ID: 1169312973

View in Genome Browser
Species Human (GRCh38)
Location 20:4562979-4563001
Sequence CTGGAGATCAAGAGAGCAGA AGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 1 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1169312973_1169312975 19 Left 1169312973 20:4562979-4563001 CCTTCTGCTCTCTTGATCTCCAG No data
Right 1169312975 20:4563021-4563043 ATATGAATGATAATGAGTGATGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1169312973 Original CRISPR CTGGAGATCAAGAGAGCAGA AGG (reversed) Intergenic
No off target data available for this crispr