ID: 1169305918

View in Genome Browser
Species Human (GRCh38)
Location 20:4490334-4490356
Sequence CCTTTTCTGCAGAGTGAACC TGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 2 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1169305918_1169305920 -8 Left 1169305918 20:4490334-4490356 CCAGGTTCACTCTGCAGAAAAGG No data
Right 1169305920 20:4490349-4490371 AGAAAAGGCAGTGCCCAGACAGG No data
1169305918_1169305924 19 Left 1169305918 20:4490334-4490356 CCAGGTTCACTCTGCAGAAAAGG No data
Right 1169305924 20:4490376-4490398 GCTCCCCTGCCCTTCACCCTTGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1169305918 Original CRISPR CCTTTTCTGCAGAGTGAACC TGG (reversed) Intergenic
No off target data available for this crispr