ID: 1169322774

View in Genome Browser
Species Human (GRCh38)
Location 20:4647871-4647893
Sequence ACCAATGACAACCATACATA AGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 2 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1169322771_1169322774 -7 Left 1169322771 20:4647855-4647877 CCAACTCCCTGCACATACCAATG No data
Right 1169322774 20:4647871-4647893 ACCAATGACAACCATACATAAGG No data
1169322770_1169322774 0 Left 1169322770 20:4647848-4647870 CCTAGAGCCAACTCCCTGCACAT No data
Right 1169322774 20:4647871-4647893 ACCAATGACAACCATACATAAGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1169322774 Original CRISPR ACCAATGACAACCATACATA AGG Intergenic
No off target data available for this crispr