ID: 1169314885

View in Genome Browser
Species Human (GRCh38)
Location 20:4582229-4582251
Sequence GTCTCCACCTCCTGTTCCCT GGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total
Summary

Found 3 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1169314881_1169314885 3 Left 1169314881 20:4582203-4582225 CCTCCTGTCATGTCTCAGTCTTT No data
Right 1169314885 20:4582229-4582251 GTCTCCACCTCCTGTTCCCTGGG No data
1169314882_1169314885 0 Left 1169314882 20:4582206-4582228 CCTGTCATGTCTCAGTCTTTCCA No data
Right 1169314885 20:4582229-4582251 GTCTCCACCTCCTGTTCCCTGGG No data
1169314880_1169314885 4 Left 1169314880 20:4582202-4582224 CCCTCCTGTCATGTCTCAGTCTT No data
Right 1169314885 20:4582229-4582251 GTCTCCACCTCCTGTTCCCTGGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1169314885 Original CRISPR GTCTCCACCTCCTGTTCCCT GGG Intergenic