ID: 1169309744

View in Genome Browser
Species Human (GRCh38)
Location 20:4525573-4525595
Sequence CACACCCAATAATCTAATTG TGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 1 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1169309742_1169309744 10 Left 1169309742 20:4525540-4525562 CCTTGCTGTTATTGTTTCTTTTC No data
Right 1169309744 20:4525573-4525595 CACACCCAATAATCTAATTGTGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1169309744 Original CRISPR CACACCCAATAATCTAATTG TGG Intergenic
No off target data available for this crispr