ID: 1169301342

View in Genome Browser
Species Human (GRCh38)
Location 20:4444241-4444263
Sequence CTGTTTCAGCCCATCTCTCT GGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 2 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1169301342_1169301347 24 Left 1169301342 20:4444241-4444263 CCCAGAGAGATGGGCTGAAACAG No data
Right 1169301347 20:4444288-4444310 ACTTACAGATAGCCACGTACTGG No data
1169301342_1169301348 27 Left 1169301342 20:4444241-4444263 CCCAGAGAGATGGGCTGAAACAG No data
Right 1169301348 20:4444291-4444313 TACAGATAGCCACGTACTGGTGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1169301342 Original CRISPR CTGTTTCAGCCCATCTCTCT GGG (reversed) Intergenic
No off target data available for this crispr