ID: 1169284656

View in Genome Browser
Species Human (GRCh38)
Location 20:4297846-4297868
Sequence CTGAACAAGGAGAAAAAGTC AGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 7 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1169284656_1169284661 17 Left 1169284656 20:4297846-4297868 CCTGACTTTTTCTCCTTGTTCAG No data
Right 1169284661 20:4297886-4297908 CTTGCTGCCTTCAGGACTCAGGG No data
1169284656_1169284664 23 Left 1169284656 20:4297846-4297868 CCTGACTTTTTCTCCTTGTTCAG No data
Right 1169284664 20:4297892-4297914 GCCTTCAGGACTCAGGGGTCGGG No data
1169284656_1169284658 9 Left 1169284656 20:4297846-4297868 CCTGACTTTTTCTCCTTGTTCAG No data
Right 1169284658 20:4297878-4297900 TTTTCTTCCTTGCTGCCTTCAGG No data
1169284656_1169284663 22 Left 1169284656 20:4297846-4297868 CCTGACTTTTTCTCCTTGTTCAG No data
Right 1169284663 20:4297891-4297913 TGCCTTCAGGACTCAGGGGTCGG No data
1169284656_1169284666 24 Left 1169284656 20:4297846-4297868 CCTGACTTTTTCTCCTTGTTCAG No data
Right 1169284666 20:4297893-4297915 CCTTCAGGACTCAGGGGTCGGGG No data
1169284656_1169284660 16 Left 1169284656 20:4297846-4297868 CCTGACTTTTTCTCCTTGTTCAG No data
Right 1169284660 20:4297885-4297907 CCTTGCTGCCTTCAGGACTCAGG No data
1169284656_1169284662 18 Left 1169284656 20:4297846-4297868 CCTGACTTTTTCTCCTTGTTCAG No data
Right 1169284662 20:4297887-4297909 TTGCTGCCTTCAGGACTCAGGGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1169284656 Original CRISPR CTGAACAAGGAGAAAAAGTC AGG (reversed) Intergenic
No off target data available for this crispr