCAGGTTGGGCTGGGG - Intergenic
1002879175 6:1236321-1236343 AAGGTTGCACAGTGAGGCTGAGG - Intergenic
1006299944 6:33188505-33188527 CAGGTGGCACCGTGTGGCTGTGG - Exonic
1006618227 6:35343865-35343887 CAGGGTGGAGGGTGGGAGTGAGG - Intronic
1006748329 6:36360784-36360806 CTGGAAGCACAGTGGGGCTGTGG - Intronic
1007293911 6:40806694-40806716 CAGGCTGCACAGAGGGCCTGGGG + Intergenic
1007599344 6:43072141-43072163 TAGTGTTCACTGTGGGGCTGTGG - Exonic
1007634154 6:43287893-43287915 CTTCGTGCACGGTGTGGCTGGGG - Exonic
1009873106 6:69472956-69472978 CAGAGTGGACGCTGAGGCTGAGG - Intergenic
1012314333 6:97767201-97767223 CAGGGGGCAGGGTGGGGAGGGGG - Intergenic
1012643643 6:101653382-101653404 GAGGGCGCAGGGTGGGGGTGAGG - Intronic
1014221543 6:118803435-118803457 CAGGGAGCATGGTGGGGGGGTGG + Intergenic
1014933411 6:127360245-127360267 CAGGGGCTACGGTGGGGATGAGG + Intergenic
1015768119 6:136740237-136740259 GAGTGTGCACAGCGGGGCTGGGG + Intronic
1017822557 6:158060058-158060080 CCGGGTGCCCTGTGGGGCTGGGG - Intronic
1017978569 6:159378432-159378454 CAAGGTGAAAGGTGGAGCTGGGG + Intergenic
1018074613 6:160200744-160200766 CAGGGTGCATGCTGGAGGTGGGG - Intronic
1018141269 6:160839152-160839174 CTGGGTGCACAGGGAGGCTGCGG - Intergenic
1018464359 6:164029668-164029690 CACTGTTCACTGTGGGGCTGAGG - Intergenic
1018620468 6:165725484-165725506 CAGGGTGTATGATGGGGTTGTGG - Intronic
1018678313 6:166242075-166242097 AAGTGTGCACTGTGGGTCTGGGG - Intergenic
1018733086 6:166668059-166668081 CAGTGTGCAGGGTGGGGCCAGGG + Intronic
1019308593 7:347942-347964 CAGGGTGCATGGGGCAGCTGAGG + Intergenic
1019322357 7:421530-421552 CCAGGTGCACGGTGGGGAGGGGG - Intergenic
1019506917 7:1395978-1396000 CAGAGTGCAGTGTGAGGCTGAGG - Intergenic
1019626873 7:2020321-2020343 CTGGGGTCACGCTGGGGCTGTGG - Intronic
1019922702 7:4173072-4173094 CAGGGAGCAGGATGGTGCTGCGG + Intronic
1020098444 7:5381154-5381176 CAGGGAGCAACCTGGGGCTGTGG - Intronic
1021024092 7:15643259-15643281 CCTGGTGAAGGGTGGGGCTGGGG + Intronic
1023818991 7:43969914-43969936 CAAGGTGCCTGGTAGGGCTGAGG - Intergenic
1023842244 7:44104240-44104262 GAGAGTGGACGGAGGGGCTGCGG - Intergenic
1023875232 7:44283098-44283120 CAGAGCGCCAGGTGGGGCTGTGG - Intronic
1024778410 7:52816402-52816424 CAGGGTGTGCTGTGGGACTGAGG - Intergenic
1025045012 7:55685108-55685130 CAGGGAGCCTGGTGAGGCTGTGG - Intergenic
1025248925 7:57338742-57338764 CAGGGTGCATAGAGGGGCCGTGG + Intergenic
1025951057 7:66145850-66145872 CAGGGTGAAGGGTGGGCGTGGGG - Intronic
1029448438 7:100627501-100627523 CAGGGTGGACGCTGGGGCGGAGG + Intronic
1029459147 7:100685411-100685433 CAGGGTGGGCAGTGGGGATGGGG + Exonic
1029744044 7:102506877-102506899 CAAGGTGCCTGGTGGGGCTGAGG - Intronic
1029762034 7:102606040-102606062 CAAGGTGCCTGGTGGGGCTGAGG - Intronic
1030139908 7:106293738-106293760 CAGTGGGCAGGGTGGGGCGGGGG - Intergenic
1030311067 7:108069708-108069730 CAAGCTGCATGATGGGGCTGTGG - Exonic
1030769569 7:113457221-113457243 CAGGGTGTGCGATGGGGGTGTGG - Intergenic
1032069007 7:128792290-128792312 CAGGGAGAAAGGAGGGGCTGGGG - Exonic
1032076215 7:128837327-128837349 CAGGGTGCAGGGGGAGACTGGGG + Intronic
1032574886 7:133042980-133043002 CCAGCTGCTCGGTGGGGCTGAGG - Intronic
1033038363 7:137895981-137896003 CAGTGTGCAGGGCTGGGCTGGGG - Intronic
1033570916 7:142627450-142627472 CAGGGGGCCCGCTGGGGCGGAGG - Intergenic
1034531292 7:151697705-151697727 CTGGGTGCAGGGAGGGGGTGTGG + Intronic
1035142617 7:156777908-156777930 CAGGGTGTATGGTGGGGGTAGGG - Intronic
1035170592 7:157015290-157015312 CAGGTTGCAGGGAGAGGCTGAGG - Intergenic
1035291846 7:157844330-157844352 GAGGGTGCAGGCTGGGGATGGGG - Intronic
1035316484 7:158000602-158000624 TGGGGAGCAGGGTGGGGCTGGGG + Intronic
1035316693 7:158001137-158001159 TGGGGTGCAAGGTGGGGCTGGGG + Intronic
1035316730 7:158001243-158001265 TGGGGTACAGGGTGGGGCTGAGG + Intronic
1035556592 8:571740-571762 CAGGAAGGAAGGTGGGGCTGGGG + Intergenic
1035590414 8:808655-808677 CAGGGTGGACGGTAGTGCTGAGG + Intergenic
1035922047 8:3687678-3687700 CAGTTAGCACGGTGGGGCTCAGG - Intronic
1036645756 8:10610879-10610901 CAGGCTGCAGGGTGAGCCTGCGG - Exonic
1036691594 8:10948005-10948027 CAGGGTGCAGGGTGGGTTAGGGG + Intronic
1037800321 8:22030793-22030815 CAGGCTACTCGGGGGGGCTGAGG - Intronic
1037808936 8:22074723-22074745 CAGGGTACACTGTGGGGCAGTGG + Intronic
1037887568 8:22602814-22602836 CAGGGTTCTGGGTGGGGTTGGGG + Intronic
1038612512 8:29069292-29069314 CACCATGCACGGTGGGCCTGGGG + Exonic
1038612723 8:29070250-29070272 CTGGGTGCCCGCAGGGGCTGGGG - Exonic
1041176999 8:55207236-55207258 CTGGGGGCAGGGTGGGGCAGTGG + Intronic
1041522733 8:58772843-58772865 CAGGAGGCACGATGGGGCTGAGG + Intergenic
1042271500 8:66961344-66961366 CGGGGCGCACCGCGGGGCTGGGG - Intronic
1043148317 8:76682391-76682413 TGGGGTGAACGCTGGGGCTGGGG + Intronic
1043605227 8:81991371-81991393 CAGGGTGTGCGATGGGGGTGTGG + Intergenic
1043982810 8:86660296-86660318 CAGGGTGGGAGGTGGGGTTGGGG + Intronic
1044763020 8:95542296-95542318 CAGGGTGGAGGGTGGGGAGGAGG + Intergenic
1045314235 8:101029286-101029308 CATGATGCAGTGTGGGGCTGGGG + Intergenic
1045518438 8:102881547-102881569 CCCAGTGCACGGGGGGGCTGAGG + Intronic
1046590277 8:116198142-116198164 CAGGGTGTGCGATGGGGGTGTGG + Intergenic
1047739946 8:127798367-127798389 TAAGGTGCACGGTGAGGGTGGGG - Intergenic
1049209466 8:141378873-141378895 CAGGCTTCAGGGTGGGGCGGGGG - Intergenic
1049376022 8:142289592-142289614 CAGGGTGCACCCTGGCCCTGAGG + Intronic
1049395266 8:142397307-142397329 CAAGGTGCACAGAGGGGCTGTGG - Intronic
1049407274 8:142457384-142457406 CAGAGACCACTGTGGGGCTGAGG - Intronic
1049410316 8:142471046-142471068 CAGGGAGCACCGAGGGGCTTGGG + Intronic
1049412298 8:142478680-142478702 CAGGGTGCACAGTGGGACTTGGG + Intronic
1049412315 8:142478740-142478762 CGGGGTGCACAGTGGGACTTGGG + Intronic
1049412380 8:142478996-142479018 CGGGGTGCACAGTGGGACTTGGG + Intronic
1049581350 8:143412570-143412592 GAGGGTTCACGGTGGGGGTGGGG - Intergenic
1049651455 8:143771682-143771704 CAGGGTGCGTGGTGGGGGTGAGG + Intergenic
1049692619 8:143969300-143969322 CAGGGAGAATGGGGGGGCTGAGG - Intronic
1049693012 8:143970997-143971019 CAGGGAGAATGGGGGGGCTGAGG + Intronic
1049725024 8:144141876-144141898 CAGGGCCCACGGGAGGGCTGGGG - Intergenic
1049745222 8:144260443-144260465 CAGGGAGGAGGGTGGGGCTGGGG - Intronic
1050259050 9:3821866-3821888 CAGGGTCCAGGGAGGGGCTTAGG + Intergenic
1052370187 9:27655488-27655510 CAGGGTGTGCGATGGGGGTGTGG - Intergenic
1052824289 9:33163935-33163957 CAGGGTGCCCGGTGTGGGGGCGG + Intronic
1053354946 9:37437659-37437681 CTGGGGGCAGGGAGGGGCTGGGG - Intergenic
1053564152 9:39230385-39230407 CAGGGTCCCCTTTGGGGCTGTGG + Intronic
1053829939 9:42068256-42068278 CAGGGTCCCCTTTGGGGCTGTGG + Intronic
1054132996 9:61388649-61388671 CAGGGTCCCCTTTGGGGCTGTGG - Intergenic
1054452071 9:65408709-65408731 CAGGAAGCACGGTGGCTCTGAGG + Intergenic
1054600617 9:67119197-67119219 CAGGGTCCCCTTTGGGGCTGTGG - Intergenic
1055279357 9:74656933-74656955 CAGGGTGCATGGAGGAGATGAGG - Intronic
1056709604 9:88980075-88980097 CAGGGTGGGGGGTGGGGGTGGGG + Intergenic
1056782289 9:89559788-89559810 CATTGTGCAAGGTGAGGCTGGGG + Intergenic
1056815968 9:89801114-89801136 CAGAGTGTAGGGTGGGGGTGAGG + Intergenic
1057144604 9:92749445-92749467 CAGGGAACACTGTAGGGCTGTGG + Intronic
1057187285 9:93063863-93063885 GATGGTGCCTGGTGGGGCTGGGG - Intronic
1057240046 9:93400031-93400053 GAGGGTTCAGGATGGGGCTGGGG - Intergenic
1057380492 9:94563079-94563101 CATGGTGAACGGTGGGTGTGAGG + Intronic
1057433886 9:95021675-95021697 CAGGGGGCAGGTTTGGGCTGGGG + Intronic
1057834620 9:98434371-98434393 CAGGGAACATGGTGGGGCTCAGG + Intronic
1059483158 9:114607807-114607829 CAGGTAGAACGATGGGGCTGGGG + Intergenic
1060004985 9:119991966-119991988 CACGGTGCACCGGGGGTCTGGGG + Intergenic
1060199644 9:121645140-121645162 CAGGGAGAAAGGAGGGGCTGTGG + Intronic
1060214677 9:121731654-121731676 CAGATTGCCCAGTGGGGCTGGGG + Intronic
1060732624 9:126048055-126048077 CCCTGTGCAGGGTGGGGCTGGGG + Intergenic
1060774995 9:126366713-126366735 CAGGGTGCACAGTGAGGGAGAGG - Intronic
1060831754 9:126722073-126722095 CAGAGGGCACGGAGGGTCTGAGG - Intergenic
1061289261 9:129641618-129641640 CAGGCGACAGGGTGGGGCTGAGG + Intronic
1061621720 9:131814916-131814938 AAGGGTGCTCAGTGGGGGTGAGG - Intergenic
1061878324 9:133555967-133555989 CAGGGGGCAGGATGGGGCCGAGG + Intronic
1061888719 9:133606447-133606469 CAGAGGCCAGGGTGGGGCTGGGG - Intergenic
1061926822 9:133809995-133810017 CAACGTGCAAGATGGGGCTGTGG + Intronic
1062029346 9:134355112-134355134 TGGGGTTCAAGGTGGGGCTGGGG + Intronic
1062117321 9:134816504-134816526 CTGGGTGCAAGGTGGGGCAAGGG - Intronic
1062204597 9:135329118-135329140 ATGGGAGCCCGGTGGGGCTGGGG - Intergenic
1062315919 9:135966970-135966992 TAGGGTGCCCGGTGTGGCTGTGG - Intergenic
1062315932 9:135967005-135967027 TAGGGTGCCCGGCGTGGCTGTGG - Intergenic
1062315944 9:135967040-135967062 TAGGGTGCCCGGCGTGGCTGTGG - Intergenic
1062315956 9:135967075-135967097 TAGGGTGCCCGGCGTGGCTGTGG - Intergenic
1062315968 9:135967110-135967132 TAGGGTGCCCGGCGTGGCTGTGG - Intergenic
1186300289 X:8193372-8193394 CAGGGTGCAGGGTGGGAGTAGGG - Intergenic
1188003468 X:25002499-25002521 GAGGGTGCAGGGTTGGGCAGAGG - Intergenic
1188058712 X:25573707-25573729 CAGGGAGCAGGCTGGAGCTGGGG + Intergenic
1189739087 X:44100364-44100386 CATTGTGCATGGTGGGGATGTGG + Intergenic
1190735054 X:53250590-53250612 CAGGGGCCCTGGTGGGGCTGGGG + Exonic
1193523458 X:82559629-82559651 CAGGGTGCATGGTGGGGGTAGGG - Intergenic
1193898276 X:87141347-87141369 CAGGGTGTGCGATGGGGGTGTGG - Intergenic
1193924910 X:87472589-87472611 CAGGGTGAAGGGTGGGGTTAGGG + Intergenic
1196711733 X:118770240-118770262 CAGGGTGCACGATGGGCAGGCGG - Intronic
1197870397 X:131058277-131058299 CTGGGTGCAGGGTGCGGCTCAGG + Exonic
1199936562 X:152580147-152580169 CAGGGAGCAGGGTGGGGGAGGGG - Intergenic
1200072992 X:153538159-153538181 CCGGGTGCACGGCCGGGCTAGGG - Intronic
1200104428 X:153704427-153704449 CAGGGAGGAAGGTGGTGCTGTGG - Intronic