ID: 1169327471

View in Genome Browser
Species Human (GRCh38)
Location 20:4687030-4687052
Sequence CGCGATGCCCAGAGGGTGCT TGG
Strand +
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 101
Summary {0: 1, 1: 0, 2: 2, 3: 10, 4: 88}

Found 6 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1169327462_1169327471 9 Left 1169327462 20:4686998-4687020 CCAGAACGCCCCTTGGCAAGGCC 0: 1
1: 0
2: 0
3: 9
4: 75
Right 1169327471 20:4687030-4687052 CGCGATGCCCAGAGGGTGCTTGG 0: 1
1: 0
2: 2
3: 10
4: 88
1169327466_1169327471 -1 Left 1169327466 20:4687008-4687030 CCTTGGCAAGGCCTGGCGCTTCC 0: 1
1: 0
2: 2
3: 19
4: 213
Right 1169327471 20:4687030-4687052 CGCGATGCCCAGAGGGTGCTTGG 0: 1
1: 0
2: 2
3: 10
4: 88
1169327465_1169327471 0 Left 1169327465 20:4687007-4687029 CCCTTGGCAAGGCCTGGCGCTTC 0: 1
1: 0
2: 2
3: 12
4: 142
Right 1169327471 20:4687030-4687052 CGCGATGCCCAGAGGGTGCTTGG 0: 1
1: 0
2: 2
3: 10
4: 88
1169327458_1169327471 22 Left 1169327458 20:4686985-4687007 CCGAGATCGGGGCCCAGAACGCC 0: 1
1: 0
2: 0
3: 6
4: 122
Right 1169327471 20:4687030-4687052 CGCGATGCCCAGAGGGTGCTTGG 0: 1
1: 0
2: 2
3: 10
4: 88
1169327464_1169327471 1 Left 1169327464 20:4687006-4687028 CCCCTTGGCAAGGCCTGGCGCTT 0: 1
1: 0
2: 0
3: 8
4: 112
Right 1169327471 20:4687030-4687052 CGCGATGCCCAGAGGGTGCTTGG 0: 1
1: 0
2: 2
3: 10
4: 88
1169327461_1169327471 10 Left 1169327461 20:4686997-4687019 CCCAGAACGCCCCTTGGCAAGGC 0: 1
1: 0
2: 0
3: 6
4: 74
Right 1169327471 20:4687030-4687052 CGCGATGCCCAGAGGGTGCTTGG 0: 1
1: 0
2: 2
3: 10
4: 88

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1169327471 Original CRISPR CGCGATGCCCAGAGGGTGCT TGG Intronic
900332437 1:2142727-2142749 CCCGATGCCCACTGTGTGCTGGG + Intronic
900519153 1:3097365-3097387 CTGGAAGCCCAGAGTGTGCTGGG - Intronic
900626838 1:3612164-3612186 GGGGATGCCCAGAAGGTGGTTGG - Intergenic
900651527 1:3732397-3732419 TGTGGTGCCCAGAGGGTGTTGGG + Intronic
901630093 1:10643712-10643734 AGCGAGGCCCCGTGGGTGCTGGG - Intronic
902289661 1:15427845-15427867 TCCGAAGCCCAGAGGGTGGTGGG - Intronic
903206049 1:21783234-21783256 CGGGAGGCGCAGAGGCTGCTGGG - Exonic
903358581 1:22763020-22763042 CTCGAGGCCCAGAGAGTGCTGGG + Intronic
906476711 1:46174340-46174362 CACCATGCCCAGACGGTGCTGGG - Intronic
913453419 1:119007845-119007867 CCCGACGCCCAGAGGGCGCTTGG + Intergenic
914885038 1:151577732-151577754 CGCCATGCCCAGTTGGAGCTGGG - Intronic
915939857 1:160112251-160112273 AGAGATGCCCAGAGGGGGGTTGG + Intergenic
917233705 1:172866351-172866373 CACGAAGCCCAGATGGAGCTGGG + Intergenic
923414111 1:233738127-233738149 CCTGATGCCCAGAATGTGCTTGG - Intergenic
1063557378 10:7093716-7093738 AGCGATGCCCATAGGGTCTTAGG - Intergenic
1064171793 10:13040211-13040233 CACGATACCCAGATTGTGCTTGG + Intronic
1064733392 10:18356257-18356279 CGTGATGCAAAGTGGGTGCTGGG - Intronic
1074001506 10:109378290-109378312 CACTATGCACAGAGAGTGCTAGG + Intergenic
1075726391 10:124612965-124612987 CTGGAGGCCCAGAGGGAGCTGGG + Intronic
1077470990 11:2760494-2760516 CGTGCTGCCCAGCGGGGGCTTGG - Intronic
1077496390 11:2888609-2888631 TGCGGTGTGCAGAGGGTGCTTGG - Exonic
1083853097 11:65379145-65379167 GGCAGTGCCAAGAGGGTGCTGGG - Intronic
1090839553 11:130476301-130476323 CGCGATGGGCAGAGGAGGCTAGG - Exonic
1090858713 11:130634232-130634254 AGGGATGCCCAGAGGATTCTGGG - Intergenic
1091316160 11:134615477-134615499 CTCAGAGCCCAGAGGGTGCTGGG - Intergenic
1095481444 12:42640305-42640327 CACGATGCCCATAGGGTGCTGGG + Intergenic
1096269237 12:50151120-50151142 GGGGAAGGCCAGAGGGTGCTAGG - Intronic
1096627648 12:52905138-52905160 GGCTAGGCCCAGAGGGGGCTGGG + Intronic
1097691519 12:62738828-62738850 AGGGATGCCCAGAGGCTTCTTGG - Intronic
1101815211 12:108140846-108140868 CACGATGCCCAGGGGGTGGGAGG - Intronic
1106362017 13:29039394-29039416 CCCTATGGCCAGAGGGTGCCCGG - Intronic
1107553316 13:41496570-41496592 CTCTATGCCCAGAGGCTGCAGGG + Intergenic
1107964131 13:45584560-45584582 CCAGATCCCCAGAGGATGCTTGG - Intronic
1113596922 13:111540045-111540067 AGCGGTGCCCTGGGGGTGCTGGG - Intergenic
1113922332 13:113920093-113920115 TGCCATGCCCTGAGTGTGCTGGG + Intergenic
1117448520 14:55828164-55828186 CTCGATGGCCTGAGGGTGCTGGG - Intergenic
1122811523 14:104291735-104291757 AGCGAGGCCTGGAGGGTGCTGGG - Intergenic
1123995972 15:25718331-25718353 GGTGGTGCCCAGAGGGGGCTCGG - Exonic
1130064746 15:80594416-80594438 GGCCATGACCAGAGGTTGCTCGG + Exonic
1132549160 16:547258-547280 GGCGGAGCCCAGAGGGGGCTGGG + Exonic
1136124640 16:28169091-28169113 CGTGAGGCCCTGAGGGTGCCGGG - Intronic
1136347349 16:29684681-29684703 GGTGGTGCCCAGAGGGTGGTAGG - Intronic
1139121534 16:64024340-64024362 CCCTATGCCCAGTGGGTACTTGG + Intergenic
1139851441 16:69953176-69953198 CTAGAGGCCCGGAGGGTGCTCGG - Intronic
1139880418 16:70176088-70176110 CTAGAGGCCCGGAGGGTGCTCGG - Intronic
1140372092 16:74419429-74419451 CTAGAGGCCCGGAGGGTGCTCGG + Intronic
1141497006 16:84417152-84417174 GGTGATGCCCATAGGGTACTTGG + Intronic
1142112948 16:88341791-88341813 TGCCATGCCCAGTGGGGGCTGGG + Intergenic
1146716310 17:35089361-35089383 CGCGATCCCGAGAGGGGGCGGGG - Intronic
1150213376 17:63453778-63453800 CGTGAGCCCCAGGGGGTGCTTGG - Intergenic
1154355981 18:13623592-13623614 CACGATGACCAGAGGCAGCTCGG + Intronic
1157466698 18:47953536-47953558 CTCAATGCACAGATGGTGCTGGG - Intergenic
1160527667 18:79546948-79546970 CACGATGCCCAGAGCGAGCGTGG - Intergenic
1160961854 19:1725700-1725722 CGCGCGGCCCGGAGGGGGCTCGG - Intergenic
1168121438 19:54254398-54254420 TGGGATCCCCAGAGGGTCCTGGG + Exonic
1168722005 19:58559324-58559346 TGCGTTACCCAGAGGGTGCGAGG + Intergenic
926697793 2:15782782-15782804 CGGGGTACCCAGAGGCTGCTTGG + Intergenic
942278529 2:174340298-174340320 CTGGAGGCCCAGAGGGTGCCTGG + Intergenic
948943998 2:241210224-241210246 GGCCATGGCCTGAGGGTGCTGGG + Intronic
1168806929 20:676936-676958 CCCCCTGCCCAGAGGGTGCTGGG + Intergenic
1168855583 20:1005443-1005465 CAAGATGCTCAGAGGGTGTTTGG + Intergenic
1169327471 20:4687030-4687052 CGCGATGCCCAGAGGGTGCTTGG + Intronic
1172965469 20:38831287-38831309 CGTGAGACCCAGAGGGTGATGGG - Intronic
1173519269 20:43687011-43687033 TGCGAGGCCCACAAGGTGCTGGG + Exonic
1174195429 20:48769436-48769458 CCCCATGCCTAGTGGGTGCTGGG - Intronic
1175422800 20:58845912-58845934 GGCTATGCCCAGTGGGAGCTGGG - Intronic
1175762545 20:61571394-61571416 CTTGATGCCCAGAGGGTACCTGG + Intronic
1178916359 21:36707704-36707726 CGCGATGCCCAGGGCGTTCCCGG + Intronic
1179476990 21:41653322-41653344 GGTGATGCCTAGAGGGTGCAGGG - Intergenic
1181311381 22:21946655-21946677 AGGGATCCCCAGAGGCTGCTGGG + Intronic
1183064269 22:35352779-35352801 CACGGTGCACAGAGGGTGCAGGG - Intergenic
1183378379 22:37478338-37478360 CCTGATGCCCAGGGGGTCCTGGG + Intronic
1183981051 22:41540457-41540479 AGAGATGGCCAGAGGGTGGTGGG - Intronic
950171130 3:10839710-10839732 TGCAATGCCCAGAGGCTACTGGG - Intronic
954843450 3:53533589-53533611 TGGGATTCCCAGAGGGTGCAGGG + Intronic
968271553 3:197407250-197407272 TGCGATCCCCAGAGGGCTCTGGG + Intergenic
969713071 4:8855495-8855517 CTCGACCCCCAGAGTGTGCTAGG - Intronic
974646849 4:64705447-64705469 CACCATGCCCAGAGGGTTCTAGG - Intergenic
975192463 4:71481172-71481194 CACTATGCTCAGAAGGTGCTGGG + Intronic
975914980 4:79313819-79313841 CAAGATGCCCAGATGGTGATGGG + Intronic
985545359 5:506331-506353 CGGGCTGCGGAGAGGGTGCTGGG + Intronic
986607725 5:9538797-9538819 CGCCAGGGCCAGTGGGTGCTAGG - Intronic
1001652787 5:173327670-173327692 CGGGAGGCCCAGAGGGTCCCCGG - Intronic
1009479958 6:64144477-64144499 AGTGAGGCCCAGAGTGTGCTTGG + Intronic
1010307658 6:74343569-74343591 CGCGTGGCTCAGAGGGTCCTAGG - Intergenic
1012939320 6:105400857-105400879 CGCAATGCCCAGCTGATGCTGGG + Intronic
1013463489 6:110398164-110398186 GGTGATGACCAGAGGATGCTGGG - Intronic
1019520405 7:1458353-1458375 CGCTTTGCCCAGAAGGTGCCTGG + Intronic
1022332048 7:29389157-29389179 CCCGTTGCTCAGAGCGTGCTGGG + Intronic
1029114576 7:98230712-98230734 CCCGATGCTCAGAGGCTGCTGGG + Intronic
1031504125 7:122559818-122559840 GGTGGTGCCCAGAGGGTTCTCGG - Intronic
1032082884 7:128868978-128869000 AGCAATGACCAGAGGGTGCTGGG + Intronic
1035021346 7:155802915-155802937 CGCCATGCCCAGCGGGTGCAGGG + Exonic
1038636675 8:29292932-29292954 CTCAATGCCAAGAGGGTGCTGGG - Intergenic
1040015552 8:42696292-42696314 TGAGACACCCAGAGGGTGCTCGG - Intergenic
1049570022 8:143365300-143365322 CCCCTTGCCCAGTGGGTGCTGGG - Intergenic
1053043153 9:34891661-34891683 GACCATGCCCAGAGGCTGCTAGG - Intergenic
1055530405 9:77177778-77177800 CCAGATGCCCAGAGAGAGCTGGG - Exonic
1059963993 9:119595449-119595471 CTCCATGACCAGAGGGTGTTTGG + Intergenic
1062254914 9:135616350-135616372 GGCGATGCCCAGGGGGTGCTGGG - Intergenic
1062612345 9:137380654-137380676 GGGGATGCCCAGAGGGGGGTTGG - Intronic