ID: 1169325140

View in Genome Browser
Species Human (GRCh38)
Location 20:4669707-4669729
Sequence TGTATAATCTAGTAACATAT AGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 5 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1169325134_1169325140 26 Left 1169325134 20:4669658-4669680 CCTGACTCTCTCTGCCTGGGTGT No data
Right 1169325140 20:4669707-4669729 TGTATAATCTAGTAACATATAGG No data
1169325135_1169325140 12 Left 1169325135 20:4669672-4669694 CCTGGGTGTCCCTTAGATCTTAT No data
Right 1169325140 20:4669707-4669729 TGTATAATCTAGTAACATATAGG No data
1169325133_1169325140 27 Left 1169325133 20:4669657-4669679 CCCTGACTCTCTCTGCCTGGGTG No data
Right 1169325140 20:4669707-4669729 TGTATAATCTAGTAACATATAGG No data
1169325139_1169325140 2 Left 1169325139 20:4669682-4669704 CCTTAGATCTTATATGGTTGGTG No data
Right 1169325140 20:4669707-4669729 TGTATAATCTAGTAACATATAGG No data
1169325138_1169325140 3 Left 1169325138 20:4669681-4669703 CCCTTAGATCTTATATGGTTGGT No data
Right 1169325140 20:4669707-4669729 TGTATAATCTAGTAACATATAGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1169325140 Original CRISPR TGTATAATCTAGTAACATAT AGG Intergenic
No off target data available for this crispr