ID: 1169321177

View in Genome Browser
Species Human (GRCh38)
Location 20:4634506-4634528
Sequence CTTGATTCCCATTCTGGAAG CGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 8 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1169321171_1169321177 21 Left 1169321171 20:4634462-4634484 CCAGCATTCAAACATCTCCCCCA No data
Right 1169321177 20:4634506-4634528 CTTGATTCCCATTCTGGAAGCGG No data
1169321169_1169321177 23 Left 1169321169 20:4634460-4634482 CCCCAGCATTCAAACATCTCCCC No data
Right 1169321177 20:4634506-4634528 CTTGATTCCCATTCTGGAAGCGG No data
1169321174_1169321177 2 Left 1169321174 20:4634481-4634503 CCCATCTTAAAAAAACAAAACTG No data
Right 1169321177 20:4634506-4634528 CTTGATTCCCATTCTGGAAGCGG No data
1169321173_1169321177 3 Left 1169321173 20:4634480-4634502 CCCCATCTTAAAAAAACAAAACT No data
Right 1169321177 20:4634506-4634528 CTTGATTCCCATTCTGGAAGCGG No data
1169321168_1169321177 26 Left 1169321168 20:4634457-4634479 CCTCCCCAGCATTCAAACATCTC No data
Right 1169321177 20:4634506-4634528 CTTGATTCCCATTCTGGAAGCGG No data
1169321170_1169321177 22 Left 1169321170 20:4634461-4634483 CCCAGCATTCAAACATCTCCCCC No data
Right 1169321177 20:4634506-4634528 CTTGATTCCCATTCTGGAAGCGG No data
1169321175_1169321177 1 Left 1169321175 20:4634482-4634504 CCATCTTAAAAAAACAAAACTGA No data
Right 1169321177 20:4634506-4634528 CTTGATTCCCATTCTGGAAGCGG No data
1169321172_1169321177 4 Left 1169321172 20:4634479-4634501 CCCCCATCTTAAAAAAACAAAAC No data
Right 1169321177 20:4634506-4634528 CTTGATTCCCATTCTGGAAGCGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1169321177 Original CRISPR CTTGATTCCCATTCTGGAAG CGG Intergenic
No off target data available for this crispr