ID: 1169299143

View in Genome Browser
Species Human (GRCh38)
Location 20:4427139-4427161
Sequence CATTAAGATTTCCTGTAGTA AGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 1 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1169299139_1169299143 22 Left 1169299139 20:4427094-4427116 CCACACAGCGTATGGAATTTGTC No data
Right 1169299143 20:4427139-4427161 CATTAAGATTTCCTGTAGTAAGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1169299143 Original CRISPR CATTAAGATTTCCTGTAGTA AGG Intergenic
No off target data available for this crispr