ID: 1169278485

View in Genome Browser
Species Human (GRCh38)
Location 20:4248868-4248890
Sequence GCCCCCGCCGCCGCCCGCGC TGG
Strand +
Crispr in exon? Yes
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total 1315
Summary {0: 1, 1: 4, 2: 31, 3: 268, 4: 1011}

Found 11 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1169278479_1169278485 5 Left 1169278479 20:4248840-4248862 CCTCCGAGGGGGCCGCGCCGCCC 0: 1
1: 0
2: 2
3: 24
4: 256
Right 1169278485 20:4248868-4248890 GCCCCCGCCGCCGCCCGCGCTGG 0: 1
1: 4
2: 31
3: 268
4: 1011
1169278480_1169278485 2 Left 1169278480 20:4248843-4248865 CCGAGGGGGCCGCGCCGCCCGCG 0: 1
1: 0
2: 1
3: 17
4: 253
Right 1169278485 20:4248868-4248890 GCCCCCGCCGCCGCCCGCGCTGG 0: 1
1: 4
2: 31
3: 268
4: 1011
1169278473_1169278485 17 Left 1169278473 20:4248828-4248850 CCACCGCCGGGCCCTCCGAGGGG 0: 1
1: 0
2: 0
3: 26
4: 200
Right 1169278485 20:4248868-4248890 GCCCCCGCCGCCGCCCGCGCTGG 0: 1
1: 4
2: 31
3: 268
4: 1011
1169278481_1169278485 -7 Left 1169278481 20:4248852-4248874 CCGCGCCGCCCGCGCTGCCCCCG 0: 1
1: 1
2: 23
3: 162
4: 1147
Right 1169278485 20:4248868-4248890 GCCCCCGCCGCCGCCCGCGCTGG 0: 1
1: 4
2: 31
3: 268
4: 1011
1169278477_1169278485 11 Left 1169278477 20:4248834-4248856 CCGGGCCCTCCGAGGGGGCCGCG 0: 1
1: 0
2: 1
3: 18
4: 255
Right 1169278485 20:4248868-4248890 GCCCCCGCCGCCGCCCGCGCTGG 0: 1
1: 4
2: 31
3: 268
4: 1011
1169278465_1169278485 30 Left 1169278465 20:4248815-4248837 CCCGGCACGCCGCCCACCGCCGG 0: 1
1: 0
2: 1
3: 23
4: 228
Right 1169278485 20:4248868-4248890 GCCCCCGCCGCCGCCCGCGCTGG 0: 1
1: 4
2: 31
3: 268
4: 1011
1169278469_1169278485 21 Left 1169278469 20:4248824-4248846 CCGCCCACCGCCGGGCCCTCCGA 0: 1
1: 0
2: 4
3: 16
4: 221
Right 1169278485 20:4248868-4248890 GCCCCCGCCGCCGCCCGCGCTGG 0: 1
1: 4
2: 31
3: 268
4: 1011
1169278471_1169278485 18 Left 1169278471 20:4248827-4248849 CCCACCGCCGGGCCCTCCGAGGG 0: 1
1: 0
2: 1
3: 5
4: 129
Right 1169278485 20:4248868-4248890 GCCCCCGCCGCCGCCCGCGCTGG 0: 1
1: 4
2: 31
3: 268
4: 1011
1169278476_1169278485 14 Left 1169278476 20:4248831-4248853 CCGCCGGGCCCTCCGAGGGGGCC 0: 1
1: 0
2: 1
3: 18
4: 209
Right 1169278485 20:4248868-4248890 GCCCCCGCCGCCGCCCGCGCTGG 0: 1
1: 4
2: 31
3: 268
4: 1011
1169278467_1169278485 29 Left 1169278467 20:4248816-4248838 CCGGCACGCCGCCCACCGCCGGG 0: 1
1: 0
2: 0
3: 26
4: 229
Right 1169278485 20:4248868-4248890 GCCCCCGCCGCCGCCCGCGCTGG 0: 1
1: 4
2: 31
3: 268
4: 1011
1169278478_1169278485 6 Left 1169278478 20:4248839-4248861 CCCTCCGAGGGGGCCGCGCCGCC 0: 1
1: 0
2: 0
3: 11
4: 137
Right 1169278485 20:4248868-4248890 GCCCCCGCCGCCGCCCGCGCTGG 0: 1
1: 4
2: 31
3: 268
4: 1011

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1169278485 Original CRISPR GCCCCCGCCGCCGCCCGCGC TGG Exonic