ID: 1169285713

View in Genome Browser
Species Human (GRCh38)
Location 20:4305555-4305577
Sequence CAGAGCACGGTGAGATGGTT CGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 3 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1169285709_1169285713 -5 Left 1169285709 20:4305537-4305559 CCAGTGGGCTTAGGGTTCCAGAG No data
Right 1169285713 20:4305555-4305577 CAGAGCACGGTGAGATGGTTCGG No data
1169285705_1169285713 9 Left 1169285705 20:4305523-4305545 CCCTGACATGAGAGCCAGTGGGC No data
Right 1169285713 20:4305555-4305577 CAGAGCACGGTGAGATGGTTCGG No data
1169285706_1169285713 8 Left 1169285706 20:4305524-4305546 CCTGACATGAGAGCCAGTGGGCT No data
Right 1169285713 20:4305555-4305577 CAGAGCACGGTGAGATGGTTCGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1169285713 Original CRISPR CAGAGCACGGTGAGATGGTT CGG Intergenic
No off target data available for this crispr