ID: 1169330409

View in Genome Browser
Species Human (GRCh38)
Location 20:4711720-4711742
Sequence CTGTGGATTAGTGGTTGCCG GGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 1 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1169330404_1169330409 5 Left 1169330404 20:4711692-4711714 CCAGAAAGGGCAAATCTGTAGAA No data
Right 1169330409 20:4711720-4711742 CTGTGGATTAGTGGTTGCCGGGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1169330409 Original CRISPR CTGTGGATTAGTGGTTGCCG GGG Intergenic
No off target data available for this crispr