ID: 1169295409

View in Genome Browser
Species Human (GRCh38)
Location 20:4393145-4393167
Sequence CTGAATCTTGAATGTAGTGG TGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 3 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1169295405_1169295409 13 Left 1169295405 20:4393109-4393131 CCCTTAAGACTCCTGGATCAGAG No data
Right 1169295409 20:4393145-4393167 CTGAATCTTGAATGTAGTGGTGG No data
1169295406_1169295409 12 Left 1169295406 20:4393110-4393132 CCTTAAGACTCCTGGATCAGAGA No data
Right 1169295409 20:4393145-4393167 CTGAATCTTGAATGTAGTGGTGG No data
1169295407_1169295409 2 Left 1169295407 20:4393120-4393142 CCTGGATCAGAGACAAAAAATAG No data
Right 1169295409 20:4393145-4393167 CTGAATCTTGAATGTAGTGGTGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1169295409 Original CRISPR CTGAATCTTGAATGTAGTGG TGG Intergenic
No off target data available for this crispr