ID: 1169327488

View in Genome Browser
Species Human (GRCh38)
Location 20:4687072-4687094
Sequence GCTCCCGGAACTCCCCCGGC GGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 123
Summary {0: 1, 1: 0, 2: 0, 3: 7, 4: 115}

Found 4 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1169327488_1169327501 22 Left 1169327488 20:4687072-4687094 CCCGCCGGGGGAGTTCCGGGAGC 0: 1
1: 0
2: 0
3: 7
4: 115
Right 1169327501 20:4687117-4687139 GCAGCGTTCCTCCCGGGAGGCGG No data
1169327488_1169327498 15 Left 1169327488 20:4687072-4687094 CCCGCCGGGGGAGTTCCGGGAGC 0: 1
1: 0
2: 0
3: 7
4: 115
Right 1169327498 20:4687110-4687132 CGCAGCTGCAGCGTTCCTCCCGG 0: 1
1: 0
2: 0
3: 12
4: 94
1169327488_1169327500 19 Left 1169327488 20:4687072-4687094 CCCGCCGGGGGAGTTCCGGGAGC 0: 1
1: 0
2: 0
3: 7
4: 115
Right 1169327500 20:4687114-4687136 GCTGCAGCGTTCCTCCCGGGAGG 0: 1
1: 0
2: 2
3: 12
4: 113
1169327488_1169327499 16 Left 1169327488 20:4687072-4687094 CCCGCCGGGGGAGTTCCGGGAGC 0: 1
1: 0
2: 0
3: 7
4: 115
Right 1169327499 20:4687111-4687133 GCAGCTGCAGCGTTCCTCCCGGG 0: 1
1: 0
2: 2
3: 33
4: 209

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1169327488 Original CRISPR GCTCCCGGAACTCCCCCGGC GGG (reversed) Intronic
900146800 1:1162120-1162142 GCTCCCGGAACATCCCCATCTGG - Intergenic
900214161 1:1472207-1472229 GCCCCCGGAGCACCCCCGGCCGG + Intronic
900221710 1:1512591-1512613 GCCCCCGGAGCACCCCCGGCCGG + Intronic
901256020 1:7827399-7827421 GCCCCCGGAACTGCACCGGAAGG + Exonic
902386361 1:16078173-16078195 GCCCCTGGAACCCCCCAGGCAGG - Intergenic
903263498 1:22143301-22143323 GCTCCCGGGGCCTCCCCGGCTGG + Intronic
905044448 1:34985021-34985043 ACTCGAGGAACTCCCCAGGCAGG + Intronic
907241873 1:53085376-53085398 GCACCCGGAACTTCCCCCACAGG - Exonic
907450376 1:54542362-54542384 GCTCCCCGGACGCCCCCAGCGGG + Intronic
907905912 1:58783740-58783762 GCTCGCCGACTTCCCCCGGCGGG + Exonic
914713468 1:150235399-150235421 GCTCCCGGCACTCCTCCTCCTGG - Intronic
916716992 1:167455000-167455022 CCTCCCGGAGCTCCCCGAGCCGG + Intronic
1064048986 10:12043606-12043628 GCTTCTGGAAATCCCCCCGCAGG - Intergenic
1072591457 10:96832180-96832202 GCCCCCGCACCGCCCCCGGCAGG + Intergenic
1072679936 10:97499076-97499098 GCTCCCCGATCTCCCCCCGGGGG - Exonic
1076729935 10:132433207-132433229 CCTCCCGGTCCTCCCCCAGCCGG - Intergenic
1076871026 10:133195265-133195287 GCTCCCGGAAGCCCCCCGACTGG - Intronic
1081528370 11:43942417-43942439 TCTCCCGGAACCCCCGCGGGCGG + Exonic
1084604080 11:70162393-70162415 GCTCCAGGTGCTCCCACGGCAGG + Intronic
1085022350 11:73217733-73217755 GCTCCCTGAACTCCCCACTCTGG - Intergenic
1090995747 11:131864383-131864405 GGTCCAGGAACTCCTCCCGCTGG + Intronic
1101716721 12:107318764-107318786 CCTCCCGGAACTGCCGCCGCTGG - Exonic
1102453381 12:113057165-113057187 GCACCCGGCATCCCCCCGGCAGG + Intronic
1103891639 12:124243316-124243338 GCTCCTGGTACTTCCTCGGCTGG - Intronic
1104215080 12:126726765-126726787 GCTCCCGCCACTGCCCGGGCTGG - Intergenic
1105472196 13:20704100-20704122 GCTCCAGTAGCTCCTCCGGCCGG - Exonic
1106400793 13:29428427-29428449 GCTCCCAGCCCTCCCCTGGCGGG - Intronic
1112314379 13:98348446-98348468 GCTCCCGGAACTCGCCCCCATGG - Intronic
1113739862 13:112704095-112704117 CCTCCCGTGACTCCCCCGCCTGG - Intronic
1115906484 14:38208617-38208639 GGGCCCGGAACTTCCCTGGCGGG + Intronic
1117882713 14:60327956-60327978 GCTCCCGGAGGTCCTCCCGCAGG - Intergenic
1124370970 15:29104396-29104418 GCTCCCGGAGCTCGCCAAGCAGG - Intronic
1134595906 16:15495817-15495839 CCTCCCAGAACTCCCTTGGCTGG - Intronic
1135968079 16:27052161-27052183 GCTCCCGGCATTCTCCGGGCAGG - Intergenic
1137388281 16:48060092-48060114 GGACCCGGATCTCTCCCGGCCGG + Intergenic
1138655318 16:58487979-58488001 CCTGCCGGAACTCCCCCCACAGG - Intronic
1139433971 16:66925691-66925713 GCTACCGCTACTCCCCTGGCGGG - Intergenic
1142366718 16:89654044-89654066 GCTCCCCGAAGGCCCCAGGCAGG - Intronic
1142876262 17:2853554-2853576 GCTCCCGGGACCCCCCTGCCCGG - Intronic
1143007383 17:3845931-3845953 GCTCCCTTGACTTCCCCGGCTGG + Intronic
1143083305 17:4397181-4397203 CCACCCTGGACTCCCCCGGCAGG - Intergenic
1143483307 17:7239138-7239160 CCTCCCCGAACTCCCCCGCTGGG + Intronic
1144828813 17:18120849-18120871 GCTCTCGGGCCTGCCCCGGCCGG + Exonic
1145047577 17:19630074-19630096 GCTCCTGGGACTCCTCTGGCTGG + Intergenic
1150675765 17:67245079-67245101 GCTCCCGGAGCTCTCCGGGGAGG - Intronic
1150840416 17:68601143-68601165 GCTCCCGCGACTCCTCCTGCGGG + Exonic
1151385721 17:73754031-73754053 GGGCCCGGAAGTCCCCCAGCTGG + Intergenic
1151848608 17:76675819-76675841 GCTCCCGAAAAACCCCTGGCAGG + Exonic
1152135771 17:78502487-78502509 GCTCCAGGTACTCGCCCGGCAGG + Intronic
1152181639 17:78825788-78825810 GCTCGCTGCACTCCCCCTGCAGG + Intronic
1152708872 17:81860321-81860343 GCTCACAGAACTCCACCAGCAGG + Exonic
1160810066 19:1009404-1009426 GCTCCTGCAGCTCCCCGGGCTGG - Exonic
1161468301 19:4444191-4444213 GCCCCCGGCACTGCCCCAGCTGG - Intronic
1163550919 19:17966238-17966260 GCTCCAGGAAGCCCCCAGGCTGG + Intronic
1165895174 19:39136936-39136958 GCCCCCTGCACTCCCCCGCCGGG - Intronic
1166809651 19:45507710-45507732 GCTCCCGGGGCGCCCCTGGCTGG - Exonic
1167228897 19:48269171-48269193 GCTCCTGGAGCTCCCCAGGAAGG - Intronic
1167233074 19:48297503-48297525 GCTCCTGGAGCTCCACCTGCAGG + Exonic
1167320904 19:48796703-48796725 CCACCCGGAACTCACCCTGCAGG + Exonic
1167696222 19:51017010-51017032 TCTCTCGGAACTCCCACAGCTGG - Intronic
1168176841 19:54632808-54632830 ACTACCTGAGCTCCCCCGGCAGG - Intronic
1168309289 19:55452490-55452512 GGTCCCGGAACTCCTGCGTCTGG + Intergenic
927087601 2:19687267-19687289 GTTGCAGGAACTCCCCTGGCTGG + Intergenic
933728083 2:85437702-85437724 GCGCCCGGAACACCCCGTGCCGG + Intergenic
937451165 2:122003100-122003122 GCTCCCGGGACTCCATGGGCTGG - Intergenic
940453694 2:153871741-153871763 GCTCCCGCTCCTCCCCGGGCTGG - Intergenic
940945707 2:159615654-159615676 GATCCAGAAACTACCCCGGCAGG + Intronic
948478988 2:238238996-238239018 GATCCCGGAGCGCCCCCCGCAGG + Exonic
948846482 2:240685179-240685201 CCTCCCTGAACTTCCCCAGCAGG + Intergenic
948847380 2:240689554-240689576 CCTCCCTGAACTTCCCCAGCAGG - Intergenic
948902748 2:240964604-240964626 GCTCCGGGAACTCCACAGACAGG + Intronic
1169044424 20:2524647-2524669 GCCCCCTGGGCTCCCCCGGCGGG - Intronic
1169244598 20:4015586-4015608 GCGCCCGCCCCTCCCCCGGCGGG - Intergenic
1169248052 20:4039171-4039193 GCTCCCAGAAATCCCCTTGCTGG - Intergenic
1169327488 20:4687072-4687094 GCTCCCGGAACTCCCCCGGCGGG - Intronic
1170953428 20:20956748-20956770 GCTCCCTGAACTCCTGCCGCAGG + Intergenic
1172284675 20:33732223-33732245 GGCCCCGGAGCTCCCCCGCCGGG - Intronic
1173645651 20:44631638-44631660 GCCCCCAGAACTCCACCTGCGGG + Intronic
1174870190 20:54174288-54174310 CCTCCCCGCCCTCCCCCGGCGGG + Intergenic
1183057278 22:35314675-35314697 CCTCCCTGAGCTCCACCGGCAGG - Intronic
1183504616 22:38202318-38202340 GCTCCCGGAGCTCCATCGCCCGG + Intronic
1183979335 22:41530582-41530604 GCTCTGGGATCTCCCCCAGCAGG - Intronic
1185054311 22:48570064-48570086 GCTCCCCACACTCCCCTGGCAGG + Intronic
950668017 3:14509074-14509096 GCTCCTGGAGCGCCCCCTGCTGG - Intronic
953929472 3:46998780-46998802 GCACCAGGAACTCCCTCGCCAGG - Exonic
957350726 3:79019312-79019334 GCTCCCGGCTCTCCCCGGGGTGG + Intronic
960586122 3:119322870-119322892 GCACCCGGGACCCCCGCGGCCGG - Intronic
961423697 3:126828477-126828499 GCTCCCGGAACTGACGCAGCTGG + Intronic
966448991 3:180036729-180036751 GCTCCGGGTACTCGGCCGGCCGG + Exonic
966872822 3:184302712-184302734 GCTCCAGGAACACCCCATGCCGG - Exonic
969627060 4:8311069-8311091 GCTCCAGGGACACCCCAGGCAGG + Intergenic
979293483 4:119003860-119003882 GCTCCCGGAACTCTGGCAGCTGG - Intronic
980923930 4:139115424-139115446 GCCTCCGGGACGCCCCCGGCTGG + Intronic
982274225 4:153622991-153623013 GCTCCCCCAGCTGCCCCGGCTGG - Exonic
985129281 4:186724636-186724658 GCTCCGAGAACTCCCCGCGCCGG + Intronic
986311713 5:6556186-6556208 ACTCCCCAAACTCCCCAGGCAGG - Intergenic
992487411 5:77210344-77210366 GCTCCCGGAGCTCTCCCGACAGG - Intergenic
993095211 5:83472644-83472666 GATCCTGCACCTCCCCCGGCCGG - Intronic
994184519 5:96803542-96803564 GGTCCTGGAACACCCCCGTCAGG - Exonic
997953935 5:138263975-138263997 GTTCCAGGAACTCCCCAGGTTGG + Intronic
1000614479 5:163412304-163412326 GCCCCCGGAACTCACCAGTCTGG + Intergenic
1007414196 6:41682690-41682712 GCTCCGGGAAGTCCCAAGGCCGG - Intergenic
1011700603 6:89951104-89951126 GCTCCTGGATCTCTCCAGGCAGG + Exonic
1017957443 6:159190217-159190239 GCTCCCTGAACATCCCCAGCTGG - Intronic
1019562597 7:1665972-1665994 CCTCCCGGAGCCCGCCCGGCTGG - Intergenic
1021668749 7:23013932-23013954 GCTGCCGGAGCTCCACCTGCAGG + Exonic
1030168580 7:106579137-106579159 GCGCCCGGCACCCCCCCGCCCGG - Intergenic
1032125216 7:129188678-129188700 GCCCCCCGAACTCTCCCCGCCGG - Intergenic
1034147232 7:148884119-148884141 ACTCCCGGAGCCCCGCCGGCCGG + Intronic
1034335882 7:150323336-150323358 GCTCCCGGAACGCGCCCAGGGGG - Exonic
1034979469 7:155467015-155467037 GCTCCCGAAGCGCCCCCGGGAGG + Intergenic
1042183227 8:66112748-66112770 GGTCTCGGAACGCCCCCGGCAGG - Intergenic
1049570579 8:143368643-143368665 GCGGCCGGAACGCCCGCGGCTGG - Intergenic
1049762627 8:144337980-144338002 GCTCCCGGCACACCCGCGCCCGG - Intergenic
1056803570 9:89711125-89711147 GCTGCCTGGACTCCCCCGACCGG - Intergenic
1057167818 9:92942258-92942280 GCTCCAGAAACTCCCTCGGGGGG - Intergenic
1062289756 9:135789246-135789268 GCTCACAGGACTCCCGCGGCAGG + Intronic
1062459481 9:136656921-136656943 GCCCCCAGATCTCCCCAGGCGGG + Intergenic
1062572500 9:137192060-137192082 GCTTCCGGGACTCCCACAGCTGG + Exonic
1062583844 9:137240308-137240330 GCGCCCAGACCTCCCTCGGCGGG - Intergenic
1187698166 X:21941108-21941130 GCACCCGGGACTGCCCCTGCAGG - Intronic
1200147261 X:153932692-153932714 GCTCCCGGCTCTCCCCCAGCTGG - Intronic
1200732883 Y:6761409-6761431 GCTCCTGCAGCTCCCCAGGCTGG + Intergenic