ID: 1169316568

View in Genome Browser
Species Human (GRCh38)
Location 20:4595953-4595975
Sequence CTTTGTAAGGCCAAGGTGGG TGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 3 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1169316568_1169316577 12 Left 1169316568 20:4595953-4595975 CCACCCACCTTGGCCTTACAAAG No data
Right 1169316577 20:4595988-4596010 AGGCATGAGCCACCGTGCCTGGG 0: 43
1: 442
2: 1524
3: 3147
4: 4518
1169316568_1169316576 11 Left 1169316568 20:4595953-4595975 CCACCCACCTTGGCCTTACAAAG No data
Right 1169316576 20:4595987-4596009 CAGGCATGAGCCACCGTGCCTGG 0: 6929
1: 41657
2: 112181
3: 156808
4: 166907
1169316568_1169316575 -8 Left 1169316568 20:4595953-4595975 CCACCCACCTTGGCCTTACAAAG No data
Right 1169316575 20:4595968-4595990 TTACAAAGTGCTGGGATTACAGG 0: 67
1: 12455
2: 313856
3: 264775
4: 144378

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1169316568 Original CRISPR CTTTGTAAGGCCAAGGTGGG TGG (reversed) Intergenic
No off target data available for this crispr