ID: 1169289341

View in Genome Browser
Species Human (GRCh38)
Location 20:4335325-4335347
Sequence TGGGTTTGTTTTGGAAAAAC AGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 5 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1169289341_1169289349 20 Left 1169289341 20:4335325-4335347 CCTGTTTTTCCAAAACAAACCCA No data
Right 1169289349 20:4335368-4335390 TCTAGGCAGCCTTTGGCCTTTGG No data
1169289341_1169289352 30 Left 1169289341 20:4335325-4335347 CCTGTTTTTCCAAAACAAACCCA No data
Right 1169289352 20:4335378-4335400 CTTTGGCCTTTGGCAGTAGTGGG No data
1169289341_1169289348 13 Left 1169289341 20:4335325-4335347 CCTGTTTTTCCAAAACAAACCCA No data
Right 1169289348 20:4335361-4335383 TGCAATTTCTAGGCAGCCTTTGG No data
1169289341_1169289351 29 Left 1169289341 20:4335325-4335347 CCTGTTTTTCCAAAACAAACCCA No data
Right 1169289351 20:4335377-4335399 CCTTTGGCCTTTGGCAGTAGTGG No data
1169289341_1169289345 3 Left 1169289341 20:4335325-4335347 CCTGTTTTTCCAAAACAAACCCA No data
Right 1169289345 20:4335351-4335373 GAAGCCAGCCTGCAATTTCTAGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1169289341 Original CRISPR TGGGTTTGTTTTGGAAAAAC AGG (reversed) Intergenic
No off target data available for this crispr