ID: 1169314881

View in Genome Browser
Species Human (GRCh38)
Location 20:4582203-4582225
Sequence AAAGACTGAGACATGACAGG AGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total
Summary

Found 2 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1169314881_1169314884 2 Left 1169314881 20:4582203-4582225 CCTCCTGTCATGTCTCAGTCTTT No data
Right 1169314884 20:4582228-4582250 AGTCTCCACCTCCTGTTCCCTGG No data
1169314881_1169314885 3 Left 1169314881 20:4582203-4582225 CCTCCTGTCATGTCTCAGTCTTT No data
Right 1169314885 20:4582229-4582251 GTCTCCACCTCCTGTTCCCTGGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1169314881 Original CRISPR AAAGACTGAGACATGACAGG AGG (reversed) Intergenic