ID: 1169325139

View in Genome Browser
Species Human (GRCh38)
Location 20:4669682-4669704
Sequence CACCAACCATATAAGATCTA AGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 1 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1169325139_1169325140 2 Left 1169325139 20:4669682-4669704 CCTTAGATCTTATATGGTTGGTG No data
Right 1169325140 20:4669707-4669729 TGTATAATCTAGTAACATATAGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1169325139 Original CRISPR CACCAACCATATAAGATCTA AGG (reversed) Intergenic
No off target data available for this crispr