ID: 1169280448

View in Genome Browser
Species Human (GRCh38)
Location 20:4262680-4262702
Sequence CTTAACATACAAATCCACAA TGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 2 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1169280448_1169280452 24 Left 1169280448 20:4262680-4262702 CCATTGTGGATTTGTATGTTAAG No data
Right 1169280452 20:4262727-4262749 GTTCCAAAAAGTTCCCAATCTGG No data
1169280448_1169280453 25 Left 1169280448 20:4262680-4262702 CCATTGTGGATTTGTATGTTAAG No data
Right 1169280453 20:4262728-4262750 TTCCAAAAAGTTCCCAATCTGGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1169280448 Original CRISPR CTTAACATACAAATCCACAA TGG (reversed) Intergenic
No off target data available for this crispr