ID: 1169317910

View in Genome Browser
Species Human (GRCh38)
Location 20:4608722-4608744
Sequence TAGCCTGGTGAGGAGGTTGC AGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 1 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1169317905_1169317910 -5 Left 1169317905 20:4608704-4608726 CCTGGAACCATCACAGTCTAGCC No data
Right 1169317910 20:4608722-4608744 TAGCCTGGTGAGGAGGTTGCAGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1169317910 Original CRISPR TAGCCTGGTGAGGAGGTTGC AGG Intergenic
No off target data available for this crispr